CN105063212B - Detect the kit of three kinds of serotype of campylobacter jejuni - Google Patents
Detect the kit of three kinds of serotype of campylobacter jejuni Download PDFInfo
- Publication number
- CN105063212B CN105063212B CN201510496268.3A CN201510496268A CN105063212B CN 105063212 B CN105063212 B CN 105063212B CN 201510496268 A CN201510496268 A CN 201510496268A CN 105063212 B CN105063212 B CN 105063212B
- Authority
- CN
- China
- Prior art keywords
- serotype
- campylobacter jejuni
- seq
- specific
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The present invention provides the kits of detection three kinds of serotype of campylobacter jejuni, belong to multiplex PCR detection technique field.Kit of the present invention contains three pairs of specific primers pair for being directed to campylobacter jejuni serotype HS:7, HS:37, HS:21 respectively, and nucleotide sequence is respectively as shown in SEQ ID NO.1-2, SEQ ID NO.3-4, SEQ ID NO.5-6.The present invention also provides the specific target sequences for detecting the above-mentioned three kinds of serotype of campylobacter jejuni, and nucleotide sequence is respectively as shown in SEQ ID NO.7,8,9.Establishing multiple PCR detection kit above-mentioned to campylobacter jejuni three kinds of serotype detection sensitivities, specificities the present invention is based on the distinguished sequence of each serotype of campylobacter jejuni is 100%, it is accurate with detection, save the cost, simple and rapid advantage have good clinical.
Description
Technical field
The present invention relates to PCR detection technique fields, more particularly to for detecting campylobacter jejuni serotype HS:7, HS:
37, for the specific primer of HS:21 to combination and triple PCR detection method, the invention further relates to detect campylobacter jejuni three simultaneously
The kit of kind serotype.
Background technique
Campylobacter jejuni (Campylobacter jejuni) is human diseases is mainly resulted in Campylobacter food-borne
Pathogen is one of the main pathogen for leading to mankind's diarrhea.Campylobacter jejuni is widely distributed, and human infection is mainly due to jejunum
Caused by Campylobacter spp contaminated food products, drinking water and environment, in addition to enteritis, the infection of campylobacter jejuni can lead to guillain-Barre
Syndrome (Guillian-Barre syndrome, abbreviation GBS), brings serious Disease Spectrum to the mankind.Both at home and abroad to jejunum
The monitoring of Campylobacter spp is all paid special attention to.
Serotype is one of biological typing method of campylobacter jejuni, at present the Penner based on heat stable antigen
Serotype (Penner heat-stable serotype, HS) analysis is the main classifying method of campylobacter jejuni.There is research
It was found that the bacterial strain of GBS and the serotype of bacterial strain is caused to have much relations after Cj infection.Certain particular serotype bacterial strains
The danger level of GBS is caused to increase after infection significantly.But since current serotype reagent is deficient, expensive, experimental procedure is cumbersome,
It needs experienced professional to operate, causes the difficulty of campylobacter jejuni serotype.Therefore there is an urgent need to a kind of quick, quasi-
Really, the method for campylobacter jejuni serotype specifically, is delicately detected.
Summary of the invention
The purpose of the present invention is to provide be used for while detecting three kinds of campylobacter jejuni (Campylobacter jejuni)
The specific primer of serotype HS:7, HS:37, HS:21 are to combination.
It is another object of the present invention to provide can detect campylobacter jejuni HS:7, HS:37, HS:21 serum simultaneously
The kit of type.
To achieve the above object, the present invention passes through to the capsular polysaccharide (polysaccharide for determining bacterial strain serotype
Capsule, abbreviation CPS) synthesis related gene cluster specific nucleotide sequence detection determine Campylobacter spp serotype feature.It is right
Tri- kinds of serotype campylobacter jejunis of HS:7, HS:37, HS:21 find out its common CPS synthetic gene cluster associated dna sequence respectively,
And it is different from the specific DNA sequence of other serotypes, BLAST comparison is carried out on NCBI, determination filters out these sequence needles
To the common point and specificity of above-mentioned three kinds of serological type strains.By comparing, HS:7, tri- kinds of serum of HS:37, HS:21 are obtained
Three sections of distinguished sequences being not present in the peculiar and other serological type strain of type bacterial strain: HS:7 serological type strain specific sequence name
For SE-HS7-1, HS:37 serological type strain distinguished sequence is named as SE-HS37-2, the name of HS:21 serological type strain distinguished sequence
For SE-HS21-1, specific nucleotide sequence is respectively as shown in SEQ ID NO.7-9.
HS:7, the distinguished sequence one of the CPS related gene of HS:37, HS:21 has been sequenced in the comparison of Vector NTI Suite 6
Conservative.And with 7 design primer of primer premier 5, Clone Manager 8 and Oligo, design of primers avoids sequence
The catastrophe point of column, while to consider between three pairs of designed primers and not mispairing between primer and target sequence not occur two
Level structure, and the length of the target fragment of three pairs of primer amplifications has difference degree, and size cannot be too close to.
It compares by verifying repeatedly, it is final to determine for detecting the specific primer of three kinds of serotype of campylobacter jejuni to group
It closes, is respectively as follows:
For detecting the specific primer pair of serotype HS:7, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.1, shown in 2；
For detecting the specific primer pair of serotype HS:37, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.3, shown in 4；
For detecting the specific primer pair of serotype HS:21, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.5, shown in 6.
Further, the present invention provides nucleotide sequence primer pairs as shown in SEQ ID NO.1-2 detects in preparation
Application in campylobacter jejuni serotype HS:7 kit or diagnostic reagent.
The present invention provides nucleotide sequence primer pairs as shown in SEQ ID NO.3-4 to detect campylobacter jejuni in preparation
Application in serotype HS:37 kit or diagnostic reagent.
The present invention provides nucleotide sequence primer pairs as shown in SEQ ID NO.5-6 to detect campylobacter jejuni in preparation
Application in serotype HS:21 kit or diagnostic reagent.
In an embodiment of the present invention, the primer pair campylobacter jejuni serum as shown in SEQ ID NO.1-2 using sequence
Type HS:7 is detected using PCR method, reaction condition are as follows: 94 DEG C of 5min；94 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 1min, totally 30 are followed
Ring；Amplified production agarose gel electrophoresis if purpose band is 460bp, is illustrated that bacterium to be measured is that jejunum is curved by 72 DEG C of 8min
Aspergillus serotype HS:7.
In an embodiment of the present invention, the primer pair campylobacter jejuni serum as shown in SEQ ID NO.3-4 using sequence
Type HS:37 is detected using PCR method, reaction condition are as follows: 94 DEG C of 5min；94 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 1min, totally 30
Circulation；Amplified production agarose gel electrophoresis if purpose band is 550bp, is illustrated that bacterium to be measured is jejunum by 72 DEG C of 8min
Campylobacter spp serotype HS:37.
In an embodiment of the present invention, the primer pair campylobacter jejuni serum as shown in SEQ ID NO.5-6 using sequence
Type HS:21 is detected using PCR method, reaction condition are as follows: 94 DEG C of 5min；94 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 1min, totally 30
Circulation；Amplified production agarose gel electrophoresis if purpose band is 989bp, is illustrated that bacterium to be measured is jejunum by 72 DEG C of 8min
Campylobacter spp serotype HS:21.
Further, the target sequence that the present invention provides nucleotide sequences as described in SEQ ID NO.7 is curved in detection jejunum
The kit or examination of purposes and the target sequence in preparation detection campylobacter jejuni serotype HS:7 in aspergillus serotype HS:7
Purposes in agent.
The amino acid sequence of the albumen of SEQ ID NO.7 coding is as shown in SEQ ID NO.10.
Further, the target sequence that the present invention provides nucleotide sequences as described in SEQ ID NO.8 is curved in detection jejunum
Purposes and the target sequence in aspergillus serotype HS:37 preparation detection campylobacter jejuni serotype HS:37 kit or
Purposes in reagent.
The amino acid sequence of the albumen of SEQ ID NO.8 coding is as shown in SEQ ID NO.11.
Further, the target sequence that the present invention provides nucleotide sequences as described in SEQ ID NO.9 is curved in detection jejunum
Purposes and the target sequence in aspergillus serotype HS:21 preparation detection campylobacter jejuni serotype HS:21 kit or
Purposes in reagent.
The amino acid sequence of the albumen of SEQ ID NO.9 coding is as shown in SEQ ID NO.12.
The present invention provides the combinations containing above-mentioned 3 pairs of specific primers pair in preparation detection campylobacter jejuni serotype examination
Application in agent box.
The present invention provides contain above-mentioned specific primer to combined kit.
Kit of the invention is to be combined into primer to group with the above-mentioned specific primer for being directed to 3 kinds of serotypes, with bacterium to be measured
DNA is template, carries out triple PCR, amplified production is carried out agarose gel electrophoresis, is if electrophoresis result shows purpose band
460bp (as shown in SEQ ID NO.13), then bacterium to be measured is campylobacter jejuni serotype HS:7；If electrophoresis result shows purpose item
Band is 550bp (as shown in SEQ ID NO.14), then bacterium to be measured is campylobacter jejuni serotype HS:37；If electrophoresis result is shown
Purpose band if being 989bp (as shown in SEQ ID NO.15) bacterium to be measured be campylobacter jejuni serotype HS:21.
Preferably, 25 μ l PCR reaction systems of kit of the present invention are Easy SuperMix 12.5 μ l, ddH2O
8.5 μ l, the upstream and downstream primer of 3 pairs of specific primers pair are 0.5 μ l, and concentration is 10 μM, 1 μ l of DNA profiling.
Preferably, the response procedures of the PCR of kit of the present invention are as follows:
94 DEG C of initial denaturation 5min；
94 DEG C of denaturation 1min, 60 DEG C of annealing 1min, 72 DEG C of 1min, 30 circulations；
72℃8min；4 DEG C of holdings.
The present invention provides a kind of method of detection three kinds of serotype of campylobacter jejuni of non-diagnostic purpose, three kinds of blood
Clear type is HS:7, HS:37 and HS:21, while using 3 pairs of specific primers, is reacted by a PCR, is carried out to bacterium DNA to be measured
Detection, if being 460bp by amplified production size, bacterium to be measured is campylobacter jejuni serotype HS:7；If amplified production size is
550bp, then bacterium to be measured is campylobacter jejuni serotype HS:37；If amplified production size is 989bp, bacterium to be measured is that jejunum is curved
Aspergillus serotype HS:21；
3 pairs of specific primers are respectively as follows:
For detecting the specific primer pair of serotype HS:7, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.1, shown in 2；
For detecting the specific primer pair of serotype HS:37, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.3, shown in 4；
For detecting the specific primer pair of serotype HS:21, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.5, shown in 6.
The reaction of PCR reaction in the method for detection three kinds of serotype of campylobacter jejuni of non-diagnostic purpose provided by the invention
Program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 1min, 60 DEG C of annealing 1min, 72 DEG C of 1min, 30 circulations；72℃8min；4
DEG C keep.
The present invention also provides the specific target sequence combinations for detecting three kinds of serotypes of campylobacter jejuni, are respectively:
The specific target sequence of serotype HS:7 is detected, nucleotide sequence is as shown in SEQ ID NO.7；Detect serotype HS:37's
Specific target sequence, nucleotide sequence is as shown in SEQ ID NO.8；Detect the specific target sequence of serotype HS:21, core
Nucleotide sequence is as shown in SEQ ID NO.9.
The above-mentioned specific target sequence combination for detecting three kinds of serotypes of campylobacter jejuni, detection serotype HS:460's
Specific target sequence, amino acid sequence is as shown in SEQ ID NO.10；The specific target sequence of serotype HS:550 is detected,
Amino acid sequence is as shown in SEQ ID NO.11；Detect the specific target sequence of serotype HS:21, amino acid sequence such as SEQ
Shown in ID NO.12.
Further, the present invention also provides the specific target sequence groups for detecting three kinds of serotypes of campylobacter jejuni
Close, be respectively: the specific target sequence of detection serotype HS:7, nucleotide sequence is as shown in SEQ ID NO.13；Detect blood
The specific target sequence of clear type HS:37, nucleotide sequence is as shown in SEQ ID NO.14；Detect the special of serotype HS:21
Property target sequence, nucleotide sequence is as shown in SEQ ID NO.15.
The present invention obtains jejunum based on the diversity and specificity of cause of disease coding CPS nucleotide inhereditary material first
The coding CPS of Campylobacter spp cause of disease special DNA sequence dna, finds out the special sequence in respective Serotypes further according to the diversity of CPS
Column establish the detection method of high specificity and repeated stable multiplex PCR, pass through the special DNA sequence of identification bacterial strain
Column, so that it is determined that the serotype of bacterial strain, substantially increases sensitivity and the specificity of highly pathogenic bacterial strain identification.Utilize the present invention
The multi-PCR detection method that the distinguished sequence of each serotype obtained is established is to the sensitivity of three kinds of type Bacteria Detections, special
Degree is 100%.Multiplex PCR detection three kinds of serotype methods of campylobacter jejuni that the present invention establishes are easy to operate, substantially reduce
Testing cost and operation difficulty.Technical support is provided to prevent and treat and monitoring campylobacter jejuni disease.
Detailed description of the invention
Figure 1A and Figure 1B is respectively proportion situation of the specific primer to upstream and downstream sequence and target sequence of HS:7 serotype.
Fig. 2A and Fig. 2 B is respectively proportion feelings of the specific primer to upstream and downstream sequence and target sequence of HS:37 serotype
Condition.
Fig. 3 A and Fig. 3 B are respectively proportion feelings of the specific primer to upstream and downstream sequence and target sequence of HS:21 serotype
Condition.
Fig. 4 is that the 3 pairs of specific primers determined using embodiment 2 carry out substance to three kinds of serotypes of campylobacter jejuni respectively
PCR testing result, M:marker in figure, swimming lane 1: jejunum campylobacter bacterial strain BJ-CJD63, (HS7) 2: jejunum campylobacter bacterial strain JL-
CJHLIU1-1 (HS21) 3: jejunum campylobacter bacterial strain HB-CJGB-LL (HS37) 4: blank control (water)；A:HS7-1(460bp)B:
HS21-1(989bp)C:HS37-2(550bp)。
Fig. 5 is the campylobacter jejuni result that triple PCR of the invention detects different serotypes；M is DL2000marker, swimming
Road 1,2:BJ-CJD63 (HS:7), swimming lane 3:HB-CJGB-LL (HS:37), swimming lane 4:JL-CJHLIU1-1 (HS:21)
Fig. 6 A and Fig. 6 B are the campylobacter jejuni and non-campylobacter jejuni that triple PCR of the invention detects different serotypes
Specificity experiments are as a result, M:Marker 1: streptococcus, and 2: helicobacter pylori, 3: Campylobacter Coli, 4:BJ-CJD59 (HS2), 5:
BJ-CJD97 (HS2), 6:HB-CJGB-QYT (HS2), 7:BJ-CJH18 (HS2), 8:BJ-CJD55 (HS3), 9:BJ-CJD113
(HS3), 10:CJH5 (HS3), 11:HN-06017 (HS3), 12:BJ-CJD70 (HS12), 13:HB-CJGB-ZB (HS19), 14:
BJ-CJD101 (HS19), 15:HB-CJGB-LXC (HS19), 16:96G25 (HS19), 17:HB-CJGB-ZHX (HS19), 18:
JL-CJHLIU1-1 (HS21), 19:BJ-CJD39 (HS31), 20:JL-CJHYIN3-1 (HS31), 21:BJ-CJD29 (HS37),
22:BJ-CJD83 (HS37), 23:HB-CJGB-LL (HS37), 24:HB-CJGB-ZX (HS37), 25:ICDCCJ07001
(HS41), 26:ICDCCJ07002 (HS41), 27:ICDCCJ07004 (HS41) 28:BJ-CJD120 (HS1/44), 29:BJ-
CJD81 (HS1/44), 30:BJ-CJD106 (HS6), 31:BJ-JCD95 (HS7), 32:BJ-CJD63 (HS7), 33:BJ-
CJD131 (HS6), 34:BJ-CJD (HS6), positive control: 35:BJ-CJD63 (HS7) 36:JL-CJHLIU1-1 (HS12) 37:
HB-CJGB-LL(HS37)。
Specific embodiment
Following embodiment further illustrates the contents of the present invention, but should not be construed as limiting the invention.Without departing substantially from
In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, the present invention is belonged to
Range.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
Campylobacter jejuni different serotypes difference separation strains involved in the present embodiment are all from Chinese Center for Disease Control and Prevention.
The determination of 1 three kinds of serotype specific DNA sequences of campylobacter jejuni of embodiment
The present invention passes through to the capsular polysaccharide (polysaccharide capsule, abbreviation CPS) for determining bacterial strain serotype
The detection of the specific nucleotide sequence of synthesis related gene cluster determines the serotype feature of Campylobacter spp.To HS:7, HS:37, HS:21
The bacterial strain sequencing of three kinds of serotype campylobacter jejunis, obtains different serotypes bacterial strain CPS synthesis related gene cluster sequence, Yi Jiqu
Not in the specific DNA sequence of other serotypes, determines and be directed to HS:7, tri- kinds of serological type strain specific nucleotides of HS:37, HS:21
Sequence carries out BLAST comparison on NCBI, determine filter out these sequences for above-mentioned three kinds of serological type strains it is concomitant with
And specificity.By comparing, HS:7 is obtained, in tri- kinds of peculiar and other serological type strains of serological type strain of HS:37, HS:21 not
Existing three sections of distinguished sequences: HS:7 serological type strain specific sequence is named as SE-HS7-1, and HS:37 serological type strain is special
Sequence designations are SE-HS37-2, and HS:21 serological type strain distinguished sequence is named as SE-HS21-1, specific nucleotide sequence difference
As shown in SEQ ID NO.7-9, amino acid sequence is respectively as shown in SEQ ID NO.10-12.
HS:7 has been sequenced in the comparison of Vector NTI Suite 6, the distinguished sequence of the CPS related gene of HS:37, HS:21
Conservative.The conservative of the specific regions of each of the above serotype is very good, almost without point mutation；And on NCBI
Also there is matching without the sequence with other type bacterial strains and other any serotypes of campylobacter jejuni on BLSAT, so specific
It is high.
2 design of primers of embodiment and determination
For the HS:7 that embodiment 1 determines, 3 specific target sequences of this 3 serotypes of HS:37, HS:21 are used
Primer premier 5, Clone Manager 8,7 design primer of Oligo, design of primers avoid the catastrophe point of sequence, together
When to consider between three pairs of designed primers and not mispairing between primer and target sequence secondary structure, and three do not occur
There is difference degree to the length of the target fragment of primer amplification, size cannot be too close to.
By comparing, screening repeatedly, final choice for HS:7 serotype campylobacter jejuni specific primer to as follows,
Purpose band size is 460bp, and nucleotide sequence is as shown in SEQ ID NO.13.
HS7-1F:TCCCCATCACCATAGGCTA (SEQ ID NO.1) TM:55.8 GC:52.6
HS7-1R:ACAATCCGTCTTTCGCAAT (SEQ ID NO.2) TM:55.4 GC:42.1
For the specific primer of HS:37 serotype campylobacter jejuni to as follows, purpose band size is 550bp, nucleotides sequence
Column are as shown in SEQ ID NO.14.
HS37-2F:GATAAGGAAAACGGCGGTCT (SEQ ID NO.3) Tm:58.6 GC:50.0
HS37-2R:CAAAATGGCAATCTTCAGCA (SEQ ID NO.4) Tm:57.1 GC:40.0
For the specific primer of HS:21 serotype campylobacter jejuni to as follows, purpose band size is 989bp, nucleotides sequence
Column are as shown in SEQ ID NO.15.
HS21-1F:TACTCCACGATACCGCAGG(SEQ ID NO.5)Tm:55.6 GC:57.9
HS21-1R:TTATGGTTCTGCTTGGGCT(SEQ ID NO.6)Tm:55.6 GC:45.5
The proportion situation of above-mentioned 3 pairs of specific primers and aim sequence is by Figure 1A, Figure 1B, Fig. 2A, Fig. 2 B, Fig. 3 A, Fig. 3 B.
Above-mentioned 3 pairs of specific primers are respectively adopted, list is carried out to tri- kinds of serotypes of campylobacter jejuni HS:7, HS:37, HS:21
Weight PCR, reaction condition are as follows: 94 DEG C of 5min；94 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 1min, totally 30 recycle；72 DEG C of 8min, will expand
Volume increase object is detected with agarose gel electrophoresis, as a result sees Fig. 4, as a result illustrates the equal energy of substance PCR method for using 3 pairs of primers respectively
Realize the detection to tri- kinds of serotype of campylobacter jejuni HS:7, HS:37, HS:21.
The foundation of 3 multiplex PCR of embodiment detection three kinds of serotype methods of campylobacter jejuni
It is determined multiple using 3 pairs of primers that embodiment 2 finally determines by SSR-PCR optimization and response procedures
PCR detects the reaction system of three kinds of serotype of campylobacter jejuni, primer sequence referring to embodiment 2, and response procedures are respectively as follows:
1 multi-PRC reaction system optimization result of table
2 multi-PRC reaction program of table:
Using the multiple PCR method of above-mentioned foundation, respectively to tri- kinds of known campylobacter jejuni HS:7, HS:37, HS:21
Serological type strain application the present embodiment method carries out serotype detection, and testing result is shown in that Fig. 5, display the present embodiment establish multiple
PCR method can be realized the detection to tri- kinds of serotype of campylobacter jejuni HS:7, HS:37, HS:21 and no cross reaction.
The specificity and sensitivity evaluation of 4 the method for the present invention of embodiment
It with sterile toothpick picking single bacterium colony, is suspended in 100 μ l distilled water, 100 DEG C were centrifuged after 2 minutes, took supernatant.It takes
5 μ l carry out triple PCR to each serotype, each strain according to the method for embodiment 3 as template.Testing result see Fig. 6 A,
Fig. 6 B, as a result explanation detects serological type strain known to 31 plants using the multiplex PCR of the embodiment of the present invention 3, and only serotype is
7 plants of bacterium (18:JL-CJHLIU1-1 (HS21), 21:BJ-CJD29 (HS37) 22:BJ-CJD83 of HS:7, HS:37 and HS:21
(HS37) 23:HB-CJGB-LL (HS37) 24:HB-CJGB-ZX (HS37), 31:BJ-JCD95 (HS7) 32:BJ-CJD63
(HS7)) amplification is the positive, detects three kinds of serum of campylobacter jejuni using the multiple PCR method that the embodiment of the present invention 3 is established
Type method, there is positive amplification product in the bacterial strain that only serotype is 7,37,21, and product band size is respectively 460bp,
The colon of the Campylobacter of 550bp, 989bp, other other serological type strains of 24 plants of campylobacter jejunis and non-campylobacter jejuni
Campylobacter spp, streptococcus and the amplification of helicobacter pylori single colonie are feminine gender, illustrate that the specificity of the method for the present invention is 100%.This
The template of secondary amplification is single colonie, therefore the detection sensitivity of this experimental method is that single bacterium colony can identify that sensitivity is
100%.
The clinical application of 5 present invention detection three kinds of serotypes of campylobacter jejuni, 7,37,21 method of embodiment
It chooses and comes from Beijing, 192 plants of Shanghai clinic diarrhea patient separation strains, poultry, 100 plants of domestic animal source bacterial strain, totally 292
The campylobacter jejuni of strain different serotypes.
1, using Japan it is raw grind kit (Campylobacter Antisera Set (Cat 270030, Lot169026,
DENKA SEIKEN CO.,LTD,Japan；Reagent for Preparing Sensitzed Blood Cells(Cat
271051, Lot 149031, DENKA SEIKEN CO., LTD, Japan) serotype analysis is carried out, it is operated referring to specification
It carries out.
Serotype testing result shows that the reaction of most strains antagonistic Serum is identical as control serum, can not obtain it really
The serotype cut, life grind serological diagnosis kit and only identify 32 plants of serotypes.
3 96 orifice plate antiserum of table layout
2, the method for the multiplex PCR established using the embodiment of the present invention 3 is identified, wherein 160 plants of fubaritic serum
Type, PCR testing result is shown as negative, and the bacterial strain that kit is accredited as HS:7, HS:37 and HS:21 is ground in Japan's life, uses this
Invention multiple PCR method, qualification result are consistent.Illustrate that the method for three kinds of serotypes of rewards and punishments campylobacter jejuni of the invention has
100% accuracy rate.
4 the method for the present invention of table verifies 32 plants of Japan's lifes and grinds the bacterial strain that kit identifies result
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Claims (7)
1. the specific primer for detecting campylobacter jejuni (Campylobacter jejuni) three kinds of serotype exists to combination
Application in the detection campylobacter jejuni of non-disease diagnostic purpose, which is characterized in that the specific primer difference of three kinds of serotype
Are as follows:
For detecting the specific primer pair of serotype HS:7, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.1, shown in 2；
For detecting the specific primer pair of serotype HS:37, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.3, shown in 4；
For detecting the specific primer pair of serotype HS:21, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.5, shown in 6；Above-mentioned 3 pairs of primers realize the inspection to campylobacter jejuni serotype HS:7, HS:37, HS:21 by a PCR
It surveys.
2. application as described in claim 1, which is characterized in that it is combined into primer to group with the specific primer, with to
Survey bacterium DNA is template, and PCR is carried out in the same PCR system, amplified production is carried out agarose gel electrophoresis, if electrophoresis knot
Fruit shows that purpose band is 460bp, then bacterium to be measured is campylobacter jejuni serotype HS:7；If electrophoresis result shows purpose band and is
550bp, then bacterium to be measured is campylobacter jejuni serotype HS:37；If electrophoresis result shows that purpose band is 989bp, bacterium to be measured
For campylobacter jejuni serotype HS:21.
3. application as claimed in claim 2, which is characterized in that in the PCR system, 25 μ l PCR reaction systems are Easy
SuperMix 12.5 μ l, ddH28.5 μ l of O, the upstream and downstream primer of 3 pairs of specific primers pair is 0.5 μ l, and concentration is 10 μ
M, 1 μ l of DNA profiling.
4. application as claimed in claim 2, which is characterized in that the response procedures of PCR are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of changes
Property 1min, 60 DEG C of annealing 1min, 72 DEG C of extension 1min, totally 30 circulation；72℃8min；4 DEG C of holdings.
5. a kind of method of detection three kinds of serotype of campylobacter jejuni of non-diagnostic purpose, three kinds of serotype is HS:7, HS:
37 and HS:21, which is characterized in that while 3 pairs of specific primers are used, it is reacted by a PCR, bacterium DNA to be measured is examined
It surveys, if amplified production size is 460bp, bacterium to be measured is campylobacter jejuni serotype HS:7；If amplified production size is
550bp, then bacterium to be measured is campylobacter jejuni serotype HS:37；If amplified production size is 989bp, bacterium to be measured is that jejunum is curved
Aspergillus serotype HS:21；
3 pairs of specific primers are respectively as follows:
For detecting the specific primer pair of serotype HS:7, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.1, shown in 2；
For detecting the specific primer pair of serotype HS:37, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.3, shown in 4；
For detecting the specific primer pair of serotype HS:21, thereon, downstream primer nucleotide sequence is respectively such as SEQ ID
NO.5, shown in 6.
6. method as claimed in claim 5, which is characterized in that the response procedures of the PCR reaction are as follows: 94 DEG C of initial denaturations
5min；94 DEG C of denaturation 1min, 60 DEG C of annealing 1min, 72 DEG C, 1min, totally 30 recycle；72℃8min；4 DEG C of holdings.
7. the specific target sequence combination for detecting three kinds of serotypes of campylobacter jejuni, which is characterized in that the specific target
Combined sequence includes detecting the specific target of the specific target sequence detection serotype HS:7 of serotype HS:7, HS:37, HS:21
Sequence, nucleotide sequence is as shown in SEQ ID NO.13；Detect the specific target sequence of serotype HS:37, nucleotides sequence
Column are as shown in SEQ ID NO.14；Detect the specific target sequence of serotype HS:21, nucleotide sequence such as SEQ ID NO.15
It is shown.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510496268.3A CN105063212B (en) | 2015-08-13 | 2015-08-13 | Detect the kit of three kinds of serotype of campylobacter jejuni |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510496268.3A CN105063212B (en) | 2015-08-13 | 2015-08-13 | Detect the kit of three kinds of serotype of campylobacter jejuni |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105063212A CN105063212A (en) | 2015-11-18 |
| CN105063212B true CN105063212B (en) | 2019-02-01 |
Family
ID=54492715
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510496268.3A Active CN105063212B (en) | 2015-08-13 | 2015-08-13 | Detect the kit of three kinds of serotype of campylobacter jejuni |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105063212B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111020039B (en) * | 2019-12-30 | 2022-12-09 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Campylobacter jejuni species specific molecular target and rapid detection method thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2539458B1 (en) * | 2010-02-24 | 2018-03-14 | The United States Of America As Represented By The Secretary Of The Navy | Multiplex amplification reaction method for determination of campylobacter jejuni penner/capsule type |
| WO2015020671A1 (en) * | 2013-08-09 | 2015-02-12 | The United States Of America As Represented By The Secretary Of The Navy | Multiplex amplification reaction method for determination of campylobacter jejuni penner/capsule type |
-
2015
- 2015-08-13 CN CN201510496268.3A patent/CN105063212B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 空肠弯曲菌多重聚合酶链反应基因鉴定及其毒力相关基因分析;张茂俊等;《中华流行病学杂志》;20070430;第28卷(第4期);第377-380页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105063212A (en) | 2015-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Slotved et al. | Serotype IX, a proposed new Streptococcus agalactiae serotype | |
| Czajkowski et al. | Detection, identification and differentiation of Pectobacterium and Dickeya species causing potato blackleg and tuber soft rot: a review | |
| Lartigue et al. | Identification of Streptococcus agalactiae isolates from various phylogenetic lineages by matrix-assisted laser desorption ionization-time of flight mass spectrometry | |
| Simpson et al. | Denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA amplicons to monitor changes in fecal bacterial populations of weaning pigs after introduction of Lactobacillus reuteri strain MM53 | |
| Jackson et al. | Use of a genus-and species-specific multiplex PCR for identification of enterococci | |
| Wang et al. | Clinical validation of multiplex real-time PCR assays for detection of bacterial meningitis pathogens | |
| Chenal-Francisque et al. | Optimized multilocus variable-number tandem-repeat analysis assay and its complementarity with pulsed-field gel electrophoresis and multilocus sequence typing for Listeria monocytogenes clone identification and surveillance | |
| Siemer et al. | Identification and molecular epidemiology of Campylobacter coli isolates from human gastroenteritis, food, and animal sources by amplified fragment length polymorphism analysis and Penner serotyping | |
| Quintela‐Baluja et al. | Characterization of different food‐isolated E nterococcus strains by MALDI‐TOF mass fingerprinting | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| CN103498000B (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| Do et al. | Prevalence of O-serogroups, virulence genes, and F18 antigenic variants in Escherichia coli isolated from weaned piglets with diarrhea in Korea during 2008–2016 | |
| Nithya et al. | Molecular detection of C olletotrichum falcatum causing red rot disease of sugarcane (S accharum officinarum) using a SCAR marker | |
| Afshari et al. | Genotyping of Clostridium perfringens isolated from broiler meat in northeastern of Iran | |
| CN102947467A (en) | Assays and kits for serotyping pseudomonas aeruginosa and oligonucleotide sequences useful in such methods and kits | |
| Song et al. | Molecular typing and virulence gene profiles of enterotoxin gene cluster (egc)-positive Staphylococcus aureus isolates obtained from various food and clinical specimens | |
| Razmyar et al. | Genotyping of Clostridium perfringens isolated from healthy and diseased ostriches (Struthio camelus) | |
| Månsson et al. | Capsule typing of Haemophilus influenzae by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry | |
| Pizzuto et al. | Pyrosequencing analysis for a rapid classification of fowl adenovirus species | |
| Lawrence et al. | Evaluation of serotype prediction by cpsA-cpsB gene polymorphism in Streptococcus pneumoniae | |
| CN102776283A (en) | Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis | |
| CN105154528B (en) | The kit of three kinds of serotype of campylobacter jejuni is detected simultaneously | |
| CN104846066A (en) | PCR detection primers and detection method of Salmonella pullorum | |
| CN105063212B (en) | Detect the kit of three kinds of serotype of campylobacter jejuni |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |