CN105039388A - Infectous clone construction method for recombined single-chain negative righteousness plant virus, plasmid and virus - Google Patents

Abstract

The invention discloses an infectous clone construction method for a recombined single-chain negative righteousness plant virus, a plasmid and a virus. A mixture for introducing a plasmid vector into a plant cell comprises a transcription vector (i), at least one expression vector (ii) and one or more separated nucleic acid molecules (iii) in a polynucleotide sequence of a silence suppression sub protein capable of suppressing gene silence in a plant body, wherein the transcription vector comprises a separated nucleic acid molecule which contains a polynucleotide sequence for encoding a single-chain negative righteousness plant virus antigenome; each expression vector comprises a trans-acting protein necessary for encoding capsid packaging, transcription and copying of the single-chain negative righteousness plant virus. After a plasmid vector combination is introduced into the plant cell, a large quantity of recombined plant negative-chain RNA viruses can be produced; infectous clone can efficiently infect at least more than one plant, and no expensive equipment is needed; the infectous clone construction method is easy to operate and high in repetitiveness; the infectous clone can be effectively used for trans-genetics research on the plant negative-chain RNA viruses.

Description

Recombinant single chain bears adopted plant virus infectious clone construction process and plasmid and virus

Technical field

The present invention relates to a kind of recombinant single chain and bear adopted plant virus infectious clone construction process and plasmid and virus.

Background technology

Virus reverse genetics (reversegenetics) technology is the new branch of science of a research Organization of viral genome and the function grown up for 20 end of the centurys, its core technology is that virus infection sex clone builds (be called infections clone in animal virus field, or virus rescue technology).Utilize infectious clone technology can carry out various modification and transformation to viral genome in vitro, studied virus genomic structure, its gene clear and definite and the function of product, the interaction understanding virus and host and transformation by the phenotype and characteristic variations of analyzing recombinant virus and utilized virus vector (exogenous protein expression carrier, gene silencing vector and animal virus vaccine carrier etc.), this technology is the most basic, the most important technique means of modern virusology research field.In RNA viruses, because the geneome RNA of RNA viruses itself can not be manipulated directly, cDNA clone technology then provides a kind of method of accommodation, makes the DNA molecular that the genetic information of RNA viruses becomes can handle by cDNA clonal shift.

It is active that positive chain RNA virus genome has messenger RNA(mRNA) (mRNA), and its geneome RNA is once directly as translation masterplate, can synthesize the albumen such as the replicative enzyme of encoding viral, the infection processs of initial viral after importing sensitive cells.No matter minus-stranded rna virus is its genome (gRNA), or antigenomic RNA (agRNA) complementary with it, all directly can not serve as the translation that mRNA carries out viral protein, does not thus have after independent transfered cell and infects activity.The minimum unit that infects of this viroid is the ribonucleoprotein complexes (ribonucleoproteincorecomplex that geneome RNA and core protein (generally including nucleocapsid protein, RNA polymerase and accessory protein thereof) form, RNP) (Conzelmann etc., CurrTopMicrobiolImmunol, 2004,283:1-41).Therefore, minus-stranded rna virus infectious clone builds needs in host cell, express virus all core protein component and full length genomic rnas simultaneously.Secondly, these two ends of the rna transcription of transfered cell need just to have during faithful to viral original series to infect activity (Walpita etc., FEMSMicrobiolLett, 2005,244:9-18; Neumann etc., CurrTopMicrobiolImmunol, 2004,283:43-60).Again, the gRNA of negative strand viruses is minus strand, and the mRNA expressing core protein is normal chain, can duplex-RNA constructs be formed when expressing in cell simultaneously, thus disturb the primary activity of these RNA, and cause RNA silencing phenomenon (Roberts etc., Virology, 1998,247:1-6).Finally, negative strand RNA virus gene group comparatively large (more than not segmentation viral genome 12kb), or number more (Rice grassy stunt virus is 6 genomes), genetic manipulation difficulty, inefficiency in body.

In order to solve these technology barriers, animal virus scholar, through exploring for many years, has defined the ripe scheme solving animal negative strand viruses infectious clone and build.Its ultimate principle is; the plasmid transfection simultaneously sensitive cells of viral core protein and cRNA can be expressed; wherein cRNA expression plasmid utilizes following two class promotors to transcribe usually: a class is phage t7 rna polymerase promoter; this kind of promotor is utilized to need in cell by recombined vaccinia virus (Vacciniavirus) carrier or transgene expression t7 rna polymerase; with the reverse genetics system of the rabies virus of Rhabdoviridae and vesicular stomatitis virus for representative (Schnell etc.; EMBOJ; 1994,13:4195-4203; Lawson etc., ProcNatlAcadSciUSA1995,92:4477-4481) .(Figure 1A); Another kind of is mankind PolI promotor (being responsible for intracellular nucleic sugar body rna transcription), utilize endogenous PolI polymerase transcription virus cRNA, with influenza virus reverse genetics system for representative (Neumann etc., ProcNatlAcadSciUSA1999,96:9345-9350) (Figure 1B).This two classes promotor is all by appropriate design, make it at virus 5 ' first base initiation transcription of terminal sequence, and not there is RNA add cap activity (negative strand RNA virus gene group 5 ' end without cap sequence), and 3 ' end is by merging with hepatitis D virus (HDV) ribozyme sequence, after the processing of ribozyme self cleavage, form the total length cRNA transcript of faithful to virus sequence.CRNA is packaged by the nucleocapsid protein of co expression, and form activated cRNP with varial polymerases, after genome duplication, form vRNP, and as masterplate Retroviral mRNA, formation can be packed after viral protein translation there is infectious recombinant virus particle.

Although plant minus-stranded rna virus at genome structure, copy the similarity that there is height with the animal virus of infection processs and deme, but due to the marked difference of host's (Plants and Animals), the method for animal virus rescue can not directly apply to the structure of plant virus infectious clone.The technical difficulty of botanical system inherence, makes the reported success that there is no plant minus-stranded rna virus infectious cDNA clone up to now in the world.The major technical difficulty of botanical system comprises: 1) lack the vitro culture system being similar to zooblast.Plant suspension cell has cell wall structure, be difficult to the multiple plasmids needed for the reconstruct of Efficient Conversion virus in individual cells, and the plant protoplast cell survival time short (usual 2-4 days), thus the infectivity of plant virus measures and can only carry out in plant level, adds work difficulty; 2) utilization of T7 promotor needs to express t7 rna polymerase in cell simultaneously, and this enzyme does not have the report of efficiency utilization in plant materials; PolI promoter sequence makes a variation large and has species specificity, at present this promotor is only cloned qualification in the minority plant such as Arabidopis thaliana, but can not in other kind of plant correct initiation transcription (Heix etc., CurrOpinGenetDev, 1995,5:652 – 656); 3) invasion of stronger in vegetable cell RNA silencing activity degradable exogenous nucleic acid molecule, and the high expression (Ding etc., NatRevImmunol, 2010,10:632-644) suppressing foreign protein.As can be seen here, plant minus-stranded rna virus infectious clone builds needs employing different from animal virus and more efficiently strategy.

Plant minus-stranded rna virus comprise not segmentation Rhabdoviridae ( rhabdoviridae), the bunyaviridae of segmentation ( bunyaviridae) Tospovirus ( tospovirus), snakelike Viraceae ( ophioviridae) and very thin Tobamovirus ( tenuivirus) etc. virus, as the sonchus yellow net virus, (Kormelink etc. such as rice yellow dwarf virus and wheat rosette stunt virus, the rice stripe virus of very thin Tobamovirus and the tomato spotted wilf virus of Tospovirus of Rhabdoviridae, VirusRes, 2011,162:184-202).Sonchus yellow net virus ( sonchusyellownetvirus, SYNV) belong to Rhabdoviridae nucleus Rhabdovirus ( nucleorhabdovirus) member.SYNV is the model virus of plant rhabdovirus, is also to study one of plant minus-stranded rna virus the most deep (Jackson etc., AnnuRevPhytopathol, 2005,43:623-660).SYNV genome (known sequence, GenBankaccL32603) is mononegavirale RNA, is about 13.7kb.Negative adopted geneome RNA itself is not encoded any albumen, 6 open reading frame (openreadingframe but antigenomic RNA (i.e. positive-sense strand RNA) is encoded, ORF), relative ranks on geneome RNA is followed successively by 3'-N-P-sc4-M-G-L-5', and 6 encoding histone mRNA are that template is transcribed from 3 ' of geneome RNA end to 5 ' end successively with antisense strand geneome RNA.These mRNA can encode 6 kinds of protein in the process infecting host plant cell, comprise: nucleocapsid protein (Nucleocapsid, N), phosphorprotein (Phosphoprotein, P), motor protein (sc4), stromatin (matrixprotein, M), glycoprotein (glycoprotein, and the large subunit (Largesubunitofpolymerase, L) of RNA polymerase G).The same with other all plant strand RNA, the genome of SYNV is minus strand, the core protein complex body that viral particle comprises gRNA and wraps up with it.When after SYNV invaded plants cell, under the effect of core protein complex body, take gRNA as masterplate, Retroviral mRNA, translation produces viral protein, the viral core protein of new synthesis and gRNA pack ribonucleoprotein complex, and catalyze and synthesize agRNA, and then are a large amount of gRNA of stencil duplicating with agRNA, and turn be made into virus particle (Jackson etc., AnnuRevPhytopathol, 2005,43:623-660).Also finding the further research of other plant minus-stranded rna virus subsequently, there is the feature (Kormelink etc., VirusRes, 2011,162:184-202) common with SYNV with Infection cycie in copying of this viroid.Visible, there is general character in structure and the infection processs of plant minus-stranded rna virus, the technological breakthrough obtained in model virus research, can be applied to other virus.

Summary of the invention

The invention provides a kind of recombinant single chain and bear adopted plant virus infectious clone construction process and plasmid and virus.

A kind of recombinant single chain bears adopted plant virus infectious clone construction process, the mixture of plasmid vector is imported in vegetable cell, described mixture comprises (i) a kind of transcription vector, described transcription vector comprises a kind of nucleic acid molecule of separation, the anti-genomic polynucleotide sequence of adopted plant virus is born containing encode single chain in this nucleic acid molecule, (ii) at least one expression vector, comprise the described mononegavirale plant vims capsid packaging of coding, transcribe and copy necessary trans-acting proteins, (iii) can suppress one or more nucleic acid molecule be separated of the polynucleotide sequence of the silencing suppressors albumen of gene silencing in plant materials, the process that described plasmid vector imports vegetable cell be all plasmid vectors described in being enough to realize transcribe simultaneously or coexpression and generation recombinant virus condition under carry out.

Described mononegavirale plant virus is the sonchus yellow net virus (SYNV) of plant rhabdovirus.

Described polynucleotide sequence be selected from the anti-genome of SYNV and capsid packaging, transcribe and copy institute required

Trans-acting proteins N, P and L.

Described viral RNA silencing suppressors polynucleotide sequence can select the RNA silencing suppressors deriving from any virus.

The anti-genomic isolated nucleic acid molecule coding of described coding SYNV has the virus infecting activity.

Described transcription vector and expression vector utilize rna plymerase ii type promotor, include but not limited to cauliflower mosaic virus promoter, ubiquitin promoter.

The approach of described vector introduction vegetable cell comprises agroinfiltration and biolistic bombardment; Described vegetable cell refers to the cell of the organs such as Plant Leaf, stem, root and floral organ, or Cells In Vitro and protoplastis.

Further, be also included in vegetable cell and obtain described recombinant virus.

For the plasmid according to described method, comprise anti-genomicly transcribe plasmid vector, viral capsid packaging, transcribe and copy in the expression plasmid carrier of necessary trans-acting proteins expression vector and described RNA silencing suppressors albumen one or more.

The recombinant virus that a kind of method described in basis obtains.

The invention has the beneficial effects as follows: 1) described plasmid vector compositions can produce recombinant plant minus-stranded rna virus after importing vegetable cell in a large number; 2) infectious clone provided by the invention is utilized efficiently can to infect the plant of more than at least one, without the need to the instrument, simple to operate, reproducible of costliness; 3) infectious clone provided by the invention is utilized can be effective to the reverse genetics research of plant minus-stranded rna virus, as pathogenic analysis, known viral gene function research and expression vector establishment etc.

Accompanying drawing explanation

fig. 1.SYNV full-length cDNA transcription vector pSYNV(+) structure; The full length cDNA clone of SYNVagRNA is in plant expression vector pCB301, be placed in the downstream of cauliflower mosaic virus (CaMV) 35S promoter accurate transcription initiation site, and 3 ' end merges with hepatitis D virus (HDV) ribozyme (Rz), produce SYNVagRNA full-length cDNA that is completely loyal and virus terminal to transcribe in vivo.

fig. 2.SYNV the structure of core protein N, P and L and viral silencing suppressor expression vector; Be divided into A, B, C tri-part, (A) core protein N, P and L gene is cloned into plant expression vector pGD, respectively by CaMV35S promoter transcription; (B) series connection of core protein N, P and L expression cassette is cloned in single plant expression vector pGD, by CaMV35S promoter transcription; (C) viral RNA silencing suppressors expression vector establishment: translation bushy stunt virus p19, marmor erodens HC-Pro and barly strip mosaic virus gb gene are cloned into pGD expression vector, respectively by CaMV35S promoter transcription.

fig. 3. agroinfiltration inoculation plant schematic diagram.

fig. 4.SYNV the acquisition of recombinant virus and Molecular Detection figure thereof; Be divided into A, B, C tri-symptom of part (A) SYNV infectious clone inoculation Ben Shi cigarette induction, photo is inoculation shooting in latter 35 days; (B) Westernblot analysis recombinant virus (rSYNV) and parental wild type virus (wtSYNV) structural protein are expressed; (C) restriction endonuclease analysis recombinant virus genetic marker, M: molecular weight marker.

fig. 5.SYNV recombinate progeny virus biological characteristics figure; Be divided into A, B, C tri-part, the systemic infection symptom that (A) recombinant virus is formed on Ben Shi cigarette through frictional inoculation, Mock: damping fluid inoculation contrast, rSYNV: recombinant virus, wtSYNV: wild-type virus; (B) sequencing analysis in recombinant virus progeny variation site; (C) electromicroscopic photograph of restructuring progeny virus particle, V: virus particle; Nuc: nucleus; M: plastosome; Im: core inner membrance; Om: core adventitia.

Embodiment

The feature that the present invention copies according to above-mentioned plant minus-stranded rna virus, pack and infects, be that embodiment constructs virus infection sex clone with Rhabdoviridae SYNV, have successfully been obtained first recombinant plant and bear adopted RNA viruses, the recombinant technology bearing adopted RNA viruses for other plant provides model and technique means.

The invention will be further described for employing non-limiting example below.Embodiment 1-3 describes construction step and the method for virus full length cloning vector and plasmid replication, embodiment 4-7 describes expression vector and imports vegetable cell and obtain the step and method of recombinant virus, example 8 describes recombinant virus to compare with the biological characteristics of wild-type virus, show that the method obtains the recombinant virus with wild-type virus indifference.Following example is used to describe the present invention, instead of restriction the present invention.

SYNV infectious clone builds and mainly comprises the steps:

1) the plant leaf total serum IgE comprising SYNV geneome RNA is extracted;

2) virus full length special primer SYNV/1F:5 '-tttcatttggagaggAGAGACAGAAACTCAGAAAATACAAT-3 ' (SEQIDNO:1) and SYNV/1R:5 '-atgccatgccgacccAGAGACAAAAGCTCAGAACAATCCCTAT-3 ' (SEQIDNO:2) is designed, and with the blade total serum IgE extracted for template amplification SYNV Full_length cDNA.

3) the SYNV Full_length cDNA of amplification is cloned into plant expression vector, obtains SYNVcDNA transcription vector plasmid pSYNV;

4) plant expression vector of SYNV ribonucleoprotein RNP core protein N, P and L is built;

5) plant expression vector from the RNA silencing suppressors albumen of other viruses is built;

6) by the method for electric shock, above-mentioned vector plasmid is imported agrobacterium strains GV3101 respectively;

7) the bacterium liquid process before inoculation: the Agrobacterium inoculation 20mLYEP liquid nutrient medium (containing 25 μ g/mL Rifampin+50 μ g/mL kantlex+25 μ g/mL gentamicins) comprising above-mentioned vector plasmid, 28 DEG C of 220rpm shake bacterium, and to be cultured to OD600 be 0.8-1.2; Centrifugal through 12000rpm1 minute, abandon supernatant, with the infiltration damping fluid Eddy diffusion thalline containing 10mMMgCl2,10mMMES, 200mM Syringylethanone, adjustment OD600 is about 1.0, leaves standstill 2-3 hour;

8) Agrobacterium combination: specific Agrobacterium is mixed in desired concn ratio according to required;

9) infiltrate inoculation: the plant selecting the 4-6 leaf fully extended seedling age phase, utilize the 1ml syringe not with syringe needle to infiltrate at the plant leaf back side in 3-4 week, a strain plant generally inoculates 3-4 sheet leaf;

10) inoculate plant and be placed in 25 DEG C of Isolation warm houses cultivations, within 20 days, observe the symptom of inoculation plant afterwards, the system lobus cardiacus gathering the plant producing virus symptoms and do not produce virus symptoms carries out RT-PCR detection, identifies whether have virus infection.

Below in conjunction with embodiment and accompanying drawing, the invention will be further described.

Embodiment 1.SYNVcDNA transcription vector builds

SYNV genome is mononegavirale RNA, is about 13.7kb.Extract total serum IgE from the Ben Shi Tobacco Leaves having infected SYNV, and with carry out reverse transcription PCR for template, obtain Full_length cDNA.By full length cDNA clone to plant expression vector pCB301, namely obtain SYNVcDNA transcription vector, called after pSYNV, pSYNV import Agrobacterium GV3101 by electric shock.

The building process infecting pSYNV transcription vector comprises the steps:

1) from the Ben Shi Tobacco Leaves infecting SYNV, total serum IgE is extracted:

Get 0.1g blade, add liquid nitrogen grind into powder; By powder fast transfer to the 1.5mL centrifuge tube of precooling, add rapidly the 1mLTRIzol extract of precooling; Mix up and down, abundant cracking, room temperature places 5min; Add 0.2mL chloroform, cover tightly centrifuge tube lid, concuss 15sec, room temperature places 2min; 4 DEG C, the centrifugal 15min of 12,000rpm, get supernatant and add the Virahol of equivalent volumes, putting upside down mixing, room temperature places 10min; 4 DEG C, the centrifugal 10min of 12,000rpm; Abandon supernatant.Add 1mL75% ethanol, vortex washing and precipitating.4 DEG C, the centrifugal 5min of 7,500rpm; Abandon supernatant, residue white precipitate is the blade total serum IgE just carried, and makes RNA throw out at room temperature dry.Add 30 μ L without the water of RNA enzyme, RNA to be precipitated all to dissolve.

1) primer SYNV/1F:5 '-tttcatttggagaggAGAGACAGAAACTCAGAAAATACAAT-3 ' (SEQIDNO:1) and SYNV/1R:5 '-atgccatgccgacccAGAGACAAAAGCTCAGAACAATCCCTAT-3 ' (SEQIDNO:2) is designed, and with the blade total serum IgE extracted for template amplification SYNV Full_length cDNA.Article two, 5 ' end of primer is each with 15 bases (lowercase), these bases respectively can with the 35S promoter of carrier and HDVRz ribozyme complementary pairing, the cDNA product two ends of corresponding amplification are respectively with these bases, cDNA with these Extra bases sequences can be inserted into carrier pCB301 by In-Fusion cloning reaction, insert position between 35S promoter and HDVRz ribozyme, transcription vector plasmid called after pSYNV (+) (Fig. 1) obtained.

2) screening positive clone carry out enzyme and cut qualification, cuts the errorless clone of qualification to enzyme and checks order, determine the insertion of SYNV full-length genome and correctly assemble;

Embodiment 2.RNP core protein expression vector establishment

The ribonucleoprotein RNP core of SYNV comprises N, P and L tri-kinds of albumen, these three kinds of albumen are inserted in plant expression vector pGD, obtain pGD-N, pGD-P and pGD-L, the expression cassette (Fig. 2 .A) that pGD expression vector controls with 35S promoter and NOS transcription terminator.Or N, P and L are inserted simultaneously in same expression vector, obtain pGD-NPL, in this expression vector, three albumen are controlled by different 35S promoters and NOS transcription terminator, that is same expression vector contains three expression cassettes, express N, P and L(Fig. 2 B respectively).

Embodiment 3. viral RNA silencing suppressors protein expression vector builds

Three from the RNA silencing suppressors coded by other viruses: marmor erodens (Tobaccoetchvirus, TEV) Hc-Pro gene, tomato bushy stunt virus (Tomatobushystuntvirus, TBSV) p19 gene and barly strip mosaic virus (Barleystripemosaicvirus, BSMV) γ b gene.These three silencing suppressors are inserted into pGD carrier, obtain three expression vectors: pGD-Hc-Pro, pGD-p19 and pGD-γ b(Fig. 2 .C).

Pre-treatment before embodiment 4. Agrobacterium-mediated Transformation, cultivation and inoculation

Transcription vector described in Example 1-3 or each 1 μ L of expression vector plasmid, join in 200 μ L Agrobacterium GV3101 strain competent cells, mix gently, proceeds to 2mm and shock by electricity in cup; Select electric shock instrument (Bio-Rad) for the electroporated program of Agrobacterium, the manual furnishing 2mm of electric shock cup thickness parameter, electric shock; Room temperature adds 800 μ LYEP recovery medias after leaving standstill 2min, 28 DEG C of standing 1h, then at 28 DEG C, and 200rpm shaking culture 1.5h; The centrifugal 2min of 8,000rpm, abandons supernatant, coats YEP plate culture medium (25 μ g/mLRif+50 μ g/mLKan+50 μ g/mLGent) after suspending with 200 μ L deionized waters; Cultivation 2 days is inverted for 28 DEG C in incubator.The Agrobacterium comprising above-mentioned cDNA transcription vector plasmid or protein expression vector inoculates 3mLYEP liquid nutrient medium (containing 25 μ g/mL Rifampin+50 μ g/mL kantlex+25 μ g/mL gentamicins) respectively, and it is 0.8-1.2 that 28 DEG C of 220rpm shake bacterium overnight incubation to OD600; Centrifugal through 12000rpm1 minute, abandon supernatant, with the infiltration damping fluid Eddy diffusion thalline containing 10mMMgCl2,10mMMES, 200mM Syringylethanone, adjustment OD600 is about 1.0, leaves standstill 2-3 hour;

Embodiment 5. agroinfiltration inoculation plant

Agrobacterium mixed solution in embodiment 4 is infiltrated respectively inoculation Ben Shi cigarette, inoculation plant selects the 4-6 leaf phase to be advisable.Infiltrating to inoculate uses the 1ml disposable syringe not with syringe needle to carry out blade back infiltration at 4-6 leaf phase plant leaf, and every strain plant infiltrates 3-4 sheet blade (Fig. 3), and after inoculation, plant is placed in 25 DEG C of Isolation warm houses cultivations.

The infectivity mensuration of embodiment 6. virus infection sex clone and the acquisition of recombinant virus

The Ben Shi cigarette of two groups of Agrobacterium inoculation all showed typical virus symptoms at about 20 days, and symptom comprises the serious last volume of lobus cardiacus, netted vein yellow symptom (Fig. 4 A).Gather infectious clone inoculate and produce the Ben Shi Tobacco Leaves of systemic virus symptoms, extract leaves total protein, carry out WesternBlot analysis with SYNV polyclonal antibody, the combination of result two groups of Agrobacteriums inoculate and the Ben Shi Tobacco Leaves producing symptom all can detect the special structural protein band (Fig. 4 B) of leading of SYNV.

Find during order-checking that pSYNV is the 11st, 967bp place existence point mutation (A-G), make newly to form a restriction enzyme site BsmBI in this position, cleavage site is 11,961bp place, and the sequence of wild-type virus (GenbankACCESSION:L32603) does not have the recognition site of BsmBI in this position, so the molecule marker (molecularmarker) of the neovirion recovered after the new BsmBI formed can infect Ben Shi cigarette as infectious clone on pSYNV.

Design primer SYNV/2F:5 '-TCCTAATAAGTTTCTACC-3 ' (SEQIDNO:3) and SYNV/2R:5 '-CGGAGAGTTGTGAATGTT-3 ' (SEQIDNO:4) increase the fragment (on Fig. 4 C) of Isosorbide-5-Nitrae 96bp.The PCR primer BsmBI enzyme of amplification is cut, if amplified production comprises BsmBI recognition site, is then cut into the endonuclease bamhi that size is respectively 954bp and 542bp, otherwise is still Isosorbide-5-Nitrae 96bp.The PCR fragment (lane1 – 3) of the 1.5kb size and the Ben Shi cigarette producing systemic virus symptoms all can therefrom increase is inoculated in the combination of two Agrobacteriums, and can be cut by BsmBI, and from wild-type virus (lanewt) amplification to fragment owing to there is no the recognition site of BsmBI in this position, can not be cut by BsmBI (in figure Fig. 4 C).In contrast, pSYNV and wild-type viral sequence are at 12,023bp place all containing ApaI recognition site, and ApaI can cut the PCR primer from pSYNV and wild-type virus simultaneously, produce the endonuclease bamhi (under Fig. 4 C) that size is respectively 1,016bp and 480bp.

Embodiment 7. infects the optimization of efficiency

The Agrobacterium that Example 4 obtains, respectively with the concentration ratio (OD of following combination one (table 1), two (tables 2) or three (tables 3) ₆₀₀light absorption value) mixing.Infiltrate inoculation Ben Shi cigarette, after inoculation, plant is placed in 25 DEG C of Isolation warm houses cultivations, observes inoculation Symptoms.Statistics through 3 revision tests finds, the plant of combination one inoculation is about 5%(10/190) infected, and combine two and be about 12%(18/145), combination three is about 26%(33/125), show N, P and L to be placed in same expression vector to express, what the expression level simultaneously increasing L can significantly improve infectious clone infects efficiency.

Table 1

Table 2

Table 3

Embodiment 8. is recombinated progeny virus specificity analysis

After the Ben Shi cigarette morbidity of infectious clone inoculation, get Symptomatic sick leaf 1g, add the S-WAT damping fluid grinding homogenate of 10mL0.5%, the healthy Ben Shi cigarette of frictional inoculation 4-5 leaf phase, and be placed in growth in illumination box.Inoculating after 13 days, there is the symptom (Fig. 5 A) similar with wild-type virus in Ben Shi cigarette plant.Extract morbidity Ben Shi cigarette total tissue RNA, primer SYNV/2F:5 '-TCCTAATAAGTTTCTACC-3 ' (SEQIDNO:3) and SYNV/2R:5 '-CGGAGAGTTGTGAATGTT-3 ' (SEQIDNO:4) is utilized to carry out RT-PCR amplification, carry out order-checking to acquisition PCR fragment to find, recombinant virus genomes the 11st, 967bp place's existence point mutation (A-G) is able to stable maintenance (Fig. 5 B) in progeny virus.Separately get the Ben Shi Tobacco Leaves of systemic infection, be cut into the little bar of 1mm × 3mm, fix through glutaraldehyde, ethanol dehydration, after Spurr resin embedding, prepare normal temperature embedded samples, and observe under an electron microscope and whether have virus particle to be formed.As shown in Figure 5 C, the Ben Shi cigarette of infectious clone inoculation can form rhabdovirus particle after morbidity in nucleus, does not have difference with wild-type virus particle, does not have virus particle in the healthy Ben Shi cigarette of no inoculation.

SEQUENCELISTING

<110> Zhejiang University

<120> recombinant single chain bears adopted plant virus infectious clone construction process and plasmid and virus

<160>4

<170>PatentInversion3.5

<210>1

<211>41

<212>DNA

<213>ArtificialSequence

<220>

<223>SYNV/F

<400>1

tttcatttggagaggagagacagaaactcagaaaatacaat41

<210>2

<211>43

<212>DNA

<213>ArtificialSequence

<220>

<223>SYNV/R

<400>2

atgccatgccgacccagagacaaaagctcagaacaatccctat43

<210>3

<211>18

<212>DNA

<213>ArtificialSequence

<220>

<223>SYNV/2F

<400>3

tcctaataagtttctacc18

<210>4

<211>18

<212>DNA

<213>ArtificialSequence

<220>

<223>SYNV/2R

<400>4

cggagagttgtgaatgtt18

Claims (10)

1. recombinant single chain bears an adopted plant virus infectious clone construction process, it is characterized in that:

The mixture of plasmid vector is imported in vegetable cell, described mixture comprises (i) a kind of transcription vector, described transcription vector comprises a kind of nucleic acid molecule of separation, the anti-genomic polynucleotide sequence of adopted plant virus is born containing encode single chain in this nucleic acid molecule, (ii) at least one expression vector, comprise coding described mononegavirale plant vims capsid packaging, transcribe and copy necessary trans-acting proteins, with one or more nucleic acid molecule be separated of polynucleotide sequence of silencing suppressors albumen that (iii) can suppress gene silencing in plant materials; The process that described plasmid vector imports vegetable cell be all plasmid vectors described in being enough to realize transcribe simultaneously or coexpression and generation recombinant virus condition under carry out.

2. method as claimed in claim 1, it is characterized in that, described mononegavirale plant virus is the sonchus yellow net virus (SYNV) of plant rhabdovirus.

3. method as claimed in claim 1, is characterized in that, described polynucleotide sequence is selected from the anti-genome of SYNV and capsid packaging, transcribes and copy necessary trans-acting proteins N, P and L.

4. method as claimed in claim 1, it is characterized in that, described viral RNA silencing suppressors polynucleotide sequence can select the RNA silencing suppressors deriving from any virus.

5. method as claimed in claim 1, is characterized in that, the anti-genomic isolated nucleic acid molecule coding of described coding SYNV has the virus infecting activity.

6. method as claimed in claim 1, it is characterized in that, described transcription vector and expression vector utilize rna plymerase ii type promotor, include but not limited to cauliflower mosaic virus promoter, ubiquitin promoter.

7. method as claimed in claim 1, it is characterized in that, the approach of described vector introduction vegetable cell comprises agroinfiltration and biolistic bombardment; Described vegetable cell refers to the cell of the organs such as Plant Leaf, stem, root and floral organ, or Cells In Vitro and protoplastis.

8. method as claimed in claim 1, is characterized in that, further, is also included in vegetable cell and obtains described recombinant virus.

9. the plasmid for method according to claim 1, it is characterized in that, comprise anti-genomicly transcribe plasmid vector, viral capsid packaging, transcribe and copy in the expression plasmid carrier of necessary trans-acting proteins expression vector and described RNA silencing suppressors albumen one or more.

10. the recombinant virus of a method acquisition according to claim 1.