CN105039509A - Kit for simultaneously detecting food-borne disease pathogenic bacteria - Google Patents
Kit for simultaneously detecting food-borne disease pathogenic bacteria Download PDFInfo
- Publication number
- CN105039509A CN105039509A CN201510230334.2A CN201510230334A CN105039509A CN 105039509 A CN105039509 A CN 105039509A CN 201510230334 A CN201510230334 A CN 201510230334A CN 105039509 A CN105039509 A CN 105039509A
- Authority
- CN
- China
- Prior art keywords
- gene
- seqidno
- probe
- nucleotide sequence
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for simultaneously detecting food-borne disease pathogenic bacteria, herein the food-borne disease pathogenic bacteria includes: salmonella, shigella, escherichia coli, vibrio cholerae, yersinia enterocolitica and vibrio parahaemolyticus. The kit includes a PCR reaction solution which individually includes a first reaction liquid, a second reaction liquid and a stabilizer. The first reaction liquid contains a primer probe with SsaR gene (salmonella), IpaH gene (shigella), ydiJ gene (escherichia coli), ToxR gene (vibrio parahaemolyticus), hlyA gene (vibrio cholerae) and gytB gene (yersinia enterocolitica) as target genes, wherein the primer probe is used in fluorogenic quantitative PCR of the SsaR, IpaH, ydiJ, ToxR, hlyA and gytB genes. The kit can simultaneously detecting various pathogenic bacteria, is greatly reduced in detection time, is increased in operator safety due to short contact time with the pathogenic bacteria, and is convenient to use and is free of false positive.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of test kit simultaneously detecting food origin disease pathogenic bacteria, be specifically related to one and detect Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus detection kit simultaneously.
Background technology
Along with the exposure of increasing food safety accident in recent years, food-safety problem has become the hot issue that only one China the general common people pays close attention to the most.Food origin disease is the subject matter of food safety, and food origin disease is defined as by the World Health Organization: " every human body that to enter by ingesting makes human body suffer from infectious or toxic disease ".Here include by the food origin disease that food microorganisms pollute and chemical substance causes.And the food origin disease that microorganism causes is the subject matter of food safety.Vomiting and diarrhoea type food poisoning is situation the most common in burst food poisoning.Bacillary vomiting and diarrhoea type food poisoning causes primarily of bacteriological infection such as Salmonellas, Shigellae, pathogenic colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus.The World Health Organization in March, 2002 announces, and the diarrhoea case that the whole world causes because of the microbial contamination of food source property every year reaches billions of, dead 0-15 year children about 1,700,000.Have at least the people of 1/3 to suffer from food origin disease in developed country, on food origin disease, cost reaches multi-million dollar.In recent years, domestic and international food origin disease event also occurs again and again, as the mad cow disease of Britain, the hemorrhagic colon bacillus O157:H7 of Japan and the staphylococcal enterotoxin poison of Seichin milk break out, the listeria spp of France is poisoning, extensive outbreak of epidemic of O157:H7 that the ground such as the hepatitis A in Shanghai in 1998 is very popular, Su Wan in 1999 cause etc.WHO estimates that the rate of failing to report of various countries' food origin disease is more than 90%, and that is, annual announcement Bacterial foodborne diseases event is tip of the iceberg for its actual incidence.
Therefore, caused countries in the world to the Prevention and controls of food origin disease to pay close attention to.The detection technique of food origin disease cause of disease is the sport technique segment of the Prevention and controls crux of food origin disease.Although our country has formulated the relevant food poisoning pathogenic bacteria method of inspection at present, but what all adopt due to detection method is longer detection method classical, consuming time, and there is the problems such as internal reagent supply does not match, be therefore difficult to adapt to public health event emergency processing quick response needs.Along with the progress in epoch, the rapidity of detection method, advance, the performance index such as sensitivity and specificity are had higher requirement.Especially, when running into the accident of some new pathogenic bacterias and viral food origin disease, quick, sensitive, special detection method just seems even more important.
The popularization of the development of molecular Biological Detection technology, especially fluorescence quantitative PCR detection technique, for microorganism food poisoning rapid detection provides good technology platform.The most widely used is in the market probe method fluorescence quantitative PCR detection technique, it have highly sensitive, specificity good, detect the advantages such as quick.Also have the popularization of corresponding fluorescent quantificationally PCR detecting kit in the market, but detect while being mostly confined to 1 ~ 3 kind of bacterium, very difficult satisfied burst food poisoning one is managed many inspections and is found out nosogenetic detection demand fast.Therefore, a kind of quick, easy, high-throughout multiple fluorescence quantitative PCR food source of exploitation pathogenic microbes detect method is necessary.
Summary of the invention
goal of the invention:long for sense cycle of the prior art, operation is loaded down with trivial details, sensitivity is low, detect the shortcomings such as flux is low, the invention provides a kind ofly once to test the detection kit simultaneously detecting Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica rapidly and accurately.
technical scheme:a kind of test kit simultaneously detecting food origin disease pathogenic bacteria provided by the invention, described food origin disease pathogenic bacteria comprises Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus, described test kit comprises PCR reaction solution, and described PCR reaction solution comprises the first reaction solution, the second reaction solution and stablizer independently; Wherein, described first reaction solution comprises respectively with the primed probe of SsaR gene (Salmonellas), IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) SsaR, IpaH, ydiJ, ToxR, hlyA and gytB gene for target gene and for quantitative fluorescent PCR.
As preferably, the primed probe of described SsaR gene (Salmonellas) is:
The primer of SsaR gene:
1F:5’—GAACCTGGCCTGAAGACATAAA—3’(SEQIDNO:1)，
1R:5’—AGGTCAATAGCCAGAAAGGGA—3’(SEQIDNO:2)，
The probe of SsaR gene:
1A:5-(FAM)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:3)；
1H:5-(HEX)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:4)；
The primed probe of described IpaH gene (Shigellae) is:
The primer of IpaH gene:
2F:5’—TGAAGGAAATGCGTTTCTATG—3’(SEQIDNO:5)，
2R:5’—AGGGAGAACCAGTCCGTAAA—3’(SEQIDNO:6)，
The probe of IpaH gene:
2A:5’-(FAM)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ1)-3’(SEQIDNO:7)；
2X:5’-(ROX)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ2)-3’(SEQIDNO:8)；
The primed probe of described ydiJ gene (colon bacillus) is:
The primer of ydiJ gene:
3F:5’—ATTTGGCGAAAATGGCAGTAAC—3’(SEQIDNO:9)，
3R:5’—CAGCTATTACGATGCGCAAGTG—3’(SEQIDNO:10)，
The probe of ydiJ gene:
3A:5’-(FAM)GGAAACCTAATTTTTCGACCAGACGGA(BHQ1)-3’(SEQIDNO:11)；
3Y5:5’-(CY5)GGAAACCTAATTTTTCGACCAGACGGA(BHQ2)-3’(SEQIDNO:12)；
The primed probe of described ToxR gene (Vibrio parahemolyticus) is:
The primer of ToxR gene:
4F:5’—GAAGTTGTACGATTAGGAAGC—3’(SEQIDNO:13)，
4R:5’—TGCTCACGCCAAACAAAC—3’(SEQIDNO:14)，
The probe of ToxR gene:
4H:5’-(HEX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ1)-3’(SEQIDNO:15)；
4X:5’-(ROX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ2)-3’(SEQIDNO:16)；
The primed probe of described hlyA gene (vibrio cholerae) is:
The primer of hlyA gene:
5F:5’—GCTTTATTGTTCGATGCGTTAAAC—3’(SEQIDNO:17)，
5R:5’—GATGCCAAAATTGTGCGTATCA—3’(SEQIDNO:18)，
The probe of hlyA gene:
5H:5’-(HEX)TCTTGGGCAATCGCATCGGTTGA(BHQ1)-3’(SEQIDNO:19)；
5Y5:5’-(CY5)TCTTGGGCAATCGCATCGGTTGA(BHQ2)-3’(SEQIDNO:20)；
The primed probe of described gytB gene (Yersinia enterocolitica) is:
The primer of gytB gene:
6F:5’—AAGAAGGCCTTCGGGTTGTAA—3’(SEQIDNO:21)，
6R:5’—TTCTGCGAGTAACGTCAATCACA—3’(SEQIDNO:22)，
The probe of gytB gene:
6X:5’-(ROX)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:23)；
6Y5:5’-(CY5)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:24)。
As preferred further, described first reaction solution also comprises not containing 10 × buffer, the MgCl of magnesium ion
2, dNTPs and sterilizing ultrapure water, each volume components number of described first reaction solution is:
The primer of SsaR gene:
1F0.1-0.2 part of 25-50 μM;
1R0.1-0.2 part of 25-50 μM;
The probe of SsaR gene:
1A0.05-0.15 part of 25-50 μM;
1H0.05-0.15 part of 25-50 μM;
The primer of IpaH gene:
2F0.1-0.2 part of 25-50 μM
2R0.1-0.2 part of 25-50 μM;
The probe of IpaH gene:
2A0.05-0.15 part of 25-50 μM;
2X0.05-0.15 part of 25-50 μM;
The primer of ydiJ gene:
3F0.1-0.2 part of 25-50 μM
3R0.1-0.2 part of 25-50 μM;
The probe of ydiJ gene:
3A0.05-0.15 part of 25-50 μM;
3Y50.05-0.15 part of 25-50 μM;
The primer of ToxR gene:
4F0.1-0.2 part of 25-50 μM
4R0.1-0.2 part of 25-50 μM;
The probe of ToxR gene:
4H0.05-0.15 part of 25-50 μM;
4X0.05-0.15 part of 25-50 μM;
The primer of hlyA gene:
5F0.1-0.2 part of 25-50 μM
5R0.1-0.2 part of 25-50 μM;
The probe of hlyA gene:
5H0.05-0.15 part of 25-50 μM;
5Y50.05-0.15 part of 25-50 μM;
The primer of gytB gene:
6F0.1-0.2 part of 25-50 μM;
6R0.1-0.2 part of 25-50 μM;
The probe of gytB gene:
6X0.05-0.15 part of 25-50 μM;
6Y50.05-0.15 part of 25-50 μM;
Not containing 10 × buffer2-4 part of magnesium ion;
The MgCl of 25mM
22-4 part;
DNTPs2-4 part;
Sterilizing ultrapure water 4.35-11.25 part.
Preferred as another kind, described second reaction solution comprises archaeal dna polymerase, nitrite ion and sterilizing ultrapure water.
As preferred further, described archaeal dna polymerase is Taq enzyme, and its concentration is 5-10U/ μ l; Described nitrite ion is tetrabromophenol sulfonphthalein; The each volume components number of described second reaction solution is:
Described Taq enzyme 0.15-0.3 volume parts;
Tetrabromophenol sulfonphthalein 0.01-0.02 volume parts;
Sterilizing ultrapure water 1.68-1.84 volume parts.
Preferred as another kind, described stablizer is paraffin; First reaction solution and the second reaction solution are separated by stablizer, and the first reaction solution is positioned at below stablizer, and the second reaction solution is above stablizer.
Preferred as another kind, described test kit also comprises DNA extraction liquid, negative controls and positive control solution;
Described DNA extraction liquid is the Tris-EDTA damping fluid of the pH7.98-8.02 of 0.01-0.02M, and described Tris-EDTA damping fluid is the NP-40 of 0.01%-0.02% containing volume percent;
Described negative controls is not containing the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 of Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus genomic dna;
Described positive control solution is the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 containing Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus genomic dna.
Present invention also offers a kind of method simultaneously detecting food origin disease pathogenic bacteria, described food origin disease pathogenic bacteria comprises Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus, utilizes mentioned reagent box to carry out fluorescence quantitative PCR detection.
Preferably, described fluorescence quantitative PCR detection reaction conditions is:
50-55℃：2-5min；
94-95℃：2-3min；
94-95 DEG C: 5-10S, 55-60 DEG C: 40-80S, 35-45 circulation.
Preferably, Salmonellas FAM and HEX two kinds of fluorescent probe marks, Shigellae FAM and ROX two kinds of fluorescent probe marks, colon bacillus FAM and CY5 two kinds of fluorescent probe marks, vibrio cholerae HEX and CY5 two kinds of fluorescent probe marks, Yersinia enterocolitica ROX and CY5 two kinds of fluorescent probe marks, Vibrio parahemolyticus HEX and ROX two kinds of fluorescent probe marks; Described fluorescence quantitative PCR detection result decision method is:
beneficial effect:test kit and the using method thereof simultaneously detecting food origin disease pathogenic bacteria provided by the invention, utilizes multiple fluorescence quantitative PCR technology for Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, the specific gene SsaR gene (Salmonellas) of vibrio cholerae and Yersinia enterocolitica, IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) detect, and the operational cycle avoided in tradition cultivation detection method is long, required reagent is various, small throughput, to shortcomings such as operator's subjectivity dependences, and once can test and realize Salmonellas simultaneously, Shigellae, colon bacillus, Vibrio parahemolyticus, the detection of vibrio cholerae and Yersinia enterocolitica six kinds of pathogenic bacterium, the present invention by detection time by tradition cultivate detection method within more than 36 hours, shorten to 5 hours, and only need short-time contact germ and add operator's security, and have easy and simple to handle and there will not be the advantages such as false positive.
Accompanying drawing explanation
Fig. 1 is schematically illustrating of the Ct value that uses of the present invention, and wherein said threshold line corresponds to particular probe;
Fig. 2 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out the schema detected;
Fig. 3 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out the result of the positive control detected, and wherein four threshold lines correspond respectively to four kinds of fluorescently-labeled probes, are corresponding in turn to FAM, HEX, ROX, CY5 from top to bottom;
Fig. 4 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out the result of the negative control detected, and wherein four threshold lines correspond respectively to four kinds of fluorescently-labeled probes, are corresponding in turn to FAM, HEX, ROX, CY5 from top to bottom;
Fig. 5 is the fluorescent quantitative PCR result using the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out Salmeterol fluticasone propionate to obtain, and wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to FAM, HEX from top to bottom.
Fig. 6 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out Shigellae to detect the fluorescent quantitative PCR result obtained, and wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to FAM, ROX from top to bottom.
Fig. 7 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out colon bacillus to detect the fluorescent quantitative PCR result obtained, wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to FAM, CY5 from top to bottom.
Fig. 8 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out Vibrio parahemolyticus to detect the fluorescent quantitative PCR result obtained, wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to HEX, ROX from top to bottom.
Fig. 9 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out vibrio cholerae to detect the fluorescent quantitative PCR result obtained, and wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to HEX, CY5 from top to bottom.
Figure 10 uses the test kit simultaneously detecting food origin disease pathogenic bacteria of the present invention to carry out Yersinia enterocolitica to detect the fluorescent quantitative PCR result obtained, wherein two threshold lines correspond respectively to two kinds of fluorescently-labeled probes, are corresponding in turn to ROX, CY5 from top to bottom.
Embodiment
Below in conjunction with accompanying drawing the present invention made and further illustrating.
Following shortenings is applicable to the present invention:
PCR:PolymeraseChainReaction, polymerase chain reaction
Tris: triisopropyl second sulphonyl
EDTA:ethylenediaminetetraaceticacid, ethylenediamine tetraacetic acid (EDTA)
DNTP:deoxy-ribonucleosidetriphosphate, deoxyribonucleoside triphosphate
FAM:Carboxyfluorescein, Fluoresceincarboxylic acid
HEX:hexachloro-fluorescein, chlordene fluorescein
ROX:Carboxy-X-rhodamine, carboxy-X-rhodamine
CY5:5-N-hydroxysuccinimide eater
Ct:cyclethreshold, the cycle number experienced when the fluorescent signal in each PCR reaction tubes arrives the threshold value of setting, see Fig. 1.
The term " concentration " used in this specification sheets, if not otherwise indicated, all refers to starting point concentration, namely with other liquid mixing before concentration.
Fluorescent quantitative PCR technique is all widely used in fields such as basic scientific research, clinical diagnosis, disease research and medicament research and development.Its ultimate principle is: in PCR reaction system, introduce a kind of fluorescent chemical, and along with the carrying out of PCR reaction, PCR reaction product constantly accumulates, and fluorescence signal intensity also equal proportion increases.Often through a circulation, collect a fluorescence signal intensity, the change of product amount so just can be monitored by fluorescence intensity change, obtain an amplified fluorescence graphic representation, see Fig. 1, in the exponent amplification stage, there is linear relationship between the logarithmic value of PCR primer amount and starting template amount, can quantitative analysis be carried out.
Based on above technology, the test kit of the food origin disease of detection simultaneously pathogenic bacteria of the present invention is for SsaR gene (Salmonellas), IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) six gene design Auele Specific Primers and probe, containing SsaR in reaction system, IpaH, ydiJ, ToxR, when hlyA and gytB genes DNA template, PCR reaction is carried out and is discharged fluorescent signal.Utilize quantitative real time PCR Instrument to carry out Real-Time Monitoring and output to strength of signal corresponding in PCR process, realize the qualitative analysis of detected result.
The embodiment of the present invention provides a kind of test kit simultaneously detecting food origin disease pathogenic bacteria, comprise PCR reaction solution, described PCR reaction solution comprises the first reaction solution, second reaction solution and stablizer, described first reaction solution comprises with SsaR gene (Salmonellas), IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) are target gene, and for the SsaR of quantitative fluorescent PCR, IpaH, ydiJ, ToxR, the primed probe of hlyA and gytB gene.
Preferably, the embodiment of the present invention detects in the test kit of food origin disease pathogenic bacteria simultaneously,
The primed probe of above-mentioned SsaR gene (Salmonellas) is:
The primer of SsaR gene:
1F:5’—GAACCTGGCCTGAAGACATAAA—3’(SEQIDNO:1)，
1R:5’—AGGTCAATAGCCAGAAAGGGA—3’(SEQIDNO:2)，
The probe of SsaR gene:
1A:5’-(FAM)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:3);
1H:5’-(HEX)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:4);
The primed probe of above-mentioned IpaH gene (Shigellae) is:
The primer of IpaH gene:
2F:5’—TGAAGGAAATGCGTTTCTATG—3’(SEQIDNO:5)，
2R:5’—AGGGAGAACCAGTCCGTAAA—3’(SEQIDNO:6)，
The probe of IpaH gene:
2A:5’-(FAM)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ1)-3’(SEQIDNO:7);
2X:5’-(ROX)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ2)-3’(SEQIDNO:8);
The primed probe of above-mentioned ydiJ gene (colon bacillus) is:
The primer of ydiJ gene:
3F:5’—ATTTGGCGAAAATGGCAGTAAC—3’(SEQIDNO:9)，
3R:5’—CAGCTATTACGATGCGCAAGTG—3’(SEQIDNO:10)，
The probe of ydiJ gene:
3A:5’-(FAM)GGAAACCTAATTTTTCGACCAGACGGA(BHQ1)-3’(SEQIDNO:11);
3Y5:5’-(CY5)GGAAACCTAATTTTTCGACCAGACGGA(BHQ2)-3’(SEQIDNO:12);
The primed probe of above-mentioned ToxR gene (Vibrio parahemolyticus) is:
The primer of ToxR gene:
4F:5’—GAAGTTGTACGATTAGGAAGC—3’(SEQIDNO:13)，
4R:5’—TGCTCACGCCAAACAAAC—3’(SEQIDNO:14)，
The probe of ToxR gene:
4H:5’-(HEX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ1)-3’(SEQIDNO:15);
4X:5’-(ROX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ2)-3’(SEQIDNO:16);
The primed probe of above-mentioned hlyA gene (vibrio cholerae) is:
The primer of hlyA gene:
5F:5’—GCTTTATTGTTCGATGCGTTAAAC—3’(SEQIDNO:17)，
5R:5’—GATGCCAAAATTGTGCGTATCA—3’(SEQIDNO:18)，
The probe of hlyA gene:
5H:5’-(HEX)TCTTGGGCAATCGCATCGGTTGA(BHQ1)-3’(SEQIDNO:19);
5Y5:5’-(CY5)TCTTGGGCAATCGCATCGGTTGA(BHQ2)-3’(SEQIDNO:20);
The primed probe of above-mentioned gytB gene (Yersinia enterocolitica) is:
The primer of gytB gene:
6F:5’—AAGAAGGCCTTCGGGTTGTAA—3’(SEQIDNO:21)，
6R:5’—TTCTGCGAGTAACGTCAATCACA—3’(SEQIDNO:22)，
The probe of gytB gene:
6X:5’-(ROX)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:23);
6Y5:5’-(CY5)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:24);
Preferably, the embodiment of the present invention detects in the test kit of food origin disease pathogenic bacteria simultaneously, and described first reaction solution also comprises not containing 10 × buffer, the MgCl of magnesium ion
2, dNTPs, sterilizing ultrapure water, each volume components number of described first reaction solution is:
The primer of SsaR gene:
The 1F0.1-0.2 volume parts of 25-50 μM
The 1R0.1-0.2 volume parts of 25-50 μM;
The probe of SsaR gene:
The 1A0.05-0.15 volume parts of 25-50 μM;
The 1H0.05-0.15 volume parts of 25-50 μM;
The primer of IpaH gene:
The 2F0.1-0.2 volume parts of 25-50 μM
The 2R0.1-0.2 volume parts of 25-50 μM;
The probe of IpaH gene:
The 2A0.05-0.15 volume parts of 25-50 μM;
The 2X0.05-0.15 volume parts of 25-50 μM;
The primer of ydiJ gene:
The 3F0.1-0.2 volume parts of 25-50 μM
The 3R0.1-0.2 volume parts of 25-50 μM;
The probe of ydiJ gene:
The 3A0.05-0.15 volume parts of 25-50 μM;
The 3Y50.05-0.15 volume parts of 25-50 μM;
The primer of ToxR gene:
The 4F0.1-0.2 volume parts of 25-50 μM
The 4R0.1-0.2 volume parts of 25-50 μM;
The probe of ToxR gene:
The 4H0.05-0.15 volume parts of 25-50 μM;
The 4X0.05-0.15 volume parts of 25-50 μM;
The primer of hlyA gene:
The 5F0.1-0.2 volume parts of 25-50 μM
The 5R0.1-0.2 volume parts of 25-50 μM;
The probe of hlyA gene:
The 5H0.05-0.15 volume parts of 25-50 μM;
The 5Y50.05-0.15 volume parts of 25-50 μM;
The primer of gytB gene:
The 6F0.1-0.2 volume parts of 25-50 μM
The 6R0.1-0.2 volume parts of 25-50 μM;
The probe of gytB gene:
The 6X0.05-0.15 volume parts of 25-50 μM;
The 6Y50.05-0.15 volume parts of 25-50 μM;
Not containing 10 × buffer2-4 volume parts of magnesium ion
The MgCl of 25mM
22-4 volume parts
DNTPs2-4 volume parts
Sterilizing ultrapure water 4.35-11.25 volume parts.
This first reaction solution cumulative volume number preferably but be not only only 18 volume parts.
Preferably, the embodiment of the present invention detects in the test kit of food origin disease pathogenic bacteria simultaneously, and above-mentioned second reaction solution is made up of archaeal dna polymerase, nitrite ion and sterilizing ultrapure water.Wherein, archaeal dna polymerase is Taq enzyme, and described nitrite ion is tetrabromophenol sulfonphthalein, and each volume components number of this second reaction solution is preferably:
Taq enzyme (concentration is 5-10U/ μ l) 0.15-0.3 volume parts
Tetrabromophenol sulfonphthalein 0.01-0.02 volume parts
Sterilizing ultrapure water 1.68-1.84 volume parts.
This second reaction solution cumulative volume number preferably but not only 2 volume parts.
Preferably, the embodiment of the present invention detects in the test kit of food origin disease pathogenic bacteria simultaneously, and aforementioned stable agent is preferably paraffin, and the first reaction solution and the second reaction solution are separated by this paraffin; Wherein, the first reaction solution is positioned at below paraffin, and the second reaction solution is above paraffin.
Preferably, the embodiment of the present invention detects in the test kit of food origin disease pathogenic bacteria simultaneously, also comprises DNA extraction liquid, negative controls and positive control solution.Wherein, DNA extraction liquid is preferably the Tris-EDTA damping fluid of the pH7.98-8.02 of 0.01M-0.02M, and Tris-EDTA damping fluid is containing 0.01%-0.02%NP-40 (volume percent); Negative controls is preferably containing the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 of the genomic dna of Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica; Positive control solution is preferably the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 of the genomic dna containing Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica.
Detect the test kit of food origin disease pathogenic bacteria for detecting Salmonellas in above-described embodiment simultaneously, Shigellae, colon bacillus, Vibrio parahemolyticus, can effectively utilize fluorescent quantitative PCR technique for Salmonellas when vibrio cholerae and Yersinia enterocolitica, Shigellae, colon bacillus, Vibrio parahemolyticus, the SsaR gene (Salmonellas) of vibrio cholerae and Yersinia enterocolitica, IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) carry out rapid detection, by detection time by tradition cultivate detection method within more than 36 hours, shorten to 2 hours, and only need short-time contact germ and add operator's security, and have easy and simple to handle and there will not be the advantages such as false positive.Thus effectively prevent tradition and cultivate that operational cycle in detection method is long, required reagent is various, to shortcomings such as operator's subjectivity dependences.
The primer of the present invention and probe are synthesized by upper sea base health bio tech ltd.
The present invention also provides a kind of using method simultaneously detecting the test kit of food origin disease pathogenic bacteria, and described using method comprises the following steps:
Detected sample is provided;
Carry out fluorescence quantitative PCR detection, the test kit that described fluorescence quantitative PCR detection uses above-described embodiment to detect food origin disease pathogenic bacteria simultaneously carries out.
Preferably, in the using method of the test kit of the food origin disease of detection simultaneously pathogenic bacteria of the present invention, described fluorescence quantitative PCR detection reaction conditions is:
50-55℃：2-5min；
94-95℃：2-3min；
94-95 DEG C: 5-10S, 55-60 DEG C: 40-80S, 35-45 circulation.
Below in conjunction with specific embodiment, above-mentioned pathogenic microbes detect method is described in detail.
embodiment 1
Detect the preparation of the test kit of food origin disease pathogenic bacteria simultaneously:
(1) synthetic primer probe in the following sequence
The primer of SsaR gene:
1F:5’—GAACCTGGCCTGAAGACATAAA—3’(SEQIDNO:1)，
1R:5’—AGGTCAATAGCCAGAAAGGGA—3’(SEQIDNO:2)，
The probe of SsaR gene:
1A:5-(FAM)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:3);
1H:5-(HEX)CCGGCTAACTGACTCACCGTAAATGCCGG(BHQ1)-3’(SEQIDNO:4);
The primer of IpaH gene:
2F:5’—TGAAGGAAATGCGTTTCTATG—3’(SEQIDNO:5)，
2R:5’—AGGGAGAACCAGTCCGTAAA—3’(SEQIDNO:6)，
The probe of IpaH gene:
2A:5’-(FAM)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ1)-3’(SEQIDNO:7);
2X:5’-(ROX)CACGGCCGAAGCTATGGTCAGAAGCCGTG(BHQ2)-3’(SEQIDNO:8);
The primer of ydiJ gene:
3F:5’—ATTTGGCGAAAATGGCAGTAAC—3’(SEQIDNO:9)，
3R:5’—CAGCTATTACGATGCGCAAGTG—3’(SEQIDNO:10)，
The probe of ydiJ gene:
3A:5’-(FAM)GGAAACCTAATTTTTCGACCAGACGGA(BHQ1)-3’(SEQIDNO:11);
3Y5:5’-(CY5)GGAAACCTAATTTTTCGACCAGACGGA(BHQ2)-3’(SEQIDNO:12);
The primer of ToxR gene:
4F:5’—GAAGTTGTACGATTAGGAAGC—3’(SEQIDNO:13)，
4R:5’—TGCTCACGCCAAACAAAC—3’(SEQIDNO:14)，
The probe of ToxR gene:
4H:5’-(HEX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ1)-3’(SEQIDNO:15);
4X:5’-(ROX)CCGCCCGTATACTCCTGATGTTGGCGG(BHQ2)-3’(SEQIDNO:16);
The primer of hlyA gene:
5F:5’—GCTTTATTGTTCGATGCGTTAAAC—3’(SEQIDNO:17)，
5R:5’—GATGCCAAAATTGTGCGTATCA—3’(SEQIDNO:18)，
The probe of hlyA gene:
5H:5’-(HEX)TCTTGGGCAATCGCATCGGTTGA(BHQ1)-3’(SEQIDNO:19);
5Y5:5’-(CY5)TCTTGGGCAATCGCATCGGTTGA(BHQ2)-3’(SEQIDNO:20);
The primer of gytB gene:
6F:5’—AAGAAGGCCTTCGGGTTGTAA—3’(SEQIDNO:21)，
6R:5’—TTCTGCGAGTAACGTCAATCACA—3’(SEQIDNO:22)，
The probe of gytB gene:
6X:5’-(ROX)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:23);
6Y5:5’-(CY5)ATTAACCTTTATGCCTTCCTCCTCGCTG(BHQ2)-3’(SEQIDNO:24);
(2) the first reaction solution is prepared
Add in container containing 2.5 volume parts not containing 10 × buffer of magnesium ion, the MgCl of 3.5 volume parts 25mM
2, the dNTPs of 2.5 volume parts, and then add primer 1F (50 μMs) 0.15 volume parts, primer 1R (50 μMs) 0.15 volume parts, probe 1A (50 μMs) 0.1 volume parts, 1H (50 μMs) 0.1 volume parts, primer 2 F (50 μMs) 0.15 volume parts, primer 2 R (50 μMs) 0.15 volume parts, probe 2A (50 μMs) 0.1 volume parts, 2X (50 μMs) 0.1 volume parts, primer 3F (50 μMs) 0.15 volume parts, primer 3R (50 μMs) 0.15 volume parts, probe 3A (50 μMs) 0.1 volume parts, 3X (50 μMs) 0.1 volume parts, primer 4F (50 μMs) 0.15 volume parts, primer 4R (50 μMs) 0.15 volume parts, probe 4H (50 μMs) 0.1 volume parts, 4X (50 μMs) 0.1 volume parts, primer 5F (50 μMs) 0.15 volume parts, primer 5R (50 μMs) 0.15 volume parts, probe 5H (50 μMs) 0.1 volume parts, 5Y5 (50 μMs) 0.1 volume parts, primer 6F (50 μMs) 0.15 volume parts, primer 6R (50 μMs) 0.15 volume parts, probe 6X (50 μMs) 0.1 volume parts, 6Y5 (50 μMs) 0.1 volume parts, then add sterilizing ultrapure water and make the first reaction solution cumulative volume number be 18, mix, be placed in container,
(3) stablizer is prepared
Get paraffin, be placed in container;
(4) the second reaction solution is prepared
Get the Taq enzyme (5U/ μ l) of 0.2 volume parts, the tetrabromophenol sulfonphthalein of 0.02 volume parts add sterilizing ultrapure water and make the second reaction solution cumulative volume number be 2, mix, be placed in container;
(5) DNA extraction liquid is prepared
0.01MTris-EDTA damping fluid, pH8.0, containing 0.01%NP-40, is placed in container;
(6) negative controls is prepared
0.01MTris-EDTA damping fluid, pH8.0;
(7) positive control solution is prepared
Extract the nucleic acid DNA of Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica, be dissolved in 0.01MTris-EDTA damping fluid (positive control dna concentration: 5ng/ μ l), pH8.0, is placed in freezen protective in container.
This detection kit is preparation technology be summarized as follows:
1. divided the first reaction solution prepared by above-mentioned steps (2) in 0.2ml eight union be filled to for quantitative fluorescent PCR, often pipe adds 18 μ l;
2. the heating paraffin above-mentioned steps (3) prepared is melted, and be added on the first reaction solution in eight unions that step 1 obtains, often pipe adds 20 μ l;
3., after the paraffin cooled and solidified of step 2, in this eight union, add the second reaction solution that step (4) is prepared, often pipe adds 2 μ l, is prepared into eight unions containing PCR reaction solution;
4. DNA extraction liquid step (5) prepared is aseptic subpackaged to the common centrifuge tube of 5ml, and 5ml/ manages, and this centrifuge tube is furnished with blue cap;
5. negative controls above-mentioned steps (6) prepared is aseptic subpackaged, and to the common centrifuge tube with cover of 0.6ml, 40 μ l/ manage, and this centrifuge tube is that purple is transparent;
6. positive control solution above-mentioned steps (7) prepared is aseptic subpackaged after melting, and to the common centrifuge tube with cover of 0.6ml, 40 μ l/ manage, and this centrifuge tube is transparent salmon;
7. assemble test kit, wherein each test kit specification is: containing 0.2ml eight union × 6 of PCR reaction solution; Blue lid centrifuge tube × 1 of 5ml containing DNA extraction liquid; Containing the transparent centrifuge tube of 0.6ml purple of negative controls; Containing the 0.6ml transparent salmon centrifuge tube of positive control solution.
embodiment 2
Detect the preparation of the test kit of food origin disease pathogenic bacteria simultaneously:
(1) synthetic primer probe, with embodiment 1;
(2) the first reaction solution is prepared
Add in container containing 2 volume parts not containing 10 × buffer of magnesium ion, the MgCl of 2 volume parts 25mM
2, the dNTPs of 2 volume parts, and then add primer 1F (50 μMs) 0.1 volume parts, primer 1R (50 μMs) 0.1 volume parts, probe 1A (50 μMs) 0.05 volume parts, 1H (50 μMs) 0.05 volume parts, primer 2 F (50 μMs) 0.1 volume parts, primer 2 R (50 μMs) 0.1 volume parts, probe 2A (50 μMs) 0.05 volume parts, 2X (50 μMs) 0.05 volume parts, primer 3F (50 μMs) 0.1 volume parts, primer 3R (50 μMs) 0.1 volume parts, probe 3A (50 μMs) 0.05 volume parts, 3X (50 μMs) 0.05 volume parts, primer 4F (50 μMs) 0.1 volume parts, primer 4R (50 μMs) 0.1 volume parts, probe 4H (50 μMs) 0.05 volume parts, 4X (50 μMs) 0.05 volume parts, primer 5F (50 μMs) 0.1 volume parts, primer 5R (50 μMs) 0.1 volume parts, probe 5H (50 μMs) 0.05 volume parts, 5Y5 (50 μMs) 0.05 volume parts, primer 6F (50 μMs) 0.1 volume parts, primer 6R (50 μMs) 0.1 volume parts, probe 6X (50 μMs) 0.05 volume parts, 6Y5 (50 μMs) 0.05 volume parts, then add sterilizing ultrapure water 11.25 parts by volume, mix, be placed in container,
(3) stablizer is prepared
Get paraffin, be placed in container;
(4) the second reaction solution is prepared
Get the Taq enzyme (5U/ μ l) of 0.15 volume parts, the tetrabromophenol sulfonphthalein of 0.01 volume parts add sterilizing ultrapure water 1.84 volume parts and make the second reaction solution cumulative volume number be 2, mix, be placed in container;
(5) DNA extraction liquid is prepared
0.01MTris-EDTA damping fluid, pH8.02, containing 0.01%NP-40, is placed in container;
(6) negative controls is prepared
0.01MTris-EDTA damping fluid, pH8.02;
(7) positive control solution is prepared
Extract the nucleic acid DNA of Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica, be dissolved in 0.01MTris-EDTA damping fluid (positive control dna concentration: 5ng/ μ l), pH8.02, is placed in freezen protective in container.
embodiment 3
Detect the preparation of the test kit of food origin disease pathogenic bacteria simultaneously:
(1) synthetic primer probe, with embodiment 1;
(2) the first reaction solution is prepared
Add in container containing 4 volume parts not containing 10 × buffer of magnesium ion, the MgCl of 4 volume parts 25mM
2, the dNTPs of 4 volume parts, and then add primer 1F (50 μMs) 0.2 volume parts, primer 1R (50 μMs) 0.2 volume parts, probe 1A (50 μMs) 0.15 volume parts, 1H (50 μMs) 0.15 volume parts, primer 2 F (50 μMs) 0.2 volume parts, primer 2 R (50 μMs) 0.2 volume parts, probe 2A (50 μMs) 0.15 volume parts, 2X (50 μMs) 0.15 volume parts, primer 3F (50 μMs) 0.2 volume parts, primer 3R (50 μMs) 0.2 volume parts, probe 3A (50 μMs) 0.15 volume parts, 3X (50 μMs) 0.15 volume parts, primer 4F (50 μMs) 0.2 volume parts, primer 4R (50 μMs) 0.2 volume parts, probe 4H (50 μMs) 0.15 volume parts, 4X (50 μMs) 0.15 volume parts, primer 5F (50 μMs) 0.2 volume parts, primer 5R (50 μMs) 0.2 volume parts, probe 5H (50 μMs) 0.15 volume parts, 5Y5 (50 μMs) 0.15 volume parts, primer 6F (50 μMs) 0.2 volume parts, primer 6R (50 μMs) 0.2 volume parts, probe 6X (50 μMs) 0.15 volume parts, 6Y5 (50 μMs) 0.15 volume parts, then add sterilizing ultrapure water 4.35 parts by volume, mix, be placed in container,
(3) stablizer is prepared
Get paraffin, be placed in container;
(4) the second reaction solution is prepared
Get the Taq enzyme (5U/ μ l) of 0.3 volume parts, the tetrabromophenol sulfonphthalein of 0.02 volume parts add sterilizing ultrapure water 1.68 volume parts and make the second reaction solution cumulative volume number be 2, mix, be placed in container;
(5) DNA extraction liquid is prepared
0.02MTris-EDTA damping fluid, pH7.98, containing 0.02%NP-40, is placed in container;
(6) negative controls is prepared
0.02MTris-EDTA damping fluid, pH7.98;
(7) positive control solution is prepared
Extract the nucleic acid DNA of Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica, be dissolved in 0.02MTris-EDTA damping fluid (positive control dna concentration: 5ng/ μ l), pH7.98, is placed in freezen protective in container.
embodiment 4
Detect the application of the test kit of food origin disease pathogenic bacteria simultaneously:
Using culture method as the reference detecting Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica, the testing process simultaneously detecting the test kit of food origin disease pathogenic bacteria of the present invention as shown in Figure 2.
Culture method step is as follows:
Testing sample is placed in LB substratum, cultivates 18 hours in 37 DEG C, then 10 times of gradient dilutions are carried out, from 10 wherein to enrichment liquid
-4, 10
-5, 10
-6respectively get 0.1mL enrichment liquid in diluent to drip respectively on Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica colour developing agar plate, carry out being coated with sterilizing L spreading rod and be placed in 37 DEG C ± 1 DEG C and cultivate 18 hours-24 hours.Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica colour developing agar plate after cultivating choose suspicious Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica bacterium colony.Select this suspicious bacterium colony from this agar plate, carry out biochemical identification and serum agglutination test, judge according to acquired results.
Utilize the detection kit detecting step of embodiment 1 as follows:
(1) Zengjing Granule: testing sample is placed in LB substratum, cultivates 3 hours in 37 DEG C, gets 1ml enrichment liquid, add DNA extraction liquid 50 μ l, mix;
(2) application of sample: the mixed solution getting step (1) gained, to be added in embodiment one preparation containing in eight unions of PCR reaction solution, often pipe 5 μ l;
(3) negative control group: the negative controls of preparation in Example one, to be added in embodiment one preparation containing in eight unions of PCR reaction solution, often pipe 5 μ l;
(4) positive controls: the positive control solution of preparation in Example one, to be added in embodiment one preparation containing in eight unions of PCR reaction solution, often pipe 5 μ l;
(5) eight unions of step (2)-(5) gained are put into quantitative real time PCR Instrument (model: StratageneMx3005P) to react, quantitative fluorescent PCR reaction conditions is:
50℃：2min；
95℃：3min；
95 DEG C: 5S, 55 DEG C: 60S, 45 circulations;
(6) according to AFLP system result of determination, with reference to positive control result (Fig. 3), negative control result (Fig. 4), wherein:
Positive findings: amplification curve diagram Ct value≤35, and have obvious exponential growth.
Negative findings: amplification curve diagram Ct value > 35 or without Ct value.
Result:
Use detection kit of the present invention to carry out detecting the fluorescent quantitative PCR result obtained and see Fig. 5 to 10.
The comparison of the result of culture method detected result and detection kit of the present invention is see table 1.
Table 1
Culture-based method detects Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica needs more than 36h, and adopt detection kit of the present invention to carry out detecting and only need about 5h, and the detected result of detection kit of the present invention is consistent with culture-based method detected result.Therefore, as can be seen from the above results, the test kit of the food origin disease of detection simultaneously pathogenic bacteria of the present invention is compared with traditional culture method, in detection Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica, there is the advantages such as quick, sensitive, safe, can be applicable to the detection of Salmonellas, Shigellae, colon bacillus, Vibrio parahemolyticus, vibrio cholerae and Yersinia enterocolitica.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
SEQUENCELISTING
<110> Huzhou Teachers College
<120> mono-kind detects the test kit of food origin disease pathogenic bacteria simultaneously
<130>KW20150505001
<160>24
<170>PatentInversion3.3
<210>1
<211>22
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>1
gaacctggcctgaagacataaa22
<210>2
<211>21
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>2
aggtcaatagccagaaaggga21
<210>3
<211>29
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>3
ccggctaactgactcaccgtaaatgccgg29
<210>4
<211>29
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>4
ccggctaactgactcaccgtaaatgccgg29
<210>5
<211>21
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>5
tgaaggaaatgcgtttctatg21
<210>6
<211>20
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>6
agggagaaccagtccgtaaa20
<210>7
<211>29
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>7
cacggccgaagctatggtcagaagccgtg29
<210>8
<211>29
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>8
cacggccgaagctatggtcagaagccgtg29
<210>9
<211>22
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>9
atttggcgaaaatggcagtaac22
<210>10
<211>22
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>10
cagctattacgatgcgcaagtg22
<210>11
<211>27
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>11
ggaaacctaatttttcgaccagacgga27
<210>12
<211>27
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>12
ggaaacctaatttttcgaccagacgga27
<210>13
<211>21
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>13
gaagttgtacgattaggaagc21
<210>14
<211>18
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>14
tgctcacgccaaacaaac18
<210>15
<211>27
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>15
ccgcccgtatactcctgatgttggcgg27
<210>16
<211>27
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>16
ccgcccgtatactcctgatgttggcgg27
<210>17
<211>24
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>17
gctttattgttcgatgcgttaaac24
<210>18
<211>22
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>18
gatgccaaaattgtgcgtatca22
<210>19
<211>23
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>19
tcttgggcaatcgcatcggttga23
<210>20
<211>23
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>20
tcttgggcaatcgcatcggttga23
<210>21
<211>21
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>21
aagaaggccttcgggttgtaa21
<210>22
<211>23
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>22
ttctgcgagtaacgtcaatcaca23
<210>23
<211>28
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>23
attaacctttatgccttcctcctcgctg28
<210>24
<211>28
<212>DNA
<213>Artificial
<220>
<223> artificial sequence
<400>24
attaacctttatgccttcctcctcgctg28
Claims (10)
1. one kind is detected the test kit of food origin disease pathogenic bacteria simultaneously, described food origin disease pathogenic bacteria comprises Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus, it is characterized in that: described test kit comprises PCR reaction solution, described PCR reaction solution comprises the first reaction solution, the second reaction solution and stablizer independently; Wherein, described first reaction solution comprises respectively with the primed probe of SsaR gene (Salmonellas), IpaH gene (Shigellae), ydiJ gene (colon bacillus), ToxR gene (Vibrio parahemolyticus), hlyA gene (vibrio cholerae) and gytB gene (Yersinia enterocolitica) SsaR, IpaH, ydiJ, ToxR, hlyA and gytB gene for target gene and for quantitative fluorescent PCR.
2. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 1, is characterized in that:
The primed probe of described SsaR gene is:
The primer of SsaR gene:
1F:5 '-GAACCTGGCCTGAAGACATAAA-3 ', its nucleotide sequence as shown in SEQIDNO:1,
1R:5 '-AGGTCAATAGCCAGAAAGGGA-3 ', its nucleotide sequence as shown in SEQIDNO:2,
The probe of SsaR gene:
1A:5-(FAM) CCGGCTAACTGACTCACCGTAAATGCCGG (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:3;
1H:5-(HEX) CCGGCTAACTGACTCACCGTAAATGCCGG (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:4;
The primed probe of described IpaH gene (Shigellae) is:
The primer of IpaH gene:
2F:5 '-TGAAGGAAATGCGTTTCTATG-3 ', its nucleotide sequence as shown in SEQIDNO:5,
2R:5 '-AGGGAGAACCAGTCCGTAAA-3 ', its nucleotide sequence as shown in SEQIDNO:6,
The probe of IpaH gene:
2A:5 '-(FAM) CACGGCCGAAGCTATGGTCAGAAGCCGTG (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:7;
2X:5 '-(ROX) CACGGCCGAAGCTATGGTCAGAAGCCGTG (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:8;
The primed probe of described ydiJ gene (colon bacillus) is:
The primer of ydiJ gene:
3F:5 '-ATTTGGCGAAAATGGCAGTAAC-3 ', its nucleotide sequence as shown in SEQIDNO:9,
3R:5 '-CAGCTATTACGATGCGCAAGTG-3 ', its nucleotide sequence as shown in SEQIDNO:10,
The probe of ydiJ gene:
3A:5 '-(FAM) GGAAACCTAATTTTTCGACCAGACGGA (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:11;
3Y5:5 '-(CY5) GGAAACCTAATTTTTCGACCAGACGGA (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:12;
The primed probe of described ToxR gene (Vibrio parahemolyticus) is:
The primer of ToxR gene:
4F:5 '-GAAGTTGTACGATTAGGAAGC-3 ', its nucleotide sequence as shown in SEQIDNO:13,
4R:5 '-TGCTCACGCCAAACAAAC-3 ', its nucleotide sequence as shown in SEQIDNO:14,
The probe of ToxR gene:
4H:5 '-(HEX) CCGCCCGTATACTCCTGATGTTGGCGG (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:15;
4X:5 '-(ROX) CCGCCCGTATACTCCTGATGTTGGCGG (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:16;
The primed probe of described hlyA gene (vibrio cholerae) is:
The primer of hlyA gene:
5F:5 '-GCTTTATTGTTCGATGCGTTAAAC-3 ', its nucleotide sequence as shown in SEQIDNO:17,
5R:5 '-GATGCCAAAATTGTGCGTATCA-3 ', its nucleotide sequence as shown in SEQIDNO:18,
The probe of hlyA gene:
5H:5 '-(HEX) TCTTGGGCAATCGCATCGGTTGA (BHQ1)-3 ', its nucleotide sequence is as shown in SEQIDNO:19;
5Y5:5 '-(CY5) TCTTGGGCAATCGCATCGGTTGA (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:20;
The primed probe of described gytB gene (Yersinia enterocolitica) is:
The primer of gytB gene:
6F:5 '-AAGAAGGCCTTCGGGTTGTAA-3 ', its nucleotide sequence as shown in SEQIDNO:21,
6R:5 '-TTCTGCGAGTAACGTCAATCACA-3 ', its nucleotide sequence as shown in SEQIDNO:22,
The probe of gytB gene:
6X:5 '-(ROX) ATTAACCTTTATGCCTTCCTCCTCGCTG (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:23;
6Y5:5 '-(CY5) ATTAACCTTTATGCCTTCCTCCTCGCTG (BHQ2)-3 ', its nucleotide sequence is as shown in SEQIDNO:24.
3. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 2, is characterized in that:
Described first reaction solution also comprises not containing 10 × buffer, the MgCl of magnesium ion
2, dNTPs and sterilizing ultrapure water, each volume components number of described first reaction solution is:
The primer of SsaR gene:
1F0.1-0.2 part of 25-50 μM;
1R0.1-0.2 part of 25-50 μM;
The probe of SsaR gene:
1A0.05-0.15 part of 25-50 μM;
1H0.05-0.15 part of 25-50 μM;
The primer of IpaH gene:
2F0.1-0.2 part of 25-50 μM
2R0.1-0.2 part of 25-50 μM;
The probe of IpaH gene:
2A0.05-0.15 part of 25-50 μM;
2X0.05-0.15 part of 25-50 μM;
The primer of ydiJ gene:
3F0.1-0.2 part of 25-50 μM
3R0.1-0.2 part of 25-50 μM;
The probe of ydiJ gene:
3A0.05-0.15 part of 25-50 μM;
3Y50.05-0.15 part of 25-50 μM;
The primer of ToxR gene:
4F0.1-0.2 part of 25-50 μM
4R0.1-0.2 part of 25-50 μM;
The probe of ToxR gene:
4H0.05-0.15 part of 25-50 μM;
4X0.05-0.15 part of 25-50 μM;
The primer of hlyA gene:
5F0.1-0.2 part of 25-50 μM
5R0.1-0.2 part of 25-50 μM;
The probe of hlyA gene:
5H0.05-0.15 part of 25-50 μM;
5Y50.05-0.15 part of 25-50 μM;
The primer of gytB gene:
6F0.1-0.2 part of 25-50 μM;
6R0.1-0.2 part of 25-50 μM;
The probe of gytB gene:
6X0.05-0.15 part of 25-50 μM;
6Y50.05-0.15 part of 25-50 μM;
Not containing 10 × buffer2-4 part of magnesium ion;
The MgCl of 25mM
22-4 part;
DNTPs2-4 part;
Sterilizing ultrapure water 4.35-11.25 part.
4. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 1, is characterized in that: described second reaction solution comprises archaeal dna polymerase, nitrite ion and sterilizing ultrapure water.
5. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 4, it is characterized in that: described archaeal dna polymerase is Taq enzyme, its concentration is 5-10U/ μ l; Described nitrite ion is tetrabromophenol sulfonphthalein; The each volume components number of described second reaction solution is:
Described Taq enzyme 0.15-0.3 volume parts;
Tetrabromophenol sulfonphthalein 0.01-0.02 volume parts;
Sterilizing ultrapure water 1.68-1.84 volume parts.
6. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 1, is characterized in that: described stablizer is paraffin; First reaction solution and the second reaction solution are separated by stablizer, and the first reaction solution is positioned at below stablizer, and the second reaction solution is above stablizer.
7. a kind of test kit simultaneously detecting food origin disease pathogenic bacteria according to claim 1, is characterized in that: described test kit also comprises DNA extraction liquid, negative controls and positive control solution;
Described DNA extraction liquid is the Tris-EDTA damping fluid of the pH7.98-8.02 of 0.01-0.02M, and described Tris-EDTA damping fluid is the NP-40 of 0.01%-0.02% containing volume percent;
Described negative controls is not containing the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 of Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus genomic dna;
Described positive control solution is the Tris-EDTA damping fluid of the 0.01-0.02MpH7.98-8.02 containing Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus genomic dna.
8. one kind is detected the method for food origin disease pathogenic bacteria simultaneously, described food origin disease pathogenic bacteria comprises Salmonellas, Shigellae, colon bacillus, vibrio cholerae, Yersinia enterocolitica, Vibrio parahemolyticus, it is characterized in that: utilize the test kit described in any one of claim 1 to 7 to carry out fluorescence quantitative PCR detection.
9. a kind of method simultaneously detecting food origin disease pathogenic bacteria according to claim 8, is characterized in that: described fluorescence quantitative PCR detection reaction conditions is:
50-55℃：2-5min；
94-95℃：2-3min；
94-95 DEG C: 5-10S, 55-60 DEG C: 40-80S, 35-45 circulation.
10. a kind of method simultaneously detecting food origin disease pathogenic bacteria according to claim 8, it is characterized in that: Salmonellas FAM and HEX two kinds of fluorescent probe marks, Shigellae FAM and ROX two kinds of fluorescent probe marks, colon bacillus FAM and CY5 two kinds of fluorescent probe marks, vibrio cholerae HEX and CY5 two kinds of fluorescent probe marks, Yersinia enterocolitica ROX and CY5 two kinds of fluorescent probe marks, Vibrio parahemolyticus HEX and ROX two kinds of fluorescent probe marks; Described fluorescence quantitative PCR detection result decision method is:
。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510230334.2A CN105039509A (en) | 2015-05-07 | 2015-05-07 | Kit for simultaneously detecting food-borne disease pathogenic bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510230334.2A CN105039509A (en) | 2015-05-07 | 2015-05-07 | Kit for simultaneously detecting food-borne disease pathogenic bacteria |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039509A true CN105039509A (en) | 2015-11-11 |
Family
ID=54446476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510230334.2A Pending CN105039509A (en) | 2015-05-07 | 2015-05-07 | Kit for simultaneously detecting food-borne disease pathogenic bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039509A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831603A (en) * | 2021-01-27 | 2021-05-25 | 河南省疾病预防控制中心 | Kit and method for detecting food-borne pathogenic bacteria based on multiple PCR (polymerase chain reaction) technology |
| CN115261494A (en) * | 2021-04-30 | 2022-11-01 | 上海旺旺食品集团有限公司 | System and method for detecting yersinia enterocolitica and application of system and method |
| CN117051138A (en) * | 2023-08-31 | 2023-11-14 | 上海雄图生物科技有限公司 | Kit for detecting 23 food pathogenic bacteria by single tube |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017873A (en) * | 2014-05-30 | 2014-09-03 | 浙江万里学院 | A multiple PCR primer used for simultaneously detecting five pathogenic bacteria and three virulence genes in marine, and a designing method thereof |
-
2015
- 2015-05-07 CN CN201510230334.2A patent/CN105039509A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017873A (en) * | 2014-05-30 | 2014-09-03 | 浙江万里学院 | A multiple PCR primer used for simultaneously detecting five pathogenic bacteria and three virulence genes in marine, and a designing method thereof |
Non-Patent Citations (3)
| Title |
|---|
| QINGHUA HU ET AL: "A Modified Molecular Beacons–Based Multiplex Real-Time PCR Assay for Simultaneous Detection of Eight Foodborne Pathogens in a Single Reaction and Its Application", 《FOODBORNE PATHOGENS AND DISEASE》 * |
| 中华人民共和国国家质量监督检验检疫总局: "食品中致病菌检测方法实时PCR法", 《中华人民共和国出入境检验检疫行业标准》 * |
| 胡朝友: "Taqman探针荧光PCR法定量检测水中大肠埃希氏菌方法建立和应用", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831603A (en) * | 2021-01-27 | 2021-05-25 | 河南省疾病预防控制中心 | Kit and method for detecting food-borne pathogenic bacteria based on multiple PCR (polymerase chain reaction) technology |
| CN115261494A (en) * | 2021-04-30 | 2022-11-01 | 上海旺旺食品集团有限公司 | System and method for detecting yersinia enterocolitica and application of system and method |
| CN117051138A (en) * | 2023-08-31 | 2023-11-14 | 上海雄图生物科技有限公司 | Kit for detecting 23 food pathogenic bacteria by single tube |
| CN117051138B (en) * | 2023-08-31 | 2024-06-04 | 上海雄图生物科技有限公司 | Kit for detecting 23 food pathogenic bacteria by single tube |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
| Wang et al. | Multiplex, rapid, and sensitive isothermal detection of nucleic-acid sequence by endonuclease restriction-mediated real-time multiple cross displacement amplification | |
| CN106967816A (en) | Detect the RPA specific primers of vibrio parahaemolytious and kit and application in food | |
| CN116837125A (en) | Kit for rapidly detecting vibrio parahaemolyticus based on LAMP-CRISPR/Cas12b integrated system and method thereof | |
| CN105039509A (en) | Kit for simultaneously detecting food-borne disease pathogenic bacteria | |
| CN104726594B (en) | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five | |
| Ou et al. | Direct detection of viable but non-culturable (VBNC) Salmonella in real food system by a rapid and accurate PMA-CPA technique | |
| Zeng et al. | A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| Zhou et al. | Rapid visual detection of Aeromonas salmonicida by loop‐mediated isothermal amplification with hydroxynaphthol blue dye | |
| CN103476945A (en) | Improved methods for determining cell viability using molecular nucleic acid-based techniques | |
| JP4903722B2 (en) | Method for detecting live cells in a sample by using a virus | |
| CN101974644A (en) | Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method | |
| CN104673885A (en) | Detection kit and detection method for I-form legionella pneumophila | |
| CN108277289A (en) | Escherichia coli O157:The dry powdered LAMP quick detection kits of H7 | |
| CN111440887A (en) | Pseudomonas proteorum TaqMan real-time fluorescence quantitative PCR detection kit and preparation method thereof | |
| CN101875967B (en) | Method for quickly testing food-borne pathogenic bacteria | |
| CN102605069B (en) | Enterohemorrhagic Escherichia coli O104: H4 detection kit and use method thereof | |
| CN102936625B (en) | Molecular motor biosensor kit used in vibrio parahaemolyticus molecular typing | |
| CN101235413A (en) | Method and kit for detecting Shigella and ipaH pathogenicity island thereof | |
| CN106755553B (en) | Complete set of reagents for GeXP multiplex PCR method for identifying or assisting in identifying food-borne pathogenic bacteria and application | |
| CN107012216B (en) | LAMP primer group, kit and rapid detection method for detecting enterobacter cloacae | |
| Oldham et al. | Methods for detection and identification of beer-spoilage microbes | |
| CN101717829A (en) | Multiple amplification interior label sequence of food source pathogenic bacterium and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |
|
| RJ01 | Rejection of invention patent application after publication |