CN105063052A - Acute myelogenous leukemia miRNA marker - Google Patents
Acute myelogenous leukemia miRNA marker Download PDFInfo
- Publication number
- CN105063052A CN105063052A CN201510549473.1A CN201510549473A CN105063052A CN 105063052 A CN105063052 A CN 105063052A CN 201510549473 A CN201510549473 A CN 201510549473A CN 105063052 A CN105063052 A CN 105063052A
- Authority
- CN
- China
- Prior art keywords
- mirna
- expression
- myeloid leukemia
- acute myeloid
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a miRNA marker which is miRNA-1262. Whether a patient suffers from acute myelogenous leukemia or not can be diagnosed by detecting the expression level of the miRNA-1262. As is proved by experiment, an acute myelogenous leukemia patient and a healthy person can be effectively distinguished through the miRNA-1262. On the basis, the miRNA-1262 can also be used for preparing acute myelogenous leukemia treatment drugs. The miRNA-1262 improves the sensitivity and specificity of acute myelogenous leukemia diagnosis greatly and provides a new drug target for gene therapy of acute myelogenous leukemia.
Description
Technical field
The invention belongs to biomedicine field, relate to a kind of acute myeloid leukemia miRNA marker and application thereof.
Background technology
Acute myeloid leukemia (acutemyeloidleukemia, AML) be one group of height heterogeneity disease, there is the process that development is a polygene change and multi-step in it, when making a definite diagnosis at present, cytogenetic abnormalities has become the conventional clinical prognosis index of AML, but conventional cell genetics remains in some defects, the meaning of change to prognosis of molecular genetics is increasingly important.In recent years, AML sickness rate is in the trend risen gradually, although existing methods for the treatment of makes patient's complete remission rate reach 50% ~ 70%, this sick case fatality rate is still higher, and implementing individuation layering treatment to different patient becomes matter of utmost importance.There is effect and the influence prognosis thereof of development in synthetic study gene pairs AML, contributes to seeking effective leukemia angiogenesis treatment target spot, thus instruct clinical individualization to treat further.Although some patent research existing utilizes gene or protein marker to classify to patient, but this classification is only according to the difference of mRNA and protein expression, there is certain limitation, in conjunction with the expression shown by miRNA, will redundant gene express spectra further, for acute myeloid leukemia provides clearer and more definite diagnosis and prognosis means.
MiRNA is the non-coding RNA molecule of the natural 21-22nt be present in body, is the RNA that a class is regulated expression of target gene by PTGS.According to estimates, the gene of 1/3 is about had in organism by the regulation and control of miRNA.The complex body of miRNA and RISC can be combined with the complementary sequence in target gene mRNA5 '-UTR or 3 '-UTR by base pairing, and arrestin matter is translated, or causes mRNA degraded, thus the expression of negative regulation target gene.
The expression level detecting miRNA can provide reference for the clinical diagnosis of cancer.And the unconventionality expression of miRNA directly causes the abnormal expression of some and disease generation genes involved, brings out the generation of cancer.Have been reported and prove that miRNA by the expression of regulation and control target gene mRNA, can play an important role in acute myeloid leukemia.In future clinical treatment, miRNA not only can become the new acute myeloid leukemia early diagnosis marker relevant with disease process, and is expected to by disease such as the change expression of miRNA or the expression treatment acute myeloid leukemia of its target gene etc.Find and identify that the clinical treatment that relevant miRNA and target gene thereof are miRNA occurs to acute myeloid leukemia provides basic.
Summary of the invention
In order to make up the deficiencies in the prior art, the object of the present invention is to provide a kind of miRNA marker that can be used for diagnosing acute marrow series leukemia.Compare the diagnostic method of traditional acute myeloid leukemia, use miRNA marker to carry out diagnosing acute marrow series leukemia and there is promptness, susceptibility, thus make patient just can know disease risks in early days in disease, thus take corresponding prevention and therapy measure.
To achieve these goals, present invention employs following technical scheme:
The invention provides the application of miRNA-1262 in the product preparing diagnosing acute marrow series leukemia, described miRNA-1262 is selected from least one in following group: miRNA-1262 initial miRNA, miRNA-1262 precursor miRNA, ripe miRNA-1262; The initial miRNA of described miRNA-1262 can be sheared and be expressed as ripe miRNA-1262 in people's cell; Described miRNA-1262 precursor miRNA can be sheared and be expressed as ripe miRNA-1262 in people's cell.
Further, described miRNA-1262 is ripe miRNA-1262, and nucleotide sequence is as shown in the SEQIDNO.1 in sequence table.
It should be known that miRNA-1262 of the present invention comprises the function equivalent of composing type nucleic acid molecule, i.e. variant, it shows the identical function of complete miRNA-1262 nucleic acid molecule, and they can suddenly change by the disappearance of nucleotide residue, displacement or insertion.
Those skilled in the art know, and in order to ensure the stability of miRNA, can increase protectiveness base, as TT, also can modify miRNA base, but not affect the function of miRNA in one end of miRNA or two ends.Therefore, those skilled in the art know, and under the condition not affecting miRNA-1262 function, carry out base modification or be included in equally within protection scope of the present invention in the sequence that two ends increase base obtains miRNA-1262.
In concrete embodiments more of the present invention, described miRNA-1262 is ripe miRNA-1262.
Although the ripe miRNA-1262 that uses in some embodiment, but those skilled in the art it is expected to, initial miRNA (pri-miRNA-1262), precursor miRNA (pre-miRNA-1262) can obtain the technique effect same with ripe miRNA-1262, because cell has the ability further initial miRNA (pri-miRNA-1262), precursor miRNA (pre-miRNA-1262) to be processed as ripe miRNA-1262.
MiRNA-1262 nucleic acid molecule of the present invention can exist with the form of strand or double-strand.Ripe miRNA-1262 is mainly in single stranded form, and miRNA-1262 precursor is part complementation certainly, to form duplex structure.Nucleic acid molecule of the present invention can be the form of RNA, DNA, PNA, LNA.
The invention provides the application of miRNA-1262 in high-flux sequence platform.The expression level of miRNA-1262 in sample to be detected can be known by high-flux sequence, the sample of the result of sample to be tested with Healthy People is compared, easily judge whether sample to be tested suffers from acute myeloid leukemia and suffer from the risk of acute myeloid leukemia.Therefore, be included within protection scope of the present invention by high-flux sequence acquisition miRNA-1262 expression level is same with the application of acute myeloid leukemia dependency.
The invention provides a kind of product of diagnosing acute marrow series leukemia, described product can carry out diagnosing acute marrow series leukemia by the expression level detecting miRNA-1262.
Further, product recited above comprises chip or test kit.Wherein, described chip comprises solid phase carrier; And the oligonucleotide probe be fixed on described solid phase carrier, described oligonucleotide probe comprises the part or all of sequence corresponding to miRNA-1262 recited above specifically.Described test kit comprises the reagent of the expression level for detecting miRNA-1262 recited above.
Further, oligonucleotide probe recited above also can comprise the oligonucleotide probe that can be used for the miRNA of diagnosing acute marrow series leukemia for having reported in prior art.The detection probes of multiple miRNA is placed and is also contained within protection scope of the present invention by the situation detecting multiple miRNA index Combining diagnosis acute myeloid leukemia on the same chip.
Further, described solid phase carrier comprises the various common used materials that described solid phase carrier can adopt gene chip field, such as but not limited to nylon membrane, the slide, plastic sheet etc. of the slide modified through active group (as aldehyde radical, amino etc.) or silicon chip, unmodified.
The preparation of described miRNA chip can adopt the common manufacturing method of biochip known in the art, such as, if what solid phase carrier adopted is modify slide or silicon chip, 5 ' end of probe is containing amido modified poly-dT string, oligonucleotide probe can be mixed with solution, then employing point sample instrument is by its point on modification slide or silicon chip, is arranged in predetermined sequence or array, then spent the night by placement and fix, just can obtain miRNA chip of the present invention.If nucleic acid is not containing amido modified, then its preparation method also can refer to: " the gene diagnosis technology-on-radiation operational manual " of Wang Shenwu chief editor; J.L.erisi, V.R.Iyer, P.O.BROWN.Exploringthemetabolicandgeneticcontrolofgeneex pressiononagenomicscale.Science, 1997; 278:680 and Ma Li people, Jiang Zhonghua edits. biochip. and Beijing: Chemical Industry Press, 2000,1-130.
Further, the reagent of described detection miRNA-1262 expression level comprises primer for miRNA-1262 and/or probe.Described reagent also comprises primer for the diagnosing acute marrow series leukemia miRNA reported in prior art and/or probe.The detection primer of multiple miRNA and/or probe are placed in same reagent box and are also contained within protection scope of the present invention by the situation detecting multiple miRNA index Combining diagnosis acute myeloid leukemia.
MiRNA-1262 of the present invention can be natural or synthetic, or uses the vector-transfected cell can expressing the DNA fragmentation of miRNA-1262 to obtain.Described carrier comprises virus vector, carrier for expression of eukaryon.
Virus vector can be any suitable carrier, includes but not limited to retroviral vector, adenovirus carrier, adeno-associated virus (AAV) carrier, simplexvirus (such as hsv, vaccinia virus and Epstein-Barr virus) carrier, alphavirus vectors.
Carrier for expression of eukaryon can be any suitable expression vector, include but not limited to pCMV-Myc expression vector, pcDNA3.0 expression vector, pcDNA3.1 expression vector, pEGFP expression vector, pEFBos expression vector, pTet expression vector, pTRE expression vector or the carrier through transforming on the basis of known expression vector, such as pBin438, pCAMBIA1301 etc.
The DNA fragmentation can expressing miRNA-1262 can obtain in the following way: find the position of miRNA-1262 on genome and concrete sequence information from (http://microrna.sanger.ac.uk/sequences/) miRNA database, the position of the initial miRNA of miRNA-1262 is determined according to genome sequence, in the upstream and downstream 500-800bp interval of the initial miRNA position of miRNA-1262, design Auele Specific Primer, the sequence in the middle of amplimer can obtain the DNA fragmentation of expressing miRNA-1262.
The invention provides the application of miRNA-1262 recited above in preparation treatment acute myeloid leukemia medicine.
Further, described pharmaceutical pack is containing miRNA-1262 inhibitor.Described miRNA-1262 inhibitor can suppress the expression of miRNA-1262 or can suppress the function of miRNA-1262.The suppression target of described miRNA-1262 inhibitor is not limited to miRNA-1262 itself, also comprises the upstream and downstream of miRNA-1262, such as: the genome sequence of coding miRNA-1262, and the albumen of miRNA-1262 target gene, regulation and control miRNA-1262 or gene.
Further, miRNA-1262 inhibitor comprises albumen, oligonucleotide, micromolecular compound.
Preferably, described miRNA-1262 inhibitor is antisense oligonucleotide or the antagonist of miRNA-1262.
Go out its specific antisense oligo according to miRNA-1262 sequences Design, transferred to by antisense oligonucleotide after in human body, they obviously can lower the expression of miRNA-1262." antisense oligonucleotide (antisense-oligonucleotides; AS-Ons or ASO) " is also called " antisense nucleotide ", refers to that length is about the DNA molecular of 18-26nt (more particularly about 19-22nt) or RNA molecule or its analogue.
Go out its antagonist according to miRNA-1262 sequences Design, antagonist is through the strand tiny RNA of special marking and chemically modified, after antagonist is transferred to human body, efficiently can block the expression of miRNA-1262, lowers miRNA-1262 expression level.
In the present invention, described " antisense oligonucleotide " also comprises the modified antisense nucleotide adopted as obtained based on means such as nucleic acid lock or nucleic acid chains backbone modification technology, described modification does not change the activity of antisense oligonucleotide substantially, more preferably, described modification can improve the stability of antisense oligonucleotide, activity or result for the treatment of.Nucleic acid lock (lockednucleicacid, LNA) typically refers to the modification technique 2 ' of ribose Sauerstoffatom and 4 ' carbon atom coupled together by a methylene bridge.The antisense drug developed based on the modification technique of nucleic acid chains skeleton is in solubility, and the aspects such as nuclease-resistant degraded are improved greatly, and are easy to a large amount of synthesis.The backbone modification method of oligonucleotide has multiple, comprises sulfo-method, such as, be sulfo-deoxynucleotide chain by deoxynucleotide chain thio-modification.The method is substituted by the Sauerstoffatom sulphur atom of the phosphate bond on DNA skeleton, can resist nuclease degradation.Should be understood that and anyly the major part of described antisense oligonucleotide or all active modification can be kept to be included in the present invention.
The invention provides a kind of medicine for the treatment of acute myeloid leukemia, described medicine comprises the inhibitor of miRNA-1262 recited above.
The medicine for the treatment of acute myeloid leukemia of the present invention also comprises acceptable carrier on pharmacology, and described carrier includes but not limited to: thinner, buffer reagent, suspensoid, emulsion, granule, encapsulation agents, vehicle, weighting agent, tackiness agent, sprays, cutaneous permeable agent, wetting agent, disintegrating agent, absorption enhancer, tensio-active agent, tinting material, correctives or absorption carrier.
Described medicine can be made and include but not limited to microinjection agent, be suitable for the formulation of transfection, injection liquid, tablet, pulvis, granula, capsule.The medicine of above-mentioned various formulation all can be prepared according to the ordinary method of pharmaceutical field.
Described medicine can be used separately or the medicine of acute myeloid leukemia can be suppressed to carry out combined administration with other.
The expression vector of the antisense oligonucleotide of miRNA-1262 or antagonist, miRNA-1262 antisense oligonucleotide is imported in vitro or transfection human body self or variant cell (or heterogenous cell), after vitro cell expansion, defeated the Huis' body.
Described medicine can be used in body: directly imported in body by the expression vector of the antisense oligonucleotide of miRNA-1262 or antagonist, miRNA-1262 antisense oligonucleotide.This carrier can be virus type or non-viral, or even naked DNA or RNA.
Described experimenter can be the mankind or other Mammalss.More specifically, experimenter is organ, tissue, cell.
Nucleic acid molecule of the present invention can be the form of RNA, DNA, PNA, LNA.
Advantage of the present invention and beneficial effect:
Late Cambrian of the present invention miRNA-1262 expression level develops relevant to the generation of acute myeloid leukemia, by detecting the expression level of experimenter miRNA-1262, can judge whether experimenter suffers from acute myeloid leukemia or judge whether experimenter exists the risk suffering from acute myeloid leukemia, thus instruct clinicist to provide prevention scheme or treatment plan to experimenter.
Accompanying drawing explanation
Fig. 1 display utilizes QPCR to detect the expression of miRNA-1262 in Patients with Acute Myeloid Leukemia blood;
Fig. 2 display utilizes QPCR to detect the expression of miRNA-1262 in acute myeloid leukemia cell system;
Fig. 3 shows the restraining effect that anti-miRNA-1262 expresses miRNA-1262.
Embodiment
Further illustrate the present invention below in conjunction with specific embodiment, embodiments of the invention only for explaining the present invention, and do not mean that and limit the scope of the invention.
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The screening of the miRNA that embodiment 1 is relevant to acute myeloid leukemia
1, sample acquisition: each blood sample collecting 10 routine Healthy Peoples and Patients with Acute Myeloid Leukemia.Obtaining all by the agreement of the council of organizational ethics of above-mentioned all samples.
2, the extraction of sample total serum IgE
Use the BloodRNA of U-gene company to extract test kit and extract total serum IgE.Concrete steps are as follows:
1) every volume fresh blood (maximum 1ml) adds 1 × XR-I damping fluid of 5 times of volumes, and such as: the XR-I damping fluid adding 5ml in every 1ml blood, vortex oscillation mixes;
2) ice bath 15 minutes, mixing twice rapidly in vortex oscillator, solution change shows clearly red blood cell cracking.If the hemocytometer of individual samples perhaps ECR raise time, extend the ice bath time to 20min;
3) the centrifugal 10min of 450g precipitates white corpuscle at 4 DEG C, discards the supernatant liquor containing splitting erythrocyte completely;
4) whole blood of the every volume used in step 1 with the XR-I buffer solution of 2 times of volumes, vortex oscillation is with complete suspension cell;
5) the centrifugal 10min of 450g at 4 DEG C, and again remove supernatant;
6) in agglomerating white corpuscle, add XR-II dissolve damping fluid/2 mercapto ethanol, vortex oscillation fully mixes.The whole blood of 500 below μ l just adds 400 μ lXR-II and dissolves damping fluids, if what use in step 1 is the blood of 0.5 ~ 1.0ml, then adds 650 μ lXR-II and dissolves damping fluids.After adding XR-II and dissolving damping fluid, under sample should be stored in the condition of-70 DEG C;
7) add isopyknic 70% ethanol, vortex oscillation mixes;
8) all samples (comprising all precipitations) are added on a Mu-PuRNA separator column be fixed on a 2ml collection test tube.15 seconds that 10,000g is centrifugal, discard flowing liquid;
9) repeating step 7,8;
10) inhale 750ulRNA lavation buffer solution I with liquid-transfering gun to be directly added on spin post and to wash pillar.As above method is centrifugal and discard 2ml collection tube;
11) pillar is installed to the clean new 2ml provided to collect on test tube, add the RNA lavation buffer solution II of 500 μ l alcohol dilutions, centrifugal, discard effluent liquid, reuse this collection test tube;
12) 400 μ lWashsolution are added, the centrifugal 2min of 14000g;
13) pillar is washed with the RNA lavation buffer solution II of 500 μ l again, centrifugal and discard effluent liquid.Then use the collection test tube that empty, the sub-1min of very fast centrifugal void column is to dry Mu-Pu base for post matter;
14) eluted rna.Posts transfer to the 1.5ml centrifuge tube (test kit is without providing) of a dry Net and with DEPC-water (being provided by the test kit) eluted rna of 50 ~ 100 μ l.Guarantee that the DEPC-water added directly is added in base for post matter, very fast centrifugal 1min;
15) 100 μ lEnzymeIncubationBuffer and the centrifugal 1min of 15 μ lDNaseI, 14000g are added;
16) solution in collection tube is moved into post again, room temperature places 15min;
17) RNA collected is kept in-70 DEG C of refrigerators, stand-by.
3, the mass analysis (NanoDrop1000 spectrophotometer) of RNA sample
NanoDrop1000 spectrophotometer detects RNA sample, the sample requirement of RNA-seq order-checking: OD260/OD280 is 1.8-2.2.
The RNA of said extracted is carried out agarose gel electrophoresis, AgilentTechnologies2100Bioanalyzer detects RNA sample quality, on gel imaging instrument observe, take pictures, preserve image, it is generally acknowledged 28S:18S >=2 can preliminary judgement total serum IgE quality better.
4, the extraction of miRNA and mark
1) obtain miRNA with the miRNAs extraction agent box extracting of Ambion company, concrete operations are according to respective description book.The sample method of T4RNA ligase enzyme markers step according to Thomson.MiRNA marking method is roughly as follows: 1.4 μ gmiRNA and 500ng5 '-phosphoric acid salt-cytosine(Cyt)-uridylic cy3-3 ' (Dharmacon, Chicago, USA) and 2 unit T4RNAligase (NEB, Ipswich, USA), 2 hours are hatched in 4 DEG C.The corresponding negative control of equivalent all established by every part of miRNA sample.
2) ethanol of the RNA 0.3M sodium-acetate marked and 2.5 times of volumes precipitates, resuspended containing the hybridization solution of 3 × SSC, 0.2%SDS and 15% methane amide with 15 μ l again, all hybridization repeats twice, hybridization uses LifterSlipTM (Erie, PAUSA) to ensure hybridization solution Uniform Flow between chip and cover plate.
3) hybridization chamber is placed on (CapitalBioCorp, Beijing, China) on hybridization instrument BioMixerTMII to spend the night in 42 DEG C of water-baths, washes twice by washing lotion.
5, miRNA chip operation:
MiRNA chip, adopt the miRNA chip of expression spectrum (single passage chip) of Boao Biological Co., Ltd, the detection of miRNA express spectra is carried out in instruction to specifications.
6, result:
Analyze the detected result of miRNA chip express spectra, there is significant difference in the expression of known miRNA-1262 in the blood of Patients with Acute Myeloid Leukemia blood and Healthy People, compared with the blood of Healthy People, the level of the miRNA-1262 in Patients with Acute Myeloid Leukemia blood significantly raises.
Embodiment 2QPCR verifies the miRNA-1262 of differential expression
1, miRNA-1262 is selected to carry out large sample QPCR checking according to the detected result of miRNA chip.According to the sample collection way selection Patients with Acute Myeloid Leukemia blood sample in embodiment 1 and each 80 examples of healthy human blood's sample.
2, RNA leaching process is with embodiment 1.
3, reverse transcription:
1) the total serum IgE template of 10pg-1 μ g is mixed with 2 μ l10 × damping fluids, 2 μ ldATP (10mM), 0.5 μ lpolyA polymerase, 0.5 μ l rnase (RNase) inhibitor and deoxyribonuclease water (RNasefreewater), volume is finally 20 μ l, hatches 1h for 37 DEG C.
2) add 1 μ l0.5 μ g/ μ lOligo (dT) specific RT primer in reaction tubes, hatch 5min for 70 DEG C.
3) hatch at least 2min on ice immediately, interrupt the secondary structure of RNA and primer.
4) by above-mentioned 20 μ l reaction mixtures and 4 μ l5 × damping fluid, 1 μ ldNTP (10mM), 0.5 μ lM-MLV reversed transcriptive enzyme, 0.5 μ l rnase (RNase) inhibitor, 10 μ lpolyA reaction mixtures and the mixing of 4 μ l deoxyribonucleases water (RNasefreewater), hatch 1h for 42 DEG C.
4, QPCR reaction:
1) design of primers
The primer of amplification miRNA-1262
Forward primer: ATGGGTGAATTTGTAGAAGGAT (SEQIDNO.2)
Reverse primer: GTGCAGGGTCCGAGGT (SEQIDNO.3)
The primer of amplification U6snRNA
Forward primer: CTCGCTTCGGCAGCACA (SEQIDNO.4)
Reverse primer: AACGCTTCACGAATTTGCGT (SEQIDNO.5)
2) PCR reaction system is prepared according to table 1:
Wherein, SYBRGreen polymerase chain reaction system is purchased from Invitrogen company.
Table 1PCR reaction system
| Volume | |
| SYBR Green polymerase chain reaction system | 12.5μl |
| Forward primer | 1μl |
| Reverse primer | 1μl |
| CDNA template | 2μl |
| ddH 2O | 8.5μl |
| Cumulative volume | 25μl |
3) PCR reaction conditions: 95 DEG C of 10min, (95 DEG C of 15s, 60 DEG C of 60s) × 45 circulations.Using SYBRGreen as fluorescent marker, in the enterprising performing PCR reaction of LightCycler quantitative real time PCR Instrument, using U6snRNA as reference gene, by melt curve analysis analysis and electrophoresis determination object band, Δ Δ CT method carries out relative quantification.
5, result
As shown in Figure 1, compared with the blood of Healthy People, the expression level of the miRNA-1262 in Patients with Acute Myeloid Leukemia blood significantly raises, consistent with miRNA chip results.
The expression of embodiment 3miRNA-1262 in acute myeloid leukemia cell system
1, cell cultures
By Acute myelocytic leukemia cell line U937, THP, KG-1 and the use from AML patient and the BMNC be separated in Healthy People, containing the RPMI1640 substratum cellar culture of 10% foetal calf serum, are placed in 37 DEG C, 5%CO
2in incubator.
2、QPCR
2.1 cell total rna extracts: utilize the RNA of QIAGEN company extraction test kit to carry out the extraction of cell total rna, instruction is carried out to specifications.
2.2QPCR: step is with embodiment 2.
3, result
As shown in Figure 2, compared with Healthy People BMNC, Acute myelocytic leukemia cell line U937, in the BMNC of THP, KG-1 and AML patient, the expression of miRNA-1262 obviously raises (P<0.05).
Embodiment 4 studies the impact of miRNA-1262 on acute myeloid leukemia cell multiplication capacity
1, design and synthesis is for the antisense oligonucleotide (anti-miRNA-1262) of miRNA-1262
According to the sequence information of miRNA-1262 by the precious biotinylated biomolecule Technology Co., Ltd. design and synthesis anti-miRNA-1262 in Dalian and random controls sequence.
2, cell cultures: U937 cell culture processes is with embodiment 3.
3, cell transfecting
U937 cell is divided into two groups, is respectively and suppresses negative control group (anti-NC), miRNA-1262 suppression group (anti-miRNA-1262).By negative control group and other transfection anti-NC and anti-miRNA-1262 of constituents for suppressing, use transfection reagent LipofectamineTM2000 to carry out transfection, transfection method is with reference to specification sheets.The working concentration of anti-NC and anti-miRNA-1262 is 5 μMs.After transfection, 48h collects each group of cell for subsequent experimental.
4, QPCR experiment
Cell total rna extraction and PCR step are with embodiment 3.
Result as shown in Figure 3, compared with suppression negative control group (anti-NC), the level of the miRNA-1262 of miRNA-1262 suppression group (anti-miRNA-1262) significantly declines, and shows that anti-miRNA-1262 effectively can suppress the expression of miRNA-1262.
5, cell proliferation experiment
0.25% trysinization is used to become cell suspension, with 5 × 10 in the U937 cell of transfection 48h
4individual/ml is inoculated in 96 porocyte culture plates, every hole 0.1ml, and after 60min, mtt assay surveys each hole 490nm wavelength light absorption value, represents the relative populations of viable cell by absorbance value size.
6, result
MiRNA-1262 suppression group (anti-miRNA-1262) relative optical density number is 0.322 ± 0.023, suppresses negative control group (anti-NC) relative optical density number to be 1.426 ± 0.098.Compared with suppression negative control group (anti-NC), miRNA-1262 suppression group (anti-miRNA-1262) absorbance value significantly declines (P<0.05).Above-mentioned experimental result shows that anti-miRNA-1262 can significantly suppress U937 ability of cell proliferation, shows that miRNA-1262 is conducive to U937 cell proliferation simultaneously.
The explanation of above-described embodiment is just for understanding method of the present invention and core concept thereof.It should be pointed out that for the person of ordinary skill of the art, under the premise without departing from the principles of the invention, can also carry out some improvement and modification to the present invention, these improve and modify and also will fall in the protection domain of the claims in the present invention.
Claims (10)
- The application of 1.miRNA-1262 in the product preparing diagnosing acute marrow series leukemia, is characterized in that, described miRNA-1262 is selected from least one in following group: miRNA-1262 initial miRNA, miRNA-1262 precursor miRNA, ripe miRNA-1262; The initial miRNA of described miRNA-1262 can be sheared and be expressed as ripe miRNA-1262 in people's cell; Described miRNA-1262 precursor miRNA can be sheared and be expressed as ripe miRNA-1262 in people's cell.
- 2. application according to claim 1, is characterized in that, described miRNA-1262 is ripe miRNA-1262.
- 3. the application of miRNA-1262 according to claim 1 in high-flux sequence platform, it is characterized in that, by the expression level of high throughput testing miRNA-1262, analyze and know that the abnormal expression of described miRNA-1262 is to the generation of acute myeloid leukemia with develop relevant.
- 4. a product for diagnosing acute marrow series leukemia, is characterized in that, described product can carry out diagnosing acute marrow series leukemia by the expression level detecting miRNA-1262.
- 5. product according to claim 4, is characterized in that, described product comprises chip or test kit.Wherein, described chip comprises solid phase carrier; And the oligonucleotide probe be fixed on described solid phase carrier, described oligonucleotide probe comprises the part or all of sequence corresponding to miRNA-1262 according to claim 1 specifically.Described test kit comprises the reagent of the expression level requiring the miRNA-1262 described in 1 for test right.
- 6. the application of miRNA-1262 according to claim 1 in preparation treatment acute myeloid leukemia medicine.
- 7. application according to claim 6, is characterized in that, described pharmaceutical pack is containing the inhibitor of miRNA-1262 described in claim 1.
- 8. application according to claim 7, is characterized in that, the inhibitor of described miRNA-1262 can suppress the expression of miRNA-1262 or can suppress the function of miRNA-1262.
- 9. application according to claim 8, is characterized in that, the inhibitor of described miRNA-1262 is antisense oligonucleotide or the antagonist of miRNA-1262.
- 10. treat a medicine for acute myeloid leukemia, it is characterized in that, described medicine comprises the inhibitor described in any one of 7-9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510549473.1A CN105063052B (en) | 2015-08-31 | 2015-08-31 | Acute myeloid leukemia miRNA markers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510549473.1A CN105063052B (en) | 2015-08-31 | 2015-08-31 | Acute myeloid leukemia miRNA markers |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105063052A true CN105063052A (en) | 2015-11-18 |
| CN105063052B CN105063052B (en) | 2018-06-29 |
Family
ID=54492565
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510549473.1A Active CN105063052B (en) | 2015-08-31 | 2015-08-31 | Acute myeloid leukemia miRNA markers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105063052B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164546A (en) * | 2017-07-19 | 2017-09-15 | 北京泱深生物信息技术有限公司 | MiRNA, composition and its application in diagnosing the illness |
| CN107236799A (en) * | 2017-06-15 | 2017-10-10 | 昆明医科大学第六附属医院 | A kind of kidney fibrosis miRNA labels |
| CN108359671A (en) * | 2018-05-14 | 2018-08-03 | 苏州大学 | Tumour cell Sugar intake inhibitor and its application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886115A (en) * | 2009-05-11 | 2010-11-17 | 中国医学科学院基础医学研究所 | Application of three microRNAs in diagnosis and treatment of human acute myeloid leukemia |
| CN103210089A (en) * | 2010-08-13 | 2013-07-17 | 格拉斯哥大学大学行政评议会 | Therapeutic uses of microvesicles and related microRNAs |
| WO2013139711A1 (en) * | 2012-03-19 | 2013-09-26 | Prestizia | Methods for determining the tropism and receptor usage of a virus, in particular hiv, in body samples taken from the circulation |
| CN103476947A (en) * | 2011-03-02 | 2013-12-25 | 格路福生物制药公司 | Enhanced biodistribution of oligomers |
| CN104208723A (en) * | 2014-09-12 | 2014-12-17 | 武汉大学 | Application of miR-638 in resisting acute myelogenous leukemia |
-
2015
- 2015-08-31 CN CN201510549473.1A patent/CN105063052B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886115A (en) * | 2009-05-11 | 2010-11-17 | 中国医学科学院基础医学研究所 | Application of three microRNAs in diagnosis and treatment of human acute myeloid leukemia |
| CN103210089A (en) * | 2010-08-13 | 2013-07-17 | 格拉斯哥大学大学行政评议会 | Therapeutic uses of microvesicles and related microRNAs |
| CN103476947A (en) * | 2011-03-02 | 2013-12-25 | 格路福生物制药公司 | Enhanced biodistribution of oligomers |
| WO2013139711A1 (en) * | 2012-03-19 | 2013-09-26 | Prestizia | Methods for determining the tropism and receptor usage of a virus, in particular hiv, in body samples taken from the circulation |
| CN104208723A (en) * | 2014-09-12 | 2014-12-17 | 武汉大学 | Application of miR-638 in resisting acute myelogenous leukemia |
Non-Patent Citations (2)
| Title |
|---|
| ZEJUAN LI ET AL.: "Distinct microRNA expression profiles in acute myeloid leukemia with common translocations", 《PNAS》 * |
| 王小爽 张俊武: "microRNA-新的髓系白血病致病因子及临床标志物", 《中国生物化学与分子生物学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107236799A (en) * | 2017-06-15 | 2017-10-10 | 昆明医科大学第六附属医院 | A kind of kidney fibrosis miRNA labels |
| CN107236799B (en) * | 2017-06-15 | 2020-06-09 | 昆明医科大学第六附属医院 | Kidney fibrosis miRNA marker |
| CN107164546A (en) * | 2017-07-19 | 2017-09-15 | 北京泱深生物信息技术有限公司 | MiRNA, composition and its application in diagnosing the illness |
| CN108359671A (en) * | 2018-05-14 | 2018-08-03 | 苏州大学 | Tumour cell Sugar intake inhibitor and its application |
| CN108359671B (en) * | 2018-05-14 | 2021-08-27 | 苏州大学 | Tumor cell sugar uptake inhibitor and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105063052B (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107130027B (en) | Application of the biomarker in colorectal cancer | |
| CN101988061A (en) | Breast cancer detecting marker as well as detecting method, kit and biological chip thereof | |
| CN105177174A (en) | miRNA (microribonucleic acid) biomarkers and detection kit for colon cancer diagnosis | |
| CN107312852A (en) | Myocardial infarction diagnosis mark compositions | |
| CN105154541A (en) | Application of miRNA to diagnosis and treatment of acute myelogenous leukemia | |
| CN104152567A (en) | Application of miRNA-199a in preparation of diagnostic kit | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN105063052A (en) | Acute myelogenous leukemia miRNA marker | |
| CN105349666A (en) | Cerebral-arterial-thrombosis miRNA marker | |
| CN105441565A (en) | miRNA regarding as osteosarcoma treatment target | |
| CN105506156A (en) | Molecular marker for diagnosing osteosarcoma | |
| CN101988062A (en) | cervical cancer detection markers and detection method, kit and biochip thereof | |
| CN104774966A (en) | Lung adenocarcinoma miRNA marker | |
| CN107312851A (en) | Myocardial infarction biomarker miR 1283 | |
| CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application | |
| CN105148274A (en) | Application of miRNA-885-5p to diagnosis and treatment of acute myelogenous leukemia | |
| CN106191264A (en) | Osteosarcomatous miRNA diagnosis marker | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN109652529A (en) | Osteoporosis specificity miRNA, composition and its diagnostic use | |
| CN105349667A (en) | Cerebral-arterial-thrombosis diagnosis marker | |
| CN105177149A (en) | Application of miRNA in liver cirrhosis diagnosis and treatment | |
| CN104059988B (en) | A kind of marker gene CST1 and application thereof | |
| CN105169393A (en) | Application of miRNA-548a-3p in resistance to acute myelogenous leukemia | |
| CN106435004A (en) | Application of serum exosome miRNAs marker to early diagnosis of endemic arsenism | |
| CN102021169A (en) | Serum/plasma miRNA composition and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Shi Xiaofeng Inventor after: Dong Dong Inventor after: Yang Chenggang Inventor before: Bian Yang Inventor before: Yang Chenggang |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210401 Address after: 266000 room 2503, Qianshan building, D2, Qingdao International Innovation Park Phase II, No.1 Keyuan Weiyi Road, Laoshan District, Qingdao City, Shandong Province Patentee after: Qingdao Yangshen biomedical Co.,Ltd. Address before: 100080 room 3103, cube court building, 1 good luck street, Haidian District, Beijing. Patentee before: BEIJING MEDINTELL BIOMED INFORMATION TECHNOLOGY Co.,Ltd. |