CN105067695B - The unmarked okadaic acid sensor grown based on nanogold self-catalysis - Google Patents
The unmarked okadaic acid sensor grown based on nanogold self-catalysis Download PDFInfo
- Publication number
- CN105067695B CN105067695B CN201510482063.XA CN201510482063A CN105067695B CN 105067695 B CN105067695 B CN 105067695B CN 201510482063 A CN201510482063 A CN 201510482063A CN 105067695 B CN105067695 B CN 105067695B
- Authority
- CN
- China
- Prior art keywords
- electrode
- comb
- aptamers
- pad
- nanogold
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a kind of unmarked okadaic acid sensor grown based on nanogold self-catalysis.Okadaic acid (OA) sensor, which has, has nanogold particle and OA aptamers in the interdigital microelectrode of silica substrate and a pair of comb teeth-shapeds, electrode gap.Amino is modified in microelectrode gap by silanization treatment；Nanogold particle after amino electrostatical binding with being fixed in microelectrode gap；OA aptamers can be modified in microelectrode gap, so as to complete the preparation of OA sensors with nanogold particle electrostatical binding.OA molecules can be specifically bound with OA aptamers, cause the structure change of OA aptamers, expose the avtive spot of nanogold particle.In the mixed solution of glucose and gold chloride, self-catalysis growth occurs for the avtive spot of nanogold particle, causes the change of the conductance signal at interdigital microelectrode two ends, so that indirect measuring goes out OA concentration.OA quick, markless detection can be realized using the present invention.
Description
Technical field
Nanogold self-catalysis is based on the present invention relates to okadaic acid sensor detecting field, more particularly to one kind
The unmarked okadaic acid sensor of growth.
Background technology
Okadaic acid (OA) is the metabolite of marine algae, eats or takes the photograph in the filter of shellfish, fish and other animals
During food, it is transferred to by food in their stomach or esophagus, through stomach and intestinal digestion, absorbs and cause products of the OA in shellfish body
It is tired.OA is the derivative of fatty acid of multicyclic polyether class, is the major virulent factor of diarrhetic shellfish poison, is cooked for general heating
Reason toxin is mediated still relatively to stablize.Having proven to OA has strong rush tumour and carcinogenesis.So to them from sanitation point
Detected especially important.
On OA detections, mainly there is a bioanalysis, predominantly mouse method, there is low sensitivity, accuracy and repeatability
The problem of difference, poor specificity；Chemical apparatuses analytic approach, such as chromatography of gases, liquid chromatogram and liquid-matter combination (LC-MS)
Deng, although detection characteristic is good, but instrument build is larger, and maintenance cost is higher.And immunoassay, protein phosphatase enzyme level method and
Biosensor technology, with simple to operate, sensitivity it is high, be adapted to the quick screening of field monitoring and batch samples, be not required to
Complicated and expensive instrument and equipment is wanted, and easily realizes automatic detection, therefore with larger development and application prospect.Wherein,
Biosensor technology is main based on immunology or phosphoprotein phosphatase rejection characteristic, with it is easy to operate, reusable,
The advantages of continuous on-line monitoring can be achieved, is also evolving and updates in the research of OA context of detection.
Biosensor technology is needed using the material to OA with specific recognition capability as sensitive material.At present
Can be single-stranded to the artificial aptamers DNA of OA specific recognitions through successfully preparing and filtering out.OA aptamers preparation cost is relatively low, favorably
In the cost of reduction biology sensor, so as to contribute to penetration and promotion application and the Novel Biosensor of biology sensor
Exploitation.
The content of the invention
The purpose of the present invention is that there is provided a kind of sensor for detecting okadaic acid in view of the shortcomings of the prior art.
The purpose of the present invention is achieved through the following technical solutions：It is a kind of based on nanogold self-catalysis grow without mark
Remember okadaic acid sensor, including：Silica substrate, the first comb-like electrode, the second comb-like electrode, first are drawn
Line, the second lead, the first pad, the second pad, the first wire, the second wire, nanogold particle, OA aptamers；Wherein, first
Comb-like electrode, the second comb-like electrode, the first lead, the second lead, the first pad and the second pad are attached to silica
In substrate；The comb-tooth-like portion staggered parallel arrangement of first comb-like electrode and the second comb-like electrode, forms an interdigital electricity
It is extremely right；First comb-like electrode is sequentially connected logical with the first lead, the first pad, the first wire；Second comb-like electrode and
Two leads, the second pad, the second wire are sequentially connected logical；Nanogold particle is fixed on the first comb-like electrode and the second comb teeth-shaped
In gap between electrode；OA aptamers are fixed on the surface of nanogold particle；First comb-like electrode and the second broach
The width of shape electrode and the spacing of broach are micron order, and material is conducting metal；The OA aptamers (11) have such as SEQ
DNA sequence dna shown in ID NO.1.OA aptamers can be combined and tied with OA lps molecules as the sensitive material of sensor
Structure changes, with specific recognition capability.
A kind of preparation method of the unmarked okadaic acid sensor grown based on nanogold self-catalysis, including it is following
Step：
(1) interdigital electrode pair is prepared：Spin coating photoresist on silicon oxide substrates, after exposed development, magnetron sputtering
Adhesion layer thick 20nm, then 150~200nm of magnetron sputtering deposition a layer thickness metal levels, then by the first comb-like electrode,
Metal level beyond second comb-like electrode, the first lead, the second lead, the first pad, the second pad is peeled off；
(2) fixed nanogold particle：By silica substrate soaking and washing in ethanol, then N2Dry；By titanium dioxide
Silicon base is in Piranha washing lotion (H2SO4/H2O2=3:Soaking and washing in 1v/v), the then soaking and washing in ultra-pure water, then N2It is dry
It is dry；The ethanol solution that the volume fraction that silica substrate is immersed in into 3- aminopropyl triethoxysilanes (APTES) is 2.5%
In, soak 6 hours, then fully cleaned with ethanol solution, N under the conditions of 4 DEG C2Dry, then 30 points of the solidification under the conditions of 110 DEG C
Clock；Silica substrate is immersed in nano Au colloid liquid solution, soaked 2 hours under the conditions of 4 DEG C, it is then fully clear with ultra-pure water
Wash；Nanogold particle on being fixed in gap that can be between the first comb-like electrode and the second comb-like electrode；Wherein, anthropophagy
The purpose of fish washing lotion cleaning is the pollutant for removing silicon oxide substrate surface, makes hydroxyl on silica surface band, increase parent
It is aqueous；The purpose of APTES immersions is 3- aminopropyl triethoxysilanes molecule is passed through the hydroxy combining with silica surface
And silica and 3- aminopropyl-triethoxies can be strengthened in 30 minutes by modifying the solidification under the conditions of silica surface, 110 DEG C
The combination of Si-O keys between silane molecule；The purpose of nano Au colloid liquid solution immersion is to make nanogold particle and 3- aminopropyls three
Electrostatic Absorption occurs for the amino in Ethoxysilane molecule, so that nanogold particle is fixed on silicon oxide substrate surface；
(3) wire is bonded：The first wire is bonded at the first pad using conducting resinl, the second wire is bonded in second
At pad, then solidify 3 hours under the conditions of 60 DEG C；
(4) OA aptamers are modified：Prepare and contain 50mM Tris, 150mM NaCl, 2mM MgCl2, pH is 7.5 buffering
Solution；Using cushioning liquid as bottom liquid, 1 μM of OA adaptation liquid solutions are prepared；OA adaptation liquid solutions are added dropwise in sensor surface, in room
Temperature is lower to be incubated 30 minutes, and with nanogold particle Electrostatic Absorption occurs for OA aptamers, so that the OA adaptations in sensor surface modification
Body；Then cushioning liquid cleaning sensor surface is used, okadaic acid sensor is finally prepared；Sensor without using
When, it may be dipped in cushioning liquid, preserved under the conditions of being positioned over 4 DEG C, lost with preventing OA aptamers from occurring to degrade to OA
The identification function of lps molecule.
A kind of detection method of the unmarked okadaic acid sensor grown based on nanogold self-catalysis, including it is following
Step：
(1) OA lps molecules are incubated：Using containing 50mM Tris, 150mM NaCl, 2mM MgCl2, pH for 7.5 it is slow
Rush the OA solution that solution prepares various concentrations；OA solution is added dropwise in sensor surface, is incubated under the conditions of being then placed into 37 DEG C
30 minutes；OA lps molecules are incorporated into OA aptamers surface, and the structure of OA aptamers is changed；Then use successively
Cushioning liquid and ultra-pure water cleaning sensor surface；
(2) nanogold self-catalysis grows：Prepare the mixed solution containing 150mM glucose and 300 μM of gold chlorides；Will sensing
Device is immersed in mixed solution, is placed 2 hours under the conditions of 37 DEG C；In step (1), OA aptamers combine upper OA lps molecules
Afterwards, recurring structure changes, and will expose the avtive spot of a part of nanogold particle；The nanogold particle exposed will be catalyzed
Glucose in solution is aoxidized, and produces hydrogen peroxide, and hydrogen peroxide reduces the gold chloride in solution, exposed
The new gold of nanogold particle Surface Creation so that nanogold particle grows, diameter increase；
(3) signal detection：Sensor is cleaned with ultra-pure water, and uses N2Dry, then by the first wire and the second wire point
It is not connected on the working electrode and reference electrode of electrochemical workstation, reference electrode connects with to electrode again；Test is using linear
Voltammetry is scanned, on the working electrode (s application -0.3V~0.3V voltages, sweep speed 1mV/s, the sampling interval is 1mV, so that
To current-voltage characteristic curve；Characteristic slope is asked for, sensor conductance value is obtained；In order to reduce between different tests
Difference, conductance signal S after nanogold the is grown and conductance signal S before growth0It is compared, obtains relative change (S-
S0)/S0, test result will be turned to respect to change and OA concentration is fitted and obtains calibration curve；According to calibration curve and OA to be measured
The electric conductivity value of solution, you can try to achieve the concentration of OA solution to be measured, so as to complete the signal detection of sensor.
The beneficial effects of the invention are as follows：
(1) combined standard MEMS technology of the present invention, self-assembled film technology and adaptation body technique, are repaiied on microsensor surface
Adorn OA sensitive materials, it is easy to mass production, reduce cost, beneficial to multi-channel detection, improve detection efficiency；
(2) present invention plays signal amplification work using the self-catalysis growth of the nanogold particle in the gap of interdigital electrode pair
With microcosmic structure and morphology to be changed to the change for being converted into conductance signal, easy to operate, markless detection, under OA detection
Limit can reach 1ppb.
Brief description of the drawings
Fig. 1 is the structural representation of the unmarked okadaic acid sensor grown based on nanogold self-catalysis of the present invention
Figure；
Fig. 2 is the preparation method flow chart of the okadaic acid sensor of the present invention；
Fig. 3 is the detection method schematic diagram of the okadaic acid sensor of the present invention；
Fig. 4 passes through the modification of OA aptamers, OA identifications and nanogold growth for the okadaic acid sensor of the present invention
The change of current-voltage characteristic curve；
Fig. 5 is the calibration curve of the okadaic acid sensor of the present invention；
In figure, silica substrate 1, the first comb-like electrode 2, the second comb-like electrode 3, the first lead 4, the second lead
5th, the first pad 6, the second pad 7, the first wire 8, the second wire 9, nanogold particle 10, OA aptamers 11, adhesion layer 12.
Embodiment
The present invention is described in further detail with specific embodiment below in conjunction with the accompanying drawings.
As shown in figure 1, the unmarked okadaic acid sensor that the present invention is grown based on nanogold self-catalysis, in sensing
Modified nano gold particle 10 and OA aptamers 11 in the gap of the interdigital electrode pair of device, OA lps molecules are combined with OA aptamers 11
Cause the structure change of OA aptamers 11 afterwards, expose the avtive spot of nanogold particle 10, urged certainly by nanogold particle 10
Sensor conductance signal after metaplasia length can calculate OA concentration.The okadaic acid sensor of the present invention uses nothing
The detection method of mark, it includes：Silica substrate 1, the first comb-like electrode 2, the second comb-like electrode 3, the first lead
4th, the second lead 5, the first pad 6, the second pad 7, the first wire 8, the second wire 9, nanogold particle 10, OA aptamers 11；
Wherein, the first comb-like electrode 2, the second comb-like electrode 3, the first lead 4, the second lead 5, the first pad 6 and the second pad 7
It is attached in silica substrate 1；The comb-tooth-like portion staggered parallel row of first comb-like electrode 2 and the second comb-like electrode 3
Row, form an interdigital electrode pair；First comb-like electrode 2 is sequentially connected with the first lead 4, the first pad 6, the first wire 8
It is logical；Second comb-like electrode 3 is sequentially connected logical with the second lead 5, the second pad 7, the second wire 9；Nanogold particle 10 is fixed
In gap between the first comb-like electrode 2 and the second comb-like electrode 3；OA aptamers 11 are fixed on nanogold particle 10
Surface；The width of the comb-like electrode 3 of first comb-like electrode 2 and second and the spacing of broach are micron order, and material is
Conducting metal；The OA aptamers 11 have DNA sequence dna 5 ' -/
GGTCACCAACAACAGGGAGCGCTACGCGAAGGGTCAATGTGACGTCAT GCGGATGTGTGG/-3 ', such as SEQ ID
Shown in NO.1.OA aptamers 11 can be combined with OA lps molecules as the sensitive material of sensor and occur structural change, be had
Specific recognition capability.
The preparation method for the unmarked okadaic acid sensor that the present invention is grown based on nanogold self-catalysis, including with
Lower step：
(1) interdigital electrode pair is prepared：The spin coating photoresist in silica substrate 1, after exposed development, magnetron sputtering
Adhesion layer 12 thick 20nm, then 150~200nm of magnetron sputtering deposition a layer thickness metal levels, then electric by the first comb teeth-shaped
Metal level beyond pole 2, the second comb-like electrode 3, the first lead 4, the second lead 5, the first pad 6, the second pad 7 is shelled
From as shown in Fig. 2 a, b, c, d, e；
(2) fixed nanogold particle 10：By the soaking and washing in ethanol of silica substrate 1, then N2Dry；By dioxy
SiClx substrate 1 is in Piranha washing lotion (H2SO4/H2O2=3:Soaking and washing in 1v/v), the then soaking and washing in ultra-pure water, then N2
Dry；The ethanol that the volume fraction that silica substrate 1 is immersed in into 3- aminopropyl triethoxysilanes (APTES) is 2.5%
In solution, soak 6 hours, then fully cleaned with ethanol solution, N under the conditions of 4 DEG C2Dry, then solidify 30 under the conditions of 110 DEG C
Minute；Silica substrate 1 is immersed in nano Au colloid liquid solution, soaks 2 hours, is then filled with ultra-pure water under the conditions of 4 DEG C
Distinguish and wash；Nanogold particle 10 on being fixed in gap that can be between the first comb-like electrode 2 and the second comb-like electrode 3,
As shown in Fig. 2 f, g；Wherein, the purpose of Piranha washing lotion cleaning is the pollutant for removing the surface of silica substrate 1, makes dioxy
SiClx surface takes hydroxyl, increases hydrophily；APTES immersion purpose be make 3- aminopropyl triethoxysilanes molecule by with
The hydroxy combining of silica surface and modify in silica surface, under the conditions of 110 DEG C solidification can strengthen dioxy within 30 minutes
The combination of Si-O keys between SiClx and 3- aminopropyl triethoxysilane molecules；The purpose of nano Au colloid liquid solution immersion is to make
With the amino in 3- aminopropyl triethoxysilane molecules Electrostatic Absorption occurs for nanogold particle 10, so that nanogold particle 10
It is fixed on the surface of silica substrate 1；
(3) wire is bonded：The first wire 8 is bonded at the first pad 6 using conducting resinl, the second wire 9 is bonded in
At second pad 7, then solidify 3 hours under the conditions of 60 DEG C；
(4) modification OA aptamers 11：Prepare and contain 50mM Tris, 150mM NaCl, 2mM MgCl2, pH for 7.5 it is slow
Rush solution；Using cushioning liquid as bottom liquid, 1 μM of OA adaptation liquid solutions are prepared；OA adaptation liquid solutions are added dropwise in sensor surface,
It is incubated 30 minutes at room temperature, with nanogold particle 10 Electrostatic Absorption occurs for OA aptamers 11, so that in sensor surface modification
OA aptamers 11, as shown in fig. 2h；Then cushioning liquid cleaning sensor surface is used, okadaic acid biography is finally prepared
Sensor；Sensor when not in use, may be dipped in cushioning liquid, be preserved under the conditions of being positioned over 4 DEG C, to prevent OA aptamers
11 occur degraded and lose the identification function to OA lps molecules.
As shown in figure 3, the detection for the unmarked okadaic acid sensor that the present invention is grown based on nanogold self-catalysis
Method and the course of work are as follows：
(1) OA lps molecules are incubated：Using containing 50mM Tris, 150mM NaCl, 2mM MgCl2, pH for 7.5 it is slow
Rush the OA solution that solution prepares various concentrations；OA solution is added dropwise in sensor surface, is incubated under the conditions of being then placed into 37 DEG C
30 minutes；OA lps molecules are incorporated into the surface of OA aptamers 11, and the structure of OA aptamers 11 is changed；Then successively
Using cushioning liquid and ultra-pure water cleaning sensor surface；
(2) nanogold self-catalysis grows：Prepare the mixed solution containing 150mM glucose and 300 μM of gold chlorides；Will sensing
Device is immersed in mixed solution, is placed 2 hours under the conditions of 37 DEG C；In step (1), OA aptamers 11 combine upper OA toxin point
After son, recurring structure changes, and will expose the avtive spot of a part of nanogold particle 10；The nanogold particle 10 exposed
Glucose in catalytic solution is aoxidized, hydrogen peroxide is produced, hydrogen peroxide reduces the gold chloride in solution,
The new gold of the Surface Creation of nanogold particle 10 that exposes, so that nanogold particle 10 grows, diameter increase；
(3) signal detection：Sensor is cleaned with ultra-pure water, and uses N2Dry, then by the first wire 8 and the second wire 9
It is connected on respectively on the working electrode and reference electrode of electrochemical workstation, reference electrode connects with to electrode again；Test uses line
Property scanning voltammetry, application -0.3V~0.3V voltages, sweep speed 1mV/s on the working electrode (s, the sampling interval is 1mV so that
Current-voltage characteristic curve is obtained, as shown in Figure 4；Characteristic slope is asked for, sensor conductance value is obtained；In order to reduce
Difference between difference test, the conductance signal S and conductance signal S before growth after nanogold is grown0It is compared, obtains
Relative change (S-S0)/S0, test result will be turned to respect to change and OA concentration is fitted and obtains calibration curve, such as Fig. 5 institutes
Show；According to calibration curve and the electric conductivity value of OA solution to be measured, you can the concentration of OA solution to be measured is tried to achieve, so as to complete sensor
Signal detection.
Claims (1)
1. a kind of preparation method of the unmarked okadaic acid sensor grown based on nanogold self-catalysis, described unmarked
Okadaic acid sensor includes：Silica substrate (1), the first comb-like electrode (2), the second comb-like electrode (3),
One lead (4), the second lead (5), the first pad (6), the second pad (7), the first wire (8), the second wire (9), nanogold
Particle (10), OA aptamers (11)；Wherein, the first comb-like electrode (2), the second comb-like electrode (3), the first lead (4),
Two leads (5), the first pad (6) and the second pad (7) are attached in silica substrate (1)；First comb-like electrode (2) and
The comb-tooth-like portion staggered parallel arrangement of second comb-like electrode (3), forms an interdigital electrode pair；First comb-like electrode
(2) it is sequentially connected with the first lead (4), the first pad (6), the first wire (8) logical；Second comb-like electrode (3) draws with second
Line (5), the second pad (7), the second wire (9) are sequentially connected logical；Nanogold particle (10) is fixed on the first comb-like electrode (2)
And in the second gap between comb-like electrode (3)；OA aptamers (11) are fixed on the surface of nanogold particle (10)；Described
The spacing of the width and broach of one comb-like electrode (2) and the second comb-like electrode (3) is micron order, and material is conductive gold
Category；The OA aptamers (11) have the DNA sequence dna as shown in SEQ ID NO.1；Characterized in that, this method includes following step
Suddenly：
(1) interdigital electrode pair is prepared：The spin coating photoresist in silica substrate (1), after exposed development, magnetron sputtering 20nm
Thick adhesion layer (12), then 150~200nm of magnetron sputtering deposition a layer thickness metal levels, then by the first comb-like electrode
(2), the gold beyond the second comb-like electrode (3), the first lead (4), the second lead (5), the first pad (6), the second pad (7)
Category layer is peeled off；
(2) fixed nanogold particle：By silica substrate (1) soaking and washing in ethanol, then N2Dry；By silica
H in substrate (1) soaking and washing in Piranha washing lotion, Piranha washing lotion2SO4/H2O2=3:1v/v, then soaks in ultra-pure water
Bubble cleaning, then N2Dry；Silica substrate (1) is immersed in 3- aminopropyl triethoxysilanes (APTES) volume fraction
In 2.5% ethanol solution, to soak 6 hours, then fully being cleaned with ethanol solution, N under the conditions of 4 DEG C2Dry, then 110
Solidify 30 minutes under the conditions of DEG C；Silica substrate (1) is immersed in nano Au colloid liquid solution, 2 are soaked under the conditions of 4 DEG C small
When, then fully cleaned with ultra-pure water；Gap that can be between the first comb-like electrode (2) and the second comb-like electrode (3)
Nanogold particle (10) in middle fixation；
(3) wire is bonded：First wire (8) is bonded in by the first pad (6) place using conducting resinl, the second wire (9) is bonded
At the second pad (7) place, then solidify 3 hours under the conditions of 60 DEG C；
(4) OA aptamers are modified：Prepare and contain 50mM Tris, 150mM NaCl, 2mM MgCl2, pH is 7.5 cushioning liquid；
Using cushioning liquid as bottom liquid, 1 μM of OA adaptation liquid solutions are prepared；OA adaptation liquid solutions are added dropwise in sensor surface, at room temperature
It is incubated 30 minutes, with nanogold particle (10) Electrostatic Absorption occurs for OA aptamers (11), so that the OA in sensor surface modification
Aptamers (11)；Then cushioning liquid cleaning sensor surface is used, okadaic acid sensor is finally prepared；Sensor
When not in use, it is immersed in cushioning liquid, is preserved under the conditions of being positioned over 4 DEG C, prevents OA aptamers (11) from occurring to degrade
Lose the identification function to OA lps molecules.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510482063.XA CN105067695B (en) | 2015-08-03 | 2015-08-03 | The unmarked okadaic acid sensor grown based on nanogold self-catalysis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510482063.XA CN105067695B (en) | 2015-08-03 | 2015-08-03 | The unmarked okadaic acid sensor grown based on nanogold self-catalysis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105067695A CN105067695A (en) | 2015-11-18 |
| CN105067695B true CN105067695B (en) | 2017-10-03 |
Family
ID=54497117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510482063.XA Expired - Fee Related CN105067695B (en) | 2015-08-03 | 2015-08-03 | The unmarked okadaic acid sensor grown based on nanogold self-catalysis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105067695B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN205844251U (en) * | 2016-07-20 | 2016-12-28 | 广州易活生物科技有限公司 | Detector electrode structure and detection orifice plate |
| CN109632911A (en) * | 2019-01-16 | 2019-04-16 | 中国水产科学研究院黄海水产研究所 | A kind of disposable aptamer sensor and its detection okadaic acid method |
| CN112195098A (en) * | 2020-09-16 | 2021-01-08 | 西安交通大学 | Device and method for detecting OA (oral OA) based on piezoelectric aptamer sensor and AuNPs (AuNPs) label-free detection |
| CN113466303A (en) * | 2021-05-13 | 2021-10-01 | 中国十七冶集团有限公司 | Preparation method of pathogenic bacteria detection electrode in water environment of construction site |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103713035A (en) * | 2014-01-09 | 2014-04-09 | 中国水产科学研究院黄海水产研究所 | Electrochemical detection method of okadaic acid in shellfish |
| CN104630230A (en) * | 2015-01-06 | 2015-05-20 | 江南大学 | Group of nucleic acid aptamers for specifically recognizing okadaic acid |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009067521A1 (en) * | 2007-11-19 | 2009-05-28 | Florida Atlantic University | Microfluidic chips and systems for analyzing protein expression, and methods of use thereof |
-
2015
- 2015-08-03 CN CN201510482063.XA patent/CN105067695B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103713035A (en) * | 2014-01-09 | 2014-04-09 | 中国水产科学研究院黄海水产研究所 | Electrochemical detection method of okadaic acid in shellfish |
| CN104630230A (en) * | 2015-01-06 | 2015-05-20 | 江南大学 | Group of nucleic acid aptamers for specifically recognizing okadaic acid |
Non-Patent Citations (2)
| Title |
|---|
| Selection and Identification of DNA Aptamers against Okadaic Acid for Biosensing Application;Shimaa Eissa 等;《Analytical Chemistry》;20131029;第85卷;第11794-11789页 * |
| Self-Catalytic Growth of Unmodified Gold Nanoparticles as Conductive Bridges Mediated Gap-Electrical Signal Transduction for DNA Hybridization Detection;Jing Zhang 等;《Analytical Chemistry》;20131209;第86卷;第1178-1180页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105067695A (en) | 2015-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105067695B (en) | The unmarked okadaic acid sensor grown based on nanogold self-catalysis | |
| CN105842312B (en) | Nanometer flower-shaped ultramicro gold electrode and preparation and application thereof | |
| CN103343126B (en) | Ractopamine hydrochloride aptamers and the aptamers electrochemica biological sensor detecting Ractopamine hydrochloride | |
| CN108344788B (en) | Preparation method and application of electrochemical biosensor based on gold nanocages | |
| CN104152449B (en) | MiRNA capture probes and its modified electrode and capture probe complementary strand and its carbon nano-tube modified golden magnetic nanoparticle compound | |
| CN102944598A (en) | Preparation method and application of cell based sensor based on electrochemical reduction graphite oxide/gold nanoparticle composite membrane | |
| CN106841349A (en) | A kind of aptamer sensor for mercury ion detecting and its preparation method and application | |
| CN105385753B (en) | Electrochemical sensor and preparation method thereof based on aptamer detection isocarbophos | |
| CN103743804A (en) | Organic phosphorus electrochemical biosensor based on adsorption of nano particles | |
| CN106645354A (en) | Preparation method and application of heavy metal ion electrochemical sensor | |
| CN106442649A (en) | Method for detecting 1, 5-dehydrated glucose alcohol based on EIS structure electrochemical biosensor | |
| Bailey et al. | Carbon-fiber ultramicroelectrodes modified with conductive polymeric tetrakis (3-methoxy-4-hydroxyphenyl) porphyrin for determination of nickel in single biological cells | |
| CN104198554A (en) | Working electrode and preparation method thereof as well as biosensor | |
| CN108802148B (en) | Micro-fluidic paper chip for on-line monitoring of intracellular dopamine based on nano-gold modified silk-screen printing electrode | |
| Das et al. | Macroporous silicon based simple and efficient trapping platform for electrical detection of Salmonella typhimurium pathogens | |
| CN107655958B (en) | It is the Acetamiprid detection method for indicating probe based on ferronickel cyanide complex nano particle | |
| Lai et al. | Design and characterization of a 16× 16 CMOS capacitive DNA sensor array | |
| CN105911128A (en) | Enzyme-free glucose electrochemical sensor and application thereof | |
| CN107014878A (en) | A kind of preparation method of foam nickel electrode of carbon nanomaterial modification and application | |
| CN107449820A (en) | It is a kind of to be used to detect the modified electrode of hydroquinones and catechol in water sample simultaneously | |
| CN111007137A (en) | Method and equipment for detecting organic phosphorus | |
| CN106404864A (en) | Method for detecting methyl jasmonate in plants on basis of microelectrode biosensing technique | |
| CN107976476B (en) | Determination method of lactate dehydrogenase activity based on titanium dioxide thin film field effect transistor | |
| CN109668951A (en) | One kind being based on MoS2Electrochemical sensing method of-AuNPs-PPY the composite material without enzyme detection glucose | |
| CN109900767A (en) | A method of utilizing Electrochemical Detection chicken freshness |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Su Kaiqi Inventor after: Wang Ping Inventor after: Pan Yuxiang Inventor after: Gan Ying Inventor after: Wang Jun Inventor after: Zou Ling Inventor after: Wang Qin Inventor after: Fang Jiaru Inventor before: Wang Jun Inventor before: Wang Ping Inventor before: Zou Ling Inventor before: Wang Qin Inventor before: Fang Jiaru |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171003 Termination date: 20180803 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |