CN105018627B - The PCR detection techniques of crust source allergenic substance in ammonia sugar products - Google Patents
The PCR detection techniques of crust source allergenic substance in ammonia sugar products Download PDFInfo
- Publication number
- CN105018627B CN105018627B CN201510482785.5A CN201510482785A CN105018627B CN 105018627 B CN105018627 B CN 105018627B CN 201510482785 A CN201510482785 A CN 201510482785A CN 105018627 B CN105018627 B CN 105018627B
- Authority
- CN
- China
- Prior art keywords
- pcr
- ammonia sugar
- 1min
- ammonia
- fragment length
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Abstract
The invention provides a kind of method detected using round pcr to ammonia sugar product, can quickly, conveniently, accurately know in ammonia sugar and products thereof whether contain shell-fish sensibiligen material.After Sample extraction DNA, expanded using PCR primer provided by the invention and condition, agarose gel electrophoresis observation amplification.As a result positive prompting contains shell-fish sensitization source, and feminine gender represents to be free of.
Description
Technical field
The invention belongs to technical field of bioengineering, and in particular to be in a kind of detection ammonia sugar products by round pcr
The no method containing crust source sensitizer.
Background technology
Glucosamine refers to the compound that a hydroxyl of glucose is substituted by an amino.Molecular formula C6H13O5N,
Amino sugar, abbreviation ammonia sugar, also known as gucosamine are commonly called as, is widely present in nature, 2-amino-2-deoxy-D-Glucose is usual
With N- acetyl derivatives（Such as chitin）Or with N- sulfuric esters and N- acetyl -3-O- lactic acid ethers（Muramic acid）Form is present in micro-
In biology, the polysaccharide of animal origin and combination polysaccharide.Therefore can be from microorganism（Based on filamentous fungi, higher fungus）Or first
Shell class animal（Shrimp crab）Ammonia sugar is extracted in shell.
Glucosamine is the important nutrient to form cartilage cell, is the natural tissues composition of healthy articular cartilage.With
The growth at age, the shortage of the Glucosamine in human body is increasingly severe, and articular cartilage is constantly degenerated and worn.The U.S.,
A large amount of medical researches in Europe and Japan show：Glucosamine can be helped to repair and safeguard cartilage, and cartilage can be stimulated thin
The growth of born of the same parents.
Ammonia sugar can releive the pain caused by arthritis, stiff and swelling：Osteoporosis consumes cartilage, ultimately results in
Fragmentation is peeled off, and the buffering of cartilage has been lacked in joint, is also easy to produce the stiff and inflammation of pain, and ammonia sugar helps to repair damaged cartilage,
The generation of new cartilage is stimulated, improves inflammation symptom, arthralgia of releiving, stiff and swelling；Cartilage structure can be strengthened, prevent joint
Disabler：With body ages, joint tissue meeting heavy wear, ammonia sugar can be protected and strengthen cartilage structure, prevent because closing
Aging and caused function of joint is saved to fail；Can lubricating joint and maintenance function of joint：Ammonia sugar can manufacture proteoglycan lubrication and close
Section, Bones and joints friction pain is prevented, makes joint motion freely.Ammonia sugar adds in food and medicine Surveillance Authority of the U.S. as meals
Agent is managed, and in Europe, Glucosamine is approved for medicine, is sold in the form of sulfate.
But cause the food of allergy in 8 major classes that FAO (Food and Agriculture Organization of the United Nation) proposes, the shellfish such as shrimp, crab and its
Product is important a kind of sensibiligen.Therefore, it is possible to from crustacean ammonia sugar because shrimp, crab meat（Albumen）Removing it is not thorough
Bottom, cause easy allergic human population that allergy occurs after taking.So the detection of crust source allergenic substance is carried out to ammonia sugar to be prevented
Corresponding crowd wrongly takes allergy, and provides technical foundation for the raw material sources identification of ammonia sugar, and foundation is provided for product marking.
The content of the invention
The invention provides a kind of method detected using round pcr to ammonia sugar product, can quickly, conveniently, it is accurate
True knows in ammonia sugar and products thereof whether contain shell-fish sensibiligen material.Specific method is as follows：
（1）Amplimer sequence：
crustacean1 F5’-TCTAAGCTGCGTACATATCG-3’
crustacean1 R5’-ATTATCACACTATTTCCTAC -3’
Expanding fragment length is 140bp；
crustacean2 F5’-CGCTAATCCAACAAGACAT -3’
crustacean2 R5’-CCATTCTGAACAGACATCA -3’
Expanding fragment length is 150bp.
（2）The DNA extractions of testing sample
Processing method is according to Universal Genomic DNA Extraction Kit TaKaRa, Ver.3.0, extracting
Sample DNA.
（3）PCR is expanded
PCR reactions use 25 μ L systems, and PCR reaction solutions are prepared by following components：10 × PCR buffer solutions 2 μ L, 10 μm of ol/L
Forward and reverse primer each 1 μ L, dNTP（10mmol/L）2 μ L, Taq archaeal dna polymerases（5U/μL）0.2 μ L, template DNA（Contain
50±10ngDNA）1 μ L, add dH2O supplies 25 μ L.PCR reaction conditions are as follows：94 DEG C of 3min, 94 DEG C of 1min, 66 DEG C of 1min, 72
DEG C 1min, 35 circulations；72 DEG C of 7min terminate to react.4 DEG C of preservation reaction products, product are carried out using 2% agarose gel electrophoresis
Observation.
Advantages of the present invention：It is proposed to detect crust source that may be present sensitizer in ammonia sugar using PCR method first, be
The ammonia sugar for providing high quality provides fast, easily method.
Embodiment
The Glucosamine sample detection that embodiment 1 is prepared using shrimp, crab shell
Shrimp, crab shell are prepared into Glucosamine by the method for hydrolyzing, decolourize, concentrating, crystallize, drying（With reference to Chinese special
Sharp publication number CN104327129A）, using kit Universal Genomic DNA Extraction Kit TaKaRa,
Ver.3.0 extracts DNA therein, then enters performing PCR.PCR conditions are seen below：
Amplimer sequence：Crustacean1 F5 '-TCTAAGCTGCGTACATATCG-3 ', crustacean1 R5 '-
ATTATCACACTATTTCCTAC -3 ', expanding fragment length 140bp；crustacean2 F5’-
CGCTAATCCAACAAGACAT -3 ', crustacean2 R5 '-CCATTCTGAACAGACATCA -3 ', expanding fragment length
For 150bp.PCR reactions use 25 μ L systems, and PCR reaction solutions are prepared by following components：10 × PCR buffer solutions 2 μ L, 10 μm of ol/L
Forward and reverse primer each 1 μ L, dNTP（10mmol/L）2 μ L, Taq archaeal dna polymerases（5U/μL）0.2 μ L, template DNA（Contain
50±10ngDNA）1 μ L, add dH2O supplies 25 μ L.PCR reaction conditions are as follows：94 DEG C of 3min, 94 DEG C of 1min, 66 DEG C of 1min, 72
DEG C 1min, 35 circulations；72 DEG C of 7min terminate to react.4 DEG C of preservation reaction products, product are carried out using 2% agarose gel electrophoresis
Observation.
As a result show, two kinds of primers amplify obvious respective strap, prompt in ammonia sugar preparation process, may residual
Shrimp, crab meat（Protein）Do not remove totally, be potential sensitization source for specific crowd.
The Glucosamine sample detection that embodiment 2 is prepared using the chitin of fungal mycelium extraction
Glucosamine is prepared using chitin, step is as follows：Microbial fermentation produces chitinase；Obtain crude enzyme liquid；It is dense
Contracting enzyme liquid；Produce 2-Acetamido-2-deoxy-D-glucose（Specific method refers to China Patent Publication No. CN104388496A）.Using reagent
Box Universal Genomic DNA Extraction Kit TaKaRa, Ver.3.0 extraction DNA therein, are then carried out
PCR.PCR conditions are seen below：
Amplimer sequence：Crustacean1 F5 '-TCTAAGCTGCGTACATATCG-3 ', crustacean1 R5 '-
ATTATCACACTATTTCCTAC -3 ', expanding fragment length 140bp；crustacean2 F5’-
CGCTAATCCAACAAGACAT -3 ', crustacean2 R5 '-CCATTCTGAACAGACATCA -3 ', expanding fragment length
For 150bp.PCR reactions use 25 μ L systems, and PCR reaction solutions are prepared by following components：10 × PCR buffer solutions 2 μ L, 10 μm of ol/
L forward and reverse primer each 1 μ L, dNTP（10mmol/L）2 μ L, Taq archaeal dna polymerases（5U/μL）0.2 μ L, template DNA（Contain
50±10ngDNA）1 μ L, add dH2O supplies 25 μ L.PCR reaction conditions are as follows：94 DEG C of 3min, 94 DEG C of 1min, 66 DEG C of 1min, 72
DEG C 1min, 35 circulations；72 DEG C of 7min terminate to react.4 DEG C of preservation reaction products, product are carried out using 2% agarose gel electrophoresis
Observation.
As a result show, two kinds of primers do not amplify respective strap, and the ammonia sugar is safe to shellfish allergies crowd.
The detection of the commercially available ammonia sugar product of embodiment 3
Commercially available ammonia sugar product is bought, is respectively：The aminoglucose hydrochloride capsule of sample 1, the glucosamine potassium sulfate of sample 2
Capsule, the ammonia sugar chondroitin of sample 3 add calcium tablet, the ammonia sugar chondroitin hyaluronic acid capsule of sample 4.Using kit Universal
Genomic DNA Extraction Kit TaKaRa, Ver.3.0 extraction DNA therein, then enter performing PCR.PCR conditions are shown in
Under：
Amplimer sequence：Crustacean1 F5 '-TCTAAGCTGCGTACATATCG-3 ', crustacean1 R5 '-
ATTATCACACTATTTCCTAC -3 ', expanding fragment length 140bp；crustacean2 F5’-
CGCTAATCCAACAAGACAT -3 ', crustacean2 R5 '-CCATTCTGAACAGACATCA -3 ', expanding fragment length
For 150bp.PCR reactions use 25 μ L systems, and PCR reaction solutions are prepared by following components：10 × PCR buffer solutions 2 μ L, 10 μm of ol/
L forward and reverse primer each 1 μ L, dNTP（10mmol/L）2 μ L, Taq archaeal dna polymerases（5U/μL）0.2 μ L, template DNA（Contain
50±10ngDNA）1 μ L, add dH2O supplies 25 μ L.PCR reaction conditions are as follows：94 DEG C of 3min, 94 DEG C of 1min, 66 DEG C of 1min, 72
DEG C 1min, 35 circulations；72 DEG C of 7min terminate to react.4 DEG C of preservation reaction products, product are carried out using 2% agarose gel electrophoresis
Observation.
As a result see the table below
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | |
| crustacean1 | + | + | - | - |
| crustacean2 | + | - | - | + |
The result is prompted, and the ammonia sugar in sample 1, sample 2, sample 4 derives from shell-fish extraction, is to easy allergic human population
It is unsafe；The ammonia sugar of sample 3 has no amplified band, can use safely.
crustacean1 F5’-TCTAAGCTGCGTACATATCG-3’
crustacean1 R5’-ATTATCACACTATTTCCTAC -3’
crustacean2 F5’-CGCTAATCCAACAAGACAT -3’
crustacean2 R5’-CCATTCTGAACAGACATCA -3’
Claims (2)
1. a kind of method detected using round pcr to ammonia sugar product, it can judge whether contain in ammonia sugar according to result
Shell-fish sensitization source, specific features are that PCR primer is as follows：
Crustacean1 F5 '-TCTAA GCTGC GTACA TATCG-3 ', Crustacean1 R5 '-ATTAT CACAC
TATTT CCTAC-3 ', expanding fragment length 140bp；Crustacean2 F5 '-CGCTA ATCCA ACAAG ACAT-3 ',
Crustacean2 R5 '-CCATT CTGAA CAGAC ATCA-3 ', expanding fragment length 150bp.
2. the method as described in claim 1, it is characterized in that PCR conditions are as follows：Using 25 μ L systems, prepared by following components
PCR reaction solutions：10 × PCR buffer solutions 2 μ L, 10 μm of ol/L forward and reverse primer each 1 μ L, 10mmol/L the μ L of dNTP 2,
The 5U/ μ L μ L of Taq archaeal dna polymerases 0.2, the μ L of template DNA 1 containing 50 ± 10ngDNA, add dH2O supplies 25 μ L；94 DEG C of 3min,
94 DEG C of 1min, 66 DEG C of 1min, 72 DEG C of 1min, 35 circulations；72 DEG C of 7min terminate to react；4 DEG C of preservation reaction products, product use
2% agarose gel electrophoresis is observed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510482785.5A CN105018627B (en) | 2015-08-10 | 2015-08-10 | The PCR detection techniques of crust source allergenic substance in ammonia sugar products |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510482785.5A CN105018627B (en) | 2015-08-10 | 2015-08-10 | The PCR detection techniques of crust source allergenic substance in ammonia sugar products |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105018627A CN105018627A (en) | 2015-11-04 |
| CN105018627B true CN105018627B (en) | 2018-01-16 |
Family
ID=54408925
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510482785.5A Active CN105018627B (en) | 2015-08-10 | 2015-08-10 | The PCR detection techniques of crust source allergenic substance in ammonia sugar products |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018627B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434991A (en) * | 2008-09-04 | 2009-05-20 | 集美大学 | Real time fluorescent PCR method for detecting aquatic product food allergen gene |
| CN101899501A (en) * | 2010-02-10 | 2010-12-01 | 江苏出入境检验检疫局动植物与食品检测中心 | Constant temperature amplification detection kit and method for detecting food allergen crustacean gene |
-
2015
- 2015-08-10 CN CN201510482785.5A patent/CN105018627B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434991A (en) * | 2008-09-04 | 2009-05-20 | 集美大学 | Real time fluorescent PCR method for detecting aquatic product food allergen gene |
| CN101899501A (en) * | 2010-02-10 | 2010-12-01 | 江苏出入境检验检疫局动植物与食品检测中心 | Constant temperature amplification detection kit and method for detecting food allergen crustacean gene |
Non-Patent Citations (1)
| Title |
|---|
| 甲壳类食品过敏原研究及其在出入境检验检疫中的地位;冯汉利等;《湖北农业科学》;20100131;第49卷(第1期);207-210 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105018627A (en) | 2015-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vázquez et al. | Production of valuable compounds and bioactive metabolites from by-products of fish discards using chemical processing, enzymatic hydrolysis, and bacterial fermentation | |
| van der Meer et al. | From farm to pharma: an overview of industrial heparin manufacturing methods | |
| Etyemez et al. | Bacterial community structure in the intestinal ecosystem of rainbow trout (Oncorhynchus mykiss) as revealed by pyrosequencing-based analysis of 16S rRNA genes | |
| Kraler et al. | The intestinal microbiota of piglets fed with wheat bran variants as characterised by 16S rRNA next-generation amplicon sequencing | |
| Gartland et al. | Progress towards the ‘Golden Age’of biotechnology | |
| WO2018064968A1 (en) | Method for producing edible cell | |
| Gregory et al. | Isolation and characterization of Campylobacter hepaticus from layer chickens with spotty liver disease in the United States | |
| TWI695685B (en) | Broth compositions and their use as prebiotics | |
| Lan et al. | Soy oligosaccharides in vitro fermentation characteristics and its effect on caecal microorganisms of young broiler chickens | |
| Machado et al. | Effects of innovative processing methods on microalgae cell wall: prospects towards digestibility of protein-rich biomass | |
| CN108949748B (en) | Sputum liquefaction and nucleic acid protection reagent | |
| US20170342453A1 (en) | Chitin and chitosan producing methods | |
| BR112012015596A2 (en) | "process of producing adherent cells and using them" | |
| Khurana et al. | Gut milieu shapes the bacterial communities of invasive silver carp | |
| Perricone et al. | Green tea and pomegranate extract administered during critical moments of the production cycle improves blood antiradical activity and alters cecal microbial ecology of broiler chickens | |
| Dong et al. | Clostridium perfringens suppressing activity in black soldier fly protein preparations | |
| Shen et al. | The inhibition of high ammonia to in vitro rumen fermentation is pH dependent | |
| Martí-Quijal et al. | Isolation, Identification and investigation of fermentative bacteria from sea bass (Dicentrarchus labrax): Evaluation of antifungal activity of fermented fish meat and by-products broths | |
| CN105018627B (en) | The PCR detection techniques of crust source allergenic substance in ammonia sugar products | |
| Suong et al. | Optimizing anthocyanin-rich black cane (Saccharum sinensis Robx.) silage for ruminants using molasses and iron sulphate: A sustainable alternative | |
| CN104324045B (en) | Application of the Gomphidius rutilus polysaccharide in antityrosinase inhibitor is prepared | |
| Sarnataro et al. | A nutritional and rumen ecological evaluation of the biorefinery by‐product alfalfa silage cake supplemented with Scrophularia striata extract using the rumen simulation technique | |
| Hyun et al. | Exploring the Potential of Olive Flounder Processing By-Products as a Source of Functional Ingredients for Muscle Enhancement | |
| GB2561414A (en) | Myco Capsule | |
| Al-Sharif et al. | Investigating polymorphisms and expression profile of immune, antioxidant, and erythritol-related genes for limiting postparturient endometritis in Holstein cattle |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Shi Jinsong Inventor after: Xu Zhenghong Inventor after: Geng Yan Inventor after: Gong Jinsong Inventor after: Qian Jianying Inventor before: Shi Jinsong Inventor before: Geng Yan Inventor before: Gong Jinsong Inventor before: Qian Jianying |
|
| CB03 | Change of inventor or designer information | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180228 Address after: 1800 No. 214122 Jiangsu city of Wuxi Province Li Lake Avenue Co-patentee after: YANGZHOU RIXING BIO-TECH Co., LTD. Patentee after: Jiangnan University Address before: No. 1800 road 214122 Jiangsu Lihu Binhu District City of Wuxi Province Patentee before: Jiangnan University |
|
| TR01 | Transfer of patent right |