CN105039507A - Kit for quickly detecting marine vibrio vulnificus - Google Patents
Kit for quickly detecting marine vibrio vulnificus Download PDFInfo
- Publication number
- CN105039507A CN105039507A CN201510200441.0A CN201510200441A CN105039507A CN 105039507 A CN105039507 A CN 105039507A CN 201510200441 A CN201510200441 A CN 201510200441A CN 105039507 A CN105039507 A CN 105039507A
- Authority
- CN
- China
- Prior art keywords
- primer
- vibrio vulnificus
- seqidno
- base sequence
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention provides a kit for quickly detecting marine vibrio vulnificus. In the invention, a primer is optimized, wherein by means of the optimized primer and a detection reagent, the kit can be used for accurately, sensitively and quickly detecting the marine vibrio vulnificus.
Description
Technical field
The present invention relates to one utilizes ring mediated amplification (LAMP) technology Vibrio vulnificus to be carried out to the test kit of rapid detection, belongs to clinical medicine inspection technology field.
Background technology
Vibrio vulnificus (Vibriovulnificus) is a kind of encapsulated Grain-negative halophilic vibrio, is that one is distributed widely in the subtropics shallow water along the coast and sea-food as shellfish, shrimp, crab etc., is equaled first to report for 1979 by Farmer.The infection of Vibrio vulnificus causes illness clinically to have two kinds, and namely primary septicemia and serious window infect, and also can cause the diseases such as gangrenosum acne gastro-enteritis, meningitis, pneumonia, eye keratitis.The many shellfish by nest RT-PCRs such as oyster with eating raw containing bacterium of septicemia are relevant, and be especially apt to occur in the crowd that in the bodies such as liver cirrhosis, hemochromatosis, thalassemia, lotus iron is too much, case fatality rate is more than 50%.Skin wounds infects by the Vibrio vulnificus in seawater, often causes serious tissue necrosis.The definite mechanism of causing a disease of Vibrio vulnificus is not yet completely clear so far.Think that this bacterium can produce numerous pathogenic related substanceses at present, cytolysin, metalloprotease (elastin lytic enzyme), capsular polysaccharide (CPS), Phospholipid hydrolase, intracellular toxin and catechol parent iron substance as outer in born of the same parents etc.Vibrio vulnificus is that U.S.'s sea-food consumption causes dead first cause, interstate shellfish board of health (ISSC) specifies, after results, in the oyster of process, Vibrio vulnificus limitation is no more than 30CFU/g and estimates that the annual Vibrio vulnificus septicemia case load of Japan is about 425 examples.China Taiwan 1996-2000 annual Vibrio vulnificus number of the infected 13 ~ 26 example, coastland, continent also time have Vibrio vulnificus to distribute the report of infection.
The highly pathogenic of Vibrio vulnificus has caused worldwide concern, has been classified as one of pathogenic bacterium of culture fishery and the inspection and quarantine of import and export aquatic products emphasis at present.The detection method of this bacterium was once accredited as master with separation and Culture and physics and chemistry, whole process time and effort consuming, at the bottom of sensitivity, can not meet the needs of rapid detection.In specificity, because the phenotype of Vibrio vulnificus is unstable, atypical strains is comparatively common, adopts common physics and chemistry to identify the detected result poor reliability obtained; Although enzyme linked immunosorbent assay has certain specificity and susceptibility, but still needing just can carry out in conjunction with bacteria distribution, is not still a kind of method for quick.It is a kind of new detection technique that RT-PCR method detects Vibrio vulnificus, the features such as it is easy, quick, accurate, and sensitive specificity is good, but needs expensive PCR instrument, and different service temperatures.Ring mediated isothermal amplification (LAMP) be continue that round pcr grows up based on a kind of new amplification technique detecting hereditary material DNA.This technology depends on the primer and a kind of archaeal dna polymerase with strand displacement characteristic that can identify 6 specific regions on target sequence, under isothermal conditions can efficiently, fast, high amplified target sequence specifically; Be characterized in, without the need to special, expensive detecting instrument, only needing simple thermostatic equipment or heat block, can pcr amplification being completed, the needs of Site Detection can be met.Loop-mediated isothermal amplification method used more in recent years in pathogen detection.
Summary of the invention
In order to solve the problems of the technologies described above, the invention provides one and detecting ocean Vibrio vulnificus test kit fast.The invention provides the LAMP primer for detecting Vibrio vulnificus that a group-specific is strong, highly sensitive, Vibrio vulnificus can be detected fast and accurately.
Technical scheme of the present invention is as follows:
A kind of rapid detection ocean Vibrio vulnificus test kit, comprises following component:
(1) 10* reaction buffer 2.5 μ L
（2）dNTPMixture10mMeach3.5μL
(3) trimethyl-glycine 5mol/L4 μ L
（4）MgSO
4150mmol/L1μL
(5) Bst enzyme 8000U/mL1 μ L
(6) fluorexon 4mmol/L1 μ L
(7) deionized water 4 μ L
(8) primer
FIP primer 20 μm of ol/L2 μ L
BIP primer 20 μm of ol/L2 μ L
F3 primer 8 μm of ol/L1 μ L
B3 primer 8 μm of ol/L1 μ L
(9) positive control dna 10 μm of ol/L;
Described 10* reaction buffer is composed as follows
Tris-HClPH8.8，200mM
KCl100mM
(NH4)
2SO
4100mM
MgSO
420mM
TritonX-1001%；
Described positive control dna, after going out Vibrio vulnificus vvhA gene by two external primer amplification, gets its fragment (217bp) and be recombined into plasmid gained.
Primer sequence of the present invention is as follows:
FIP primer:
5’CCTCTTGACCTCCTACTCTGCTCTTACATGACCCTGCCGATTTC’3（SEQIDNO:1）；
BIP primer:
5’TGACTCCCACGCATTTTGCACTGCAGTGTATCTGTTGCCGC’3（SEQIDNO:2）；
F3 primer:
5’TCTATTATTCTCCAAGCTC’3（SEQIDNO:3）；
B3 primer:
5’CCCTACGTATTCCCTTGTCCC’3（SEQIDNO:4）。
Concrete operation step is as follows:
1, get each reagent at room temperature to thaw, be placed in immediately after thawing and preserve on ice;
2, the preparation (please carrying out on ice) of premixed solution
(1) reaction is prepared in test tube according to following table ratio
Table 1LAMP method detects operating process
(2) attack test tube gently, puts into the simple and easy Eppendorf centrifuge centrifugal several seconds, in this, as premixed solution after making it fully mix;
(3) sample reaction adds 2uL sample DNA; Negative control reaction uses deionized water 2uL; Positive control reaction uses positive control dna 2uL, makes total amount reach 25ul;
(4) amplified reaction
1) reaction tube prepared, packing is complete is placed in constant-temperature metal bath, reacts 50 minutes under 63 DEG C of conditions;
2) constant temperature 2 minutes under constant temperature 5 minutes or 95 DEG C of conditions under 80 DEG C of conditions, makes enzyme-deactivating with termination reaction.
The invention provides the primer that a group is detected Vibrio vulnificus, this group primer designs according to the gene order that the NCBI number of including AB124803 (vvA) is corresponding, is made up of the oligonucleotide of base sequence shown in primer table sequence F3, B3, FIP, BIP; Wherein F3 is outside upstream primer, and B3 is outside downstream primer, and FIP is inner side upstream primer, and BIP is inner side downstream primer.
The present invention is highly sensitive, and numerous Research Literature shows LAMP primer to compare regular-PCR, and to have detection sensitivity high, the advantage that the reaction times is short.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.
Embodiment 1
Composition and the detection method of available data display routine clinical detection ocean Vibrio vulnificus detection (LAMP method) reagent are as follows:
(1) 10* reaction buffer
（2）dNTPMixture:10mMeach
(3) trimethyl-glycine: 5mol/L
（4）MgSO4:150mmol/L
(5) Bst enzyme: 8000U/mL
(6) dyestuff: fluorexon 4mmol/L
(7) deionized water
(8) FIP primer 20 μm of ol/L
Base sequence is: 5 ' AATACCCGTGCCAGGCTTTCCTGACGCCAAAATTGTCCGTT ' 3(SEQIDNO:5);
BIP primer 20 μm of ol/L
Base sequence is: 5 ' AGCTGGTTCCAGAGTTGGGCGGGTTTCACCCAAAGGTCGT ' 3(SEQIDNO:6);
F3 primer 5 μm of ol/L
Base sequence is: 5 ' CAACGTCAGATGGTTTTA ' 3(SEQIDNO:7);
B3 primer 5 μm of ol/L
Base sequence is: 5 ' GCTTTTTTCGGTGTGTAACC ' 3(SEQIDNO:8);
(9) positive control dna 10 μm of ol/L
※ 1: composition
Tris-HCl（PH8.8）200mM
KCl100mM
(NH4)
2SO
4100mM
MgSO
420mM
TritonX-1001%
※ 2: positive control dna, after going out Vibrio vulnificus vvhA gene by two external primer amplification, gets its fragment (217bp) and be recombined into plasmid gained.
Detect sample:
(1) yin and yang attribute sample: extract each 30 parts of the sample being defined as Vibrio vulnificus yin and yang attribute clinically by gold standard;
(2) detectability sample: a series of doubling dilution made by sample portion being defined as clinically the Vibrio vulnificus positive, and Dilution ratio is respectively 1:1(L1), 1:4(L2), 1:8(L3) and, 1:16(L4);
[operation steps]
1 get-20 DEG C at preserve all ingredients at room temperature thaw, be placed in immediately after thawing and preserve on ice.
The preparation (please carrying out on ice) of 2 premixed solutions
(1) reaction is carried out preparing (1 secondary response amount) according to following table ratio
Table 2LAMP method detects operating process
(2) attack test tube gently, puts into the simple and easy Eppendorf centrifuge centrifugal several seconds, in this, as premixed solution after making it fully mix.(3) sample reaction adds 2uL sample DNA; Negative control reaction uses deionized water 2uL; Positive control reaction uses positive control dna 2uL, makes total amount reach 25ul;
(4) amplified reaction
1) reaction tube prepared, packing is complete is placed in constant-temperature metal bath, reacts 50 minutes under 63 DEG C of conditions;
2) constant temperature 2 minutes under constant temperature 5 minutes or 95 DEG C of conditions under 80 DEG C of conditions, makes enzyme-deactivating with termination reaction.
Embodiment 2
Make trauma vibrio fast detection kit by following formula and comprise (1)-(9) as follows:
(1) 10* reaction buffer 2.5 μ L
（2）dNTPMixture10mMeach3.5μL
(3) trimethyl-glycine 5mol/L4 μ L
（4）MgSO
4150mmol/L1μL
(5) Bst enzyme 8000U/mL1 μ L
(6) fluorexon 4mmol/L1 μ L
(7) deionized water 4 μ L
(8) primer
FIP primer 20 μm of ol/L2 μ L
BIP primer 20 μm of ol/L2 μ L
F3 primer 8 μm of ol/L1 μ L
B3 primer 8 μm of ol/L1 μ L
(9) positive control dna 10 μm of ol/L;
Described 10* reaction buffer is composed as follows
Tris-HClPH8.8，200mM
KCl100mM
(NH4)
2SO
4100mM
MgSO
420mM
TritonX-1001%；
FIP primer base sequences:
5’CCTCTTGACCTCCTACTCTGCTCTTACATGACCCTGCCGATTTC’3（SEQIDNO:1）；
BIP primer base sequences:
5’TGACTCCCACGCATTTTGCACTGCAGTGTATCTGTTGCCGC’3（SEQIDNO:2）；
F3 primer base sequences:
5’TCTATTATTCTCCAAGCTC’3（SEQIDNO:3）；
B3 primer base sequences:
5’CCCTACGTATTCCCTTGTCCC’3（SEQIDNO:4）。
Detect sample, reagent volume and operation steps with embodiment 1
Embodiment 3
Make trauma vibrio fast detection kit by following formula and comprise (1)-(9) as follows:
LAMP reaction solution A:
(1) 10* reaction buffer
※ 1
（2）dNTPMixture:20mMeach
(3) trimethyl-glycine: 5mol/L
（4）MgSO4:150mmol/L
(5) Bst enzyme: 8000U/mL
(6) dyestuff: fluorexon 4mmol/L
(7) deionized water
(8) FIP primer 50umol/L
5’AATACCCGTGCCAGGCTTTCCTGACGCCAAAATTGTCCGTT’3
BIP primer 50umol/L
5’AGCTGGTTCCAGAGTTGGGCGGGTTTCACCCAAAGGTCGT’3
F3 primer 2 0umol/L
5’CAACGTCAGATGGTTTTA’3
B3 primer 2 0umol/L
5’GCTTTTTTCGGTGTGTAACC’3
(9) positive control dna
※ 210 μm of ol/L;
The composition of ※ 1, ※ 2 is with embodiment 1
Detect sample, reagent volume and operation steps with embodiment 1
The checking of yin and yang attribute coincidence rate
Extract each 30 parts of the sample being defined as Vibrio vulnificus yin and yang attribute clinically by gold standard, adopt embodiment 1,2,3 reagent to detect respectively, detecting step and result decision method are with embodiment 1.The detection data of embodiment 1,2,3 are as shown in Table 3-6:
Table 3 embodiment 1 yin and yang attribute detected result
Table 4 embodiment 2 yin and yang attribute detected result
Table 5 embodiment 3 yin and yang attribute detected result
Table 6 data analysis
Can draw through data analysis, in detection sensitivity, specific degree, positive predictive value, negative predictive value and diagnostic accordance rate aspect embodiment 2 are all better than embodiment 1, embodiment 3, the common detection methods specificity and the sensitivity that describe data display are poor, main relevant with the selection of primer, and the detected result high unity of reagent of the present invention (embodiment 2) specificity and sensitivity and gold standard, although increase the concentration of primer in embodiment 3, but do not improve experimental result, therefore verify through control experiment, embodiment 2(the present invention) reagent more can reach the effect accurately detecting Vibrio vulnificus.
The checking of minimum detectability
The acquisition of detectability sample: a series of doubling dilution made by sample portion being defined as clinically the Vibrio vulnificus positive, and Dilution ratio is respectively 1:1(L1), 1:4(L2), 1:8(L3) and, 1:16(L4).Detecting step and result decision method are with embodiment 1.Detected result is as shown in table 7:
Table 7 minimum detectability detected result
Shown in result, embodiment 1 detects positive sample and only has L1, and embodiment 3 detects L1, L2 for positive, and embodiment 2 detects L1, L2, L3 and is the positive, illustrates that the detectability of embodiment 2 is lower and is better than embodiment 1 and embodiment 3.
The present invention is by the primer of amendment Vibrio vulnificus detection kit, the clinical detection ordinary method that comparison data check arrives, through the detection validation of specificity, sensitivity and minimum detectability, result after amendment primer is more accurate, sensitive, adjust the improvement that the add-on of primer is not good to result, therefore reagent component of the present invention specificity that Vibrio vulnificus is detected and sensitivity better, more meaningful to the detection of this project.
<110> Hu Chengjin
<120> rapid detection ocean Vibrio vulnificus test kit
<160>2
<210>1
<211>44
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(44)
<223> primer
<400>1
CCTCTTGACCTCCTACTCTGCTCTTACATG30
ACCCTGCCGATTTC44
<210>2
<211>41
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(41)
<223> primer
<400>2
TGACTCCCACGCATTTTGCACTGCAGTGTA30
TCTGTTGCCGC41
<210>3
<211>19
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(19)
<223> primer
<400>3
TCTATTATTCTCCAAGCTC19
<210>4
<211>21
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(21)
<223> primer
<400>4
CCCTACGTATTCCCTTGTCCC21
<210>5
<211>40
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(41)
<223> primer
<400>5
AATACCCGTGCCAGGCTTTCCTGACGCCAA30
AATTGTCCGTT41
<210>6
<211>40
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(40)
<223> primer
<400>6
AGCTGGTTCCAGAGTTGGGCGGGTTTCACC30
CAAAGGTCGT40
<210>7
<211>18
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(18)
<223> primer
<400>7
CAACGTCAGATGGTTTTA18
<210>8
<211>20
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>(1)..(20)
<223> primer
<400>8
GCTTTTTTCGGTGTGTAACC20
Claims (1)
1. a rapid detection ocean Vibrio vulnificus test kit, comprises following component:
(1) 10* reaction buffer 2.5 μ L
（2）dNTPMixture10mMeach3.5μL
(3) trimethyl-glycine 5mol/L4 μ L
（4）MgSO
4150mmol/L1μL
(5) Bst enzyme 8000U/mL1 μ L
(6) fluorexon 4mmol/L1 μ L
(7) deionized water 4 μ L
(8) primer
FIP primer 20 μm of ol/L2 μ L
BIP primer 20 μm of ol/L2 μ L
F3 primer 8 μm of ol/L1 μ L
B3 primer 8 μm of ol/L1 μ L
(9) positive control dna 10 μm of ol/L2 μ L;
Described 10* reaction buffer is composed as follows
Tris-HCl buffer solution ph 8.8,200mM
KCl100mM
(NH4)
2SO
4100mM
MgSO
420mM
TritonX-1001%；
The base sequence of described FIP primer is as shown in SEQIDNO:1;
The base sequence of described BIP primer is as shown in SEQIDNO:2;
The base sequence of described F3 primer is as shown in SEQIDNO:3;
The base sequence of described B3 primer is as shown in SEQIDNO:4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510200441.0A CN105039507A (en) | 2015-04-24 | 2015-04-24 | Kit for quickly detecting marine vibrio vulnificus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510200441.0A CN105039507A (en) | 2015-04-24 | 2015-04-24 | Kit for quickly detecting marine vibrio vulnificus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039507A true CN105039507A (en) | 2015-11-11 |
Family
ID=54446474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510200441.0A Pending CN105039507A (en) | 2015-04-24 | 2015-04-24 | Kit for quickly detecting marine vibrio vulnificus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039507A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517887A (en) * | 2018-12-27 | 2019-03-26 | 广东环凯微生物科技有限公司 | The dry powdered LAMP quick detection kit of Vibrio vulnificus |
| CN115044690A (en) * | 2022-06-28 | 2022-09-13 | 中国科学院大学宁波华美医院 | Detection method for accurately detecting vibrio vulnificus based on targeted vvhA gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834723A (en) * | 2013-12-19 | 2014-06-04 | 宁波大学 | NASBA-microwell plate detection kit and detection method for five vibrios in mariculture |
-
2015
- 2015-04-24 CN CN201510200441.0A patent/CN105039507A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834723A (en) * | 2013-12-19 | 2014-06-04 | 宁波大学 | NASBA-microwell plate detection kit and detection method for five vibrios in mariculture |
Non-Patent Citations (2)
| Title |
|---|
| SH CAI ET AL: "Loop-mediated isothermal amplification method for rapid detection of Vibrio alginolyticus，the causative agent of vibriosis in mariculture fish", 《LETTERS IN APPLIED MICROBIOLOGY》 * |
| 薛超波等: "环介导等温扩增技术检测创伤弧菌方法的建立与应用", 《食品科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517887A (en) * | 2018-12-27 | 2019-03-26 | 广东环凯微生物科技有限公司 | The dry powdered LAMP quick detection kit of Vibrio vulnificus |
| CN115044690A (en) * | 2022-06-28 | 2022-09-13 | 中国科学院大学宁波华美医院 | Detection method for accurately detecting vibrio vulnificus based on targeted vvhA gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN102586452B (en) | Vibrio parahemolyticus detection kit and detection method thereof | |
| Geng et al. | Development and evaluation of a rapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood | |
| CN102943113B (en) | Loop-mediated isothermal amplification detection primer groups of Escherichia coli 0157, detection method and reagent kit | |
| CN103074449B (en) | Kit for synchronously detecting thirteen diarrhea viruses and detection method of kit | |
| CN104745703B (en) | The PCR ELISA detection kits and detection method of vibrio parahemolyticus | |
| Bavisetty et al. | Rapid pathogen detection tools in seafood safety | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN102851385A (en) | Primer group utilizing LAMP to detect vibrio alginolyticus and rapid diagnosis kit employing primer group | |
| CN102676664B (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN103320435B (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| D'Souza et al. | Application of gyrB targeted SYBR green based qPCR assay for the specific and rapid detection of Vibrio vulnificus in seafood | |
| CN103014152A (en) | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae | |
| CN102643919B (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| Zeng et al. | A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish | |
| CN104513857A (en) | Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus | |
| CN103898222A (en) | Salmonella molecular detection kit based on bcfD genes and non-diagnostic detection method | |
| CN105039507A (en) | Kit for quickly detecting marine vibrio vulnificus | |
| CN104450930B (en) | A kind of molecular detecting method of vibrio parahemolyticus and its application | |
| Li et al. | Effect of food matrix on rapid detection of Vibrio parahaemolyticus in aquatic products based on toxR gene | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| CN103952483B (en) | DPO-PCR method is utilized to detect DPO primer sequence and the detection kit of vibrio alginolyticus | |
| CN105087787A (en) | Reagent and method for fast detecting vibrio parahaemolyticus | |
| CN111893200A (en) | Fluorescent quantitative RPA detection method of vibrio parahaemolyticus | |
| CN104404132A (en) | SS2-LAMP detection kit of streptococcus suis type-2 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |
|
| RJ01 | Rejection of invention patent application after publication |