CN105063202B - Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 - Google Patents
Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 Download PDFInfo
- Publication number
- CN105063202B CN105063202B CN201510478753.8A CN201510478753A CN105063202B CN 105063202 B CN105063202 B CN 105063202B CN 201510478753 A CN201510478753 A CN 201510478753A CN 105063202 B CN105063202 B CN 105063202B
- Authority
- CN
- China
- Prior art keywords
- royal jelly
- bee colony
- honeybee
- primer
- higher production
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Jellies, Jams, And Syrups (AREA)
Abstract
The present invention relates to a kind of method for differentiating bee colony Higher production royal jelly character using SNP marker rs4208349, including the sampling of honeybee individual, the extraction of honeybee sample DNA, primer synthesis, PCR detections and differentiate bee colony Higher production royal jelly character, the frequency of A allele is occurred in SNP marker rs4208349 according to the worker bee individual of the random collecting from the bee colonyP A With the frequency of G alleleP G Between whether there is significant difference, differentiate bee colony Higher production royal jelly character.The present invention is horizontal from molecular biology, there is provided uses the related SNP of apis mellifera worker bee individual Higher production royal jelly（rs4208349）Mark science, accurately and rapidly differentiate apis mellifera bee colony Higher production royal jelly character, the seed selection cycle of Higher production royal jelly apis mellifera kind can be greatly shortened, accelerate honeybee breeding speed.
Description
Technical field
The present invention relates to a kind of method for differentiating honeybee bee colony Higher production royal jelly character, and in particular to one kind utilizes SNP marker
Differentiate the method for bee colony Higher production royal jelly character, belong to biological technical field.
Background technology
Royal jelly has many important nutrition and drug value, highly beneficial to human health, is natural nourishing food
Product.China is bee-keeping big country, and the yield of royal jelly accounts for more than the 90% of world's total amount, and the bee species of this and China's raising have
Inseparable relation.The apiculture scientist in China and scientific and technical personnel cultivate by honeybee group locking breed method
Honeybee is starched in " Zhejiang Nongda No.1 " and Xiaoshan, and pulp production ability is significantly higher than apis cerana and other honeybee kinds, while also has good honey
Acquisition capacity, it has also become the peculiar and main raising honeybee kind in China.All the time, the apiculture scientific worker in China is directed to king
The correlative study of high yield honeybee is starched, to find Higher production royal jelly mechanism genetic marker related to Higher production royal jelly character etc., is strengthened
The conservation of Higher production royal jelly honeybee kind and seed selection work, give full play to the advantage of the excellent honeybee kind resource in China.With regard to Higher production royal jelly character phase
Close research, molecular labeling meaning and SNP technologies and its as follows in the research overview that application of honeybee research field etc. is carried out：
1st, the research of Higher production royal jelly character mark of correlation
（1）Morphology genetic marker：Honeybee hypopharyngeal gland is the synthesis positioned at Worker head and secretes the main gland of royal jelly
Body, its activity are commonly used for the bleeding ability for weighing honeybee.Shao Rui is preferably etc.（2003）Deposited it was found that worker bee is nose heave with hypopharyngeal gland weight
In pole significant correlation, and hypopharyngeal gland weight can be as the important indicator of measurement royal jelly production performance, therefore tells the head of slurry worker bee
Portion's weight there may be certain correlation with royal jelly production performance.Zheng Aijuan etc.（2010）It was found that each age in days slurry honeybee worker pupae
Nose heave pole is significantly higher than that original seed apis mellifera worker pupae is nose heave, and worker bee is nose heave is likely to become Higher production royal jelly honeybee kind in outside
Mark on Morphology level.In addition, the anatomical morphology that people study hypopharyngeal gland is found, the bursa number in HP of worker bee, pharynx
Lower gland size and weight and the speed of the external synthetic protein of hypopharyngeal gland can be as the measurement indexs of hypopharyngeal gland activity, its
The hypopharyngeal gland length of middle worker bee and the correlation maximum of royal jelly output, possibly as the comparatively ideal form of the Apis mellifera royal jelly production traits
Learn genetic marker.
（2）Cytology genetic marker：Pass through the karyotype to " Zhejiang Nongda No.1 " Apis mellifera drone and original seed Apis mellifera drone
Com-parison and analysis discovery is carried out, there is pole significant difference for the arm ratio of the 7th, 10, the 12 article of chromosome of two different honeybee kind drones.
When this species diversity is probably " Zhejiang Nongda No.1 " Apis mellifera drone chromosome replication, the multipair allele fragment of pulp production character is controlled
Repeat replication, cause the reason that minor gene number increases.It has also been found that the 3rd article of chromosome " Zhejiang agricultural university 1 in the analysis of Chromosome G band
Number " Apis mellifera band more than original seed Apis mellifera.
（3）Biochemical genetic marker：Isodynamic enzyme is one kind of biochemical marker, because hereditary difference can produce a variety of enzyme shapes
Formula.Honeybee area research it is more be malic dehydrogenase（MDH）, the enzyme encodes by three allele：MDH Ⅰ、MDH
II and MDH III, only MDH II show polymorphism in the type not at the same level of honeybee and stage of development.Guan Yinghui etc.（1994）Grind
Study carefully discovery, Higher production royal jelly honeybee（" Zhejiang Nongda No.1 " Apis mellifera）The heterozygosities of MDH II than other two kinds of Apis melliferas（Hubei Apis mellifera and original
Kind apis mellifera）Height, and unexistent aa, ab genotype in new discovery other two kinds of royal jelly low yield Apis melliferas can conduct
The biochemical genetic marker of Higher production royal jelly honeybee kind.In addition, the MDH II of three honeybee subspecies of apis mellifera genotype frequency, base
Because frequency and heterozygosis homozygosity have pole significant difference, this result shows, can by determine MDH II gene frequency and
Heterozygosis homozygosity is identified different honeybee kinds from Biochemical Genetic angle.Bao Xiuliang（1997）Research report, Higher production royal jelly honeybee
（" Zhejiang Nongda No.1 " Apis mellifera）And the polymorphisms of MDH II of other four kinds of Apis mellifera strains are in significant difference.To sum up learn, honeybee
Malic dehydrogenase II（MDH Ⅱ）It is likely to become the genetic marker of the related biochemistry level of Higher production royal jelly character.
（4）Molecular genetic marker：Gene pleiomorphism refers to two or more base of the generally existing in organism
Because of type or allele, also there is application in the research about Higher production royal jelly honeybee kind genetic marker." Zhejiang Nongda No.1 ", Pinghu and
Slurry honeybee is Higher production royal jelly honeybee kind for Xiaoshan, belongs to 3 kinds of different race of bees.Zhang Yajuan etc.（2001）By to these three product
The honeybee of kind carries out randomly amplified polymorphic DNA-PCR（RAPD-PCR）Analysis, has obtained common DNA fragment specific
W316bp, this phenomenon illustrate that the DNA fragmentation may be related to Higher production royal jelly character.Then, Jiang Ying etc.（2002）It is again right respectively
The worker bee and drone of these three slurry honeybees have carried out DNA polymorphism atlas analysis, there is W316bp's in the worker bee of three kinds of honeybees
In the presence of, but do not found in drone, this shows that W316bp is existed only in worker bee.Wang Weiping etc.（2002）Using RAPD-PCR
Technology analyzes the gene pleiomorphism of 3 Higher production royal jelly honeybee kinds and royal jelly low yield honeybee kind Ka Niela honeybees simultaneously, as a result in card Buddhist nun
Hubei Province is drawn without discovery W316bp in honeybee, and is still detected in 3 kinds of slurry honeybees, and further demonstrating W316bp can be used as royal jelly high
Produce the genetic marker of honeybee kind.Then, English etc. is worn（2003）3 kinds of slurry honeybees are not only have studied, and to Italian Bee, black ring system honeybee
Deng also being studied, using characteristic sequence amplification region（SCARs）Method verifies to W316bp, as a result with the research of forefathers
Unanimously, indicate W316bp and be likely to a related molecular marker of Higher production royal jelly character.Jinsui River China afterwards（2003,2004）
W316bp reliability is demonstrated also by experiment.
Microsatellite DNA is to be prevalent in simple trinucleotide repeat sequence, microsatellite marker in organism genome to be
A kind of genetic marker being widely used in animals and plants breeding." Zhejiang Nongda No.1 ", original seed apis mellifera and local Italy's honey
Honeybee is that China raises more apis mellifera kinds, has different pulp production abilities, Li Jianke etc.（2003）Analyze this 3 kinds
10 microsatellite locus of honeybee, it is found that these microsatellite locus amplify the number of alleles come not in every kind of honeybee
Together, show for polymorphism, wherein the peculiar allele of " Zhejiang Nongda No.1 " honeybee is most, and according to gene frequency
Analysis result, which have found 7, to have confirmed " Zhejiang as the microsatellite marker of Higher production royal jelly honeybee kind, and by Genetic Distance Analysis
The evolutionary history of Nongda No.1 " honeybee.
Pan Jiao etc.（2012）Using covering the biochip technology of honeybee genome to Higher production royal jelly honeybee kind and low yield honeybee
Kind is analyzed, and filters out 369 difference expression genes, wherein up-regulated expression gene 201, lowers expressing gene 168,
By the analysis of bioinformatics, it is found that these genes may take part in the honeybee biological process related to secreting royal jelly,
Such as olfactory system, nervous system, kinematic system and Intervention development.Further qPCR detections and correlation analysis table
It is bright to have 3 genes（Dop2, SsRbeta and hex71）It is closely related with Higher production royal jelly character, it is believed that it can be as Higher production royal jelly
Molecular labeling.
Most of the above research related on honeybee royal jelly high-yield character is before the completion of honeybee gene order-checking
Carry out, the method for use is more traditional, and the scope of screening has some limitations, thus has scholar to query.Compare
It is reliably Pan Jiao etc.（2012）3 molecular labelings screened using biochip technology in honeybee genome range,
But use this method detection to extract honeybee RNA and use fluorescent quantitation instrument, make qualification process complexity, cost higher, no
Beneficial to the popularization of this method.
Therefore, Higher production royal jelly character is carried out from gene level using powerful ripe, more science molecular studies technology
Research, so as to find a kind of simple to operate, reliability is high, cost is low method to differentiate that the royal jelly and its product performance of honeybee seems
It is particularly important.
2nd, SNP technologies
SNP (single nucleotide polymorphism, SNP) is referred to as the 3rd generation DNA point
Son mark, refer to the difference of individual nucleotide between the not iso-allele in same site, it can be common that single nucleotide acid is replaced
Change, and often occur between purine bases (A and G) and pyrimidine bases (C and T).SNP marker can help distinguish between two individuals
The difference of inhereditary material, it is considered to be one of best genetic marker of application prospect.At present, can be by extracting genomic DNA
And interrupt at random, the SNP information of genome can be accurately obtained plus steps such as joint, the sequencing of upper machine, bioinformatic analysis,
Filter out the SNP marker related to specific traits.
As biotechnology of new generation, although SNP technologies have high practical value, the application in human diseases field
Certain progress is achieved.It is of the invention that apis mellifera adult labor royal jelly high-yield character is identified using SNP technologies, according to
This can accurately, efficiently, be rapidly selected Higher production royal jelly honeybee carry out breeding, even by gene means cultivate it is more high-quality
Pulp production honeybee kind establish good basis.
The content of the invention
It is an object of the invention to provide a kind of method for differentiating bee colony Higher production royal jelly character using SNP marker rs4208349.
The purpose of the present invention is achieved through the following technical solutions.
The method for differentiating bee colony Higher production royal jelly character using SNP marker rs4208349 of the present invention, it is characterised in that differentiate
Step is as follows：
（1）Honeybee individual sampling：From the apis mellifera bee colony of investigation, adult bees worker bee individual is collected, is taken at random
Sample, every group represents whole bee colony with 50 honeybees, honeybee sample is put in -20 DEG C of refrigerators freeze it is standby；；
（2）The extraction of honeybee sample DNA：Step is taken respectively（1）The head of honeybee freezing sample and chest, carry out tissue and break
It is broken, genomic DNA is extracted, and carry out DNA concentration and purity testing；
（3）Synthetic primer：Primer pair Primer-F and Primer-R sequence are as follows：
Primer-F：5’- AAATCCCTCCTCCGATTCAC -3’
Primer-R：5’- CATCCCTCCAACTGGTCCTA -3’
（4）PCR is detected：With step（2）Honeybee genomic DNA is masterplate, is entered using Primer-F and Primer-R as primer
Performing PCR；
The system of reaction is：11 μ of μ L, Primer-R of μ L, Primer-F of cumulative volume 30 μ L, inclusive reaction substrate Mix 15
L, DNA masterplate 2 μ L, ddH2O 11μL；
The condition of reaction is：94 DEG C of pre-degeneration 5min；94 DEG C of 30 s of denaturation, 55 DEG C of 30 s of annealing, 72 DEG C extend 1
Min, totally 35 circulations；72 DEG C of 8 min of extension；
Detected through gel electrophoresis is carried out to PCR reaction products, the PCR reaction solutions that will appear from purpose band are sequenced；
（5）Differentiate bee colony Higher production royal jelly character：By step（4）Sequencing result carry out sequence point with Alignment softwares
Analysis, according to the C gene frequencies of bee colonyP C Value, differentiate bee colony Higher production royal jelly character.When the G gene frequencies of bee colony are more than
During C gene frequencies, then this bee colony is Higher production royal jelly bee colony.
The SNP marker is the related genomic locus rs4208349 of honeybee Higher production royal jelly.
The present invention using SNP site rs4208349 come identify the method for Higher production royal jelly honeybee be by strict screening with
Checking.With Higher production royal jelly honeybee kind（" Zhejiang Nongda No.1 "）With royal jelly low yield honeybee kind（U.S.'s apis mellifera）For research object, carry
The genomic DNA of honeybee sample is taken, then send and monomer is carried out using SLAF-seq technologies in the mikey biotech company of Beijing hundred
Type is sequenced and the exploitation of molecular labeling, further carries out whole-genome association（genome-wide association
Study, GWAS）, preliminary screening goes out 21 SNPss related to Higher production royal jelly character.In addition, the collection high and low honey production honeybee sample of royal jelly
This, is verified to the SNPs of preliminary screening by PCR and DNA sequencing technology, filters out rs4208349, is produced as royal jelly
Measure the related molecular labeling of character.
Advantages of the present invention and beneficial effect：
1st, the pulp production ability of bee colony can be influenceed by genotype, and specific allele in Higher production royal jelly bee colony be present
It is significantly higher than the low bee colony of royal jelly output.The SNP marker allele G gene frequenciesP G In Higher production royal jelly bee colony and royal jelly low yield
Difference in bee colony is extremely notable, i.e., G gene frequencies are significantly higher than G equipotential bases in royal jelly low yield bee colony in Higher production royal jelly bee colony
Because of frequency, thus according to this result can with it is convenient, fast, exactly identify bee colony whether have Higher production royal jelly ability.
2nd, the royal jelly and its product ability of bee colony is judged according to statistical indicator：The honeybee worker bee individual of random acquisition exists in bee colony
The SNP site P G > P A （P< 0.05）Be Higher production royal jelly bee colony, P G < P A （P< 0.05）Be royal jelly low yield bee colony.
The high bee colony of royal jelly output is selected accordingly, the royal jelly output of bee colony is improved, so as to increase the income of beekeeper.Utilized using the present invention
The method that the related SNP marker of honeybee Higher production royal jelly differentiates bee colony Higher production royal jelly character, can greatly improve efficiency.
3rd, the Higher production royal jelly mechanism of honeybee, detection are mainly grasped from molecular level in laboratory at present using the inventive method
The molecular genetic marker related to pulp production character, and binding molecule genetic marker auxiliary bee species breeding technique, can not only be protected
The accuracy of selection is demonstrate,proved, may also speed up bee species seed selection speed, substantially increases the success rate of seed selection Higher production royal jelly honeybee kind,
It can safely, effectively, rapidly carry out the discriminating of Higher production royal jelly honeybee kind.
Brief description of the drawings
Accompanying drawing is that the related SNP marker rs4208349 of honeybee Higher production royal jelly genotype judges to refer to peak figure.Wherein：
The SNP marker genotype that square frame marks in Fig. 1 is homozygous GG, is primarily present in royal jelly high yield bee colony；
The SNP marker genotype that square frame marks in Fig. 2 is homozygous AA, is primarily present in royal jelly low yield bee colony；
The SNP marker genotype that square frame marks in Fig. 3 is heterozygosis AG, is primarily present in royal jelly low yield bee colony.
Embodiment
With reference to embodiment, the present invention is further elaborated.
Embodiment 1
A kind of method for being differentiated honeybee bee colony Higher production royal jelly character using SNP marker rs4208349, is comprised the following steps：
（1）Honeybee samples：Higher production royal jelly honeybee kind（" Zhejiang Nongda No.1 "）With royal jelly low yield honeybee kind（U.S.'s apis mellifera）Respectively
50 adult bees worker bee individuals are taken, each individual is individually placed in a centrifuge tube, it is standby in -20 DEG C of freezen protectives；
（2）The extraction of honeybee sample DNA（Use the Animal genome rapid extraction kit of Sheng Gong companies, SK8222）
By step（1）Worker bee individual cut off four limbs, wing and belly with ophthalmologic operation, only retain head and chest
Portion, it is put in the mortar for filling liquid nitrogen, is crushed with grinding rod, is then transferred into 1.5 mL centrifuge tubes, adds 400 μ L
Buffer Digestion, concussion is uniform, and 65 DEG C of h of water-bath 1 are cracked completely to cell.Then take out supernatant and add 10 μ L
RNaseA（10mg·mL-1）, stand 5 min.
200 μ L Buffer PA are added, it is fully reverse to mix, it is placed in -20 DEG C of refrigerators and places 5 min.
The rpm of room temperature 10000 centrifuges 5 min, the μ L of supernatant 400 is transferred in 1.5 new mL centrifuge tubes, adds
Isometric chloroform mixes, 12000 rpm centrifuging and taking supernatants.
400 μ L isopropanols are added, shake 1 min by hand, room temperature places 2 min, the rpm of room temperature 10000 centrifugations 5
Min, abandon supernatant.
Add the ethanol that 1 mL volume ratios are 75%（Ultra-pure water dilutes）, it is slight to shake 1 min, precipitation is suspended
Come, the rpm of room temperature 10000 centrifuges 2 min, abandons supernatant.
Repeat stepOnce.
Open centrifugation lid to be upside down on clean paper handkerchief, the ethanol to residual volatilizees completely, obtains DNA.
Obtained DNA is dissolved with 50 μ L TE Buffer, with Ago-Gel and ultraviolet point of NanoDrop 2000
The DNA mass of light photometer Detection and Extraction, is finally put in -20 DEG C and is saved backup.
（3）Synthetic primer：Primer pair Primer-F and Primer-R sequence are as follows：
Primer-F：5’- AAATCCCTCCTCCGATTCAC -3’
Primer-R：5’- CATCCCTCCAACTGGTCCTA -3’
Upstream and downstream primer is diluted to 10 μm of ol/ μ L respectively, -20 DEG C save backup.
（4）PCR is detected：With step（2）Each honeybee individual DNA be masterplate, using Primer-F and Primer-R as
Primer enters performing PCR, and row agarose gel electrophoresis detection is entered to PCR reaction products, and the PCR reaction solutions that will appear from purpose band are carried out
Sequencing.
PCR reaction systems (30 μ L):
Mix: 15 μL
Primer-F: 1 μL
Primer-R: 1 μL
Template: 2 μL
ddH2O: 11 μL
Reaction condition：
94℃ 5min
94℃ 30sec
55 DEG C of 30sec, 35 circulations
72℃ 1min
72℃ 8min
4℃ Hold
（5）The screening of SNP marker and the sequencing result analysis to acquisition：
Here is the partial dna sequence of PCR primer, the SNP（rs4208349）Mark position mark in the sequence isG/A。
5’-AAATCACGGTACTCTCTTCCTTCGACGAAAGAATTAACAAAAGTTATCTCGATGATCTCGGATCGA
CGAAGGAATCTCCGTAACGTATCAAACCCCCGTGAGAAATTGGCGTCGATTTCTCCTCCCGTTG/ ATGTCATTGAGAAACCGTACACGTTTTACACGCCCTTACCTTACGGTATCAATGGCCGGTATCGATCGAAATCTTAG
CACCGGCCTGAAATACGAGCTGCCACGTAGTTAGGAGAACGATCTGGGAGGGAGGGAGGAAAAAGGGAGGTCGGTAA
-3’。
Check that peak figure is sequenced in PCR primer, position position of the SNP marker in peak figure, genotype peak figure standard such as Fig. 1,
Fig. 2, Fig. 3 mark position, judge each sample mark is which kind of gene in homozygous AA, heterozygosis AG or homozygous GG three types
Type simultaneously counts.
（6）Differentiate bee colony Higher production royal jelly character using SNP marker rs4208349：By step（4）PCR sequencing results use
Alignment softwares carry out sequence alignment, count the marker peak graph type, genotype and gene frequency are calculated, such as the institute of table 1
Show.According to analysis result, if the G gene frequencies of identification bee colony are noticeably greater than A gene frequencies, it can determine whether that bee colony is
Queen bee pulp production high yield bee colony.
Influence and Gene frequency distribution situation of the different genotype of table 1 to bee colony pulp production ability
Table 1 examines (Fisher ' s Exact Test) statistics to obtain by fischer exact method TP=4.30E-15<0.05, show pole significant difference be present between the bee colony of different pulp production abilities and different genotype, there is statistical significance, table
The pulp production ability of bright bee colony can be influenceed by genotype.Higher production royal jelly groupP A Pole significantly less thanP G , and in low yield groupP A It is more thanP G 。
The main agents that the present invention uses are as follows（All chemical reagent are that analysis is pure）：
Absolute ethyl alcohol, isopropanol, chloroform, ultra-pure water, full formula gold Trans DNA Marker I, 2 × EasyTaq of full formula gold
PCR SuperMix, full formula gold agarose, full formula gold Galstain, raw work 50 × TAE electrophoretic buffers, Animal genome are quick
Extracts kit SK8222, upstream and downstream primer is by synthesizing, nuclease A.
Instrument used in the present invention is mainly as follows：
The mL centrifuge tubes of Axygen 1.5, Axygen PCR pipes, micro-wave oven, electronic balance, oscillator, compact centrifuge, water
Bath, micropipette rifle, electrophoresis apparatus, the hole PCR instrument of ABI companies 96, Shanghai Peiqing Science Co., Ltd's gel image analyser are high
Fast centrifuge, low temperature refrigerator, high-pressure sterilizing pot, NanoDrop 2000 etc..
<110>University Of Agriculture and Forestry In Fujian
<120>Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349
<130>
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
aaatccctcc tccgattcac 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
catccctcca actggtccta 20
<210> 3
<211> 284
<212> DNA
<213>Honeybee
<400> 3
aaatcacggt actctcttcc ttcgacgaaa gaattaacaa aagttatctc gatgatctcg 60
gatcgacgaa ggaatctccg taacgtatca aacccccgtg agaaattggc gtcgatttct 120
cctcccgttg atgtcattga gaaaccgtac acgttttaca cgcccttacc ttacggtatc 180
aatggccggt atcgatcgaa atcttagcac cggcctgaaa tacgagctgc cacgtagtta 240
ggagaacgat ctgggaggga gggaggaaaa agggaggtcg gtaa 284
Claims (1)
- A kind of 1. method for differentiating bee colony Higher production royal jelly character using SNP marker rs4208349, it is characterised in that differentiate step such as Under：（1）Honeybee individual sampling：From the apis mellifera bee colony of investigation, random collecting adult bees worker bee individual, every group with 50 honeybees represent whole bee colony, honeybee sample is put in -20 DEG C of refrigerators freeze it is standby；（2）The extraction of honeybee sample DNA：Step is taken respectively（1）The head of middle freezing honeybee sample and chest, carry out tissue and break It is broken, genomic DNA is extracted, and carry out concentration and purity testing；（3）Synthetic primer：Primer pair Primer-F and Primer-R sequence are as follows：Primer-F：5’- AAATCCCTCCTCCGATTCAC -3’Primer-R：5’- CATCCCTCCAACTGGTCCTA -3’；（4）PCR is detected：With step（2）Bee DNA is masterplate, enters performing PCR as primer using Primer-F and Primer-R；The system of reaction is：The 11 μ L of μ L, Primer-R of μ L, Primer-F of cumulative volume 30 μ L, inclusive reaction mixture M ix 15, DNA masterplates 2 μ L, ddH2O 11μL；The condition of reaction is：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30 s, 55 DEG C of annealing 30 s, 72 DEG C of 1 min of extension, altogether 35 circulations；72 DEG C of 8 min of extension；Enter row agarose gel electrophoresis detection to PCR reaction products, the PCR reaction solutions that will appear from purpose band are sequenced；（5）Differentiate bee colony Higher production royal jelly character：By step（4）Sequencing result carry out sequence alignment point with Alignment softwares Analysis, when the G gene frequencies of bee colony are noticeably greater than A gene frequencies, this bee colony is Higher production royal jelly bee colony, described notable Refer to statistical P<0.05.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510478753.8A CN105063202B (en) | 2015-08-03 | 2015-08-03 | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510478753.8A CN105063202B (en) | 2015-08-03 | 2015-08-03 | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105063202A CN105063202A (en) | 2015-11-18 |
| CN105063202B true CN105063202B (en) | 2018-02-09 |
Family
ID=54492705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510478753.8A Expired - Fee Related CN105063202B (en) | 2015-08-03 | 2015-08-03 | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105063202B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524992B (en) * | 2016-01-06 | 2019-02-01 | 中国农业科学院蜜蜂研究所 | The detection method of csd allelic gene type in apis cerana population |
| CN105779627B (en) * | 2016-05-06 | 2019-03-08 | 浙江省农业科学院 | Utilize the method for mitochondrial molecule mark identification Zhejiang slurry bee |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103409527A (en) * | 2013-08-13 | 2013-11-27 | 福建农林大学 | Method for discriminating output performance of royal jelly by using honeybee Dop2 gene fluorescent quantitative PCR technology |
-
2015
- 2015-08-03 CN CN201510478753.8A patent/CN105063202B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103409527A (en) * | 2013-08-13 | 2013-11-27 | 福建农林大学 | Method for discriminating output performance of royal jelly by using honeybee Dop2 gene fluorescent quantitative PCR technology |
Non-Patent Citations (2)
| Title |
|---|
| 基于基因芯片技术的王浆高产性状相关分子标记筛选;潘娇等;《国家蜂产业技术体系蜜蜂育种与授粉功能研究室学术研讨会暨中国养蜂学会蜜蜂育种专业委员会第四届第一次会议暨中国养蜂学会蜜源与蜜蜂授粉专业委员会第五届第一次会议论文汇编》;20121231;63-77页 * |
| 蜂王浆高产性状相关的遗传标记研究;潘娇等;《中国蜂业》;20111231;第62卷;11页右栏第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105063202A (en) | 2015-11-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105063185B (en) | The close linkage mark of wheat spike length main effect QTL and its application | |
| US20210207226A1 (en) | Dna barcoding-based method for rapid identification of lycium chinensis | |
| CN102703586B (en) | Method for constructing Prunus mume Sieb.et Zucc SSR (simple sequence repeat) genetic map | |
| CN104988240B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs16287910 | |
| CN103409527A (en) | Method for discriminating output performance of royal jelly by using honeybee Dop2 gene fluorescent quantitative PCR technology | |
| CN105063202B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs4208349 | |
| KR20100021834A (en) | Method of discriminating ginseng cultivars using sts primers | |
| Kacar et al. | Genetic relationships of some Citrus genotypes based on the candidate iron chlorosis genes | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN107523637B (en) | Method for establishing and identifying sika deer, red deer or hybrid deer thereof based on COI and SRY sequences | |
| CN104498608B (en) | Utilize the method that SNP marker differentiates the anti-Chalk characteristic of disease shape of bee colony | |
| CN111057784B (en) | SSR molecular marker primer related to walnut black spot and application thereof | |
| CN111118174B (en) | Macrobrachium rosenbergii sex identification method based on PCR and sequencing technology | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| JP5799600B2 (en) | Species identification method of Eucalyptus hybrids | |
| CN115948600B (en) | Grape powdery mildew resistance dCAPS molecular marker and application thereof | |
| CN107190089A (en) | The method that using molecular labeling 3 kinds of strawberry cultivars are carried out with quick discriminating | |
| CN107354234B (en) | Method for screening parent oysters with high glycogen content and related primer pair thereof | |
| CN103409528A (en) | Method for discriminating output performance of royal jelly by using honeybee he*71 gene fluorescent quantitative PCR technology | |
| CN105018624B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs5749071 | |
| CN111286546B (en) | Saline-alkali-resistant molecular marker C1480 of portunus trituberculatus and application thereof | |
| CN110257551B (en) | SSR primers for constructing peach DNA fingerprint, application and construction method | |
| CN109457023B (en) | Gene combination for identifying sex of gleditsia sinensis, SSR primer combination, identification method and application | |
| CN111733273A (en) | DNA barcode sequence and method for identifying lycium species by using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180209 Termination date: 20210803 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |