CN105018599A - Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea - Google Patents
Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea Download PDFInfo
- Publication number
- CN105018599A CN105018599A CN201510317918.3A CN201510317918A CN105018599A CN 105018599 A CN105018599 A CN 105018599A CN 201510317918 A CN201510317918 A CN 201510317918A CN 105018599 A CN105018599 A CN 105018599A
- Authority
- CN
- China
- Prior art keywords
- film
- specific oligonucleotide
- oligonucleotide sequences
- babesia
- sheep
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a diagnostic kit for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea, wherein the diagnostic kit comprises a Biodyne c film, and one or a plurality of specific oligonucleotide sequences in the group comprising the T luwenshuni specific oligonucleotide sequence atcttctttttgatgagttg, the T uilenbergi specific oligonucleotide sequence tgcattttccgagtgttact, the sheep Piroplasma specific oligonucleotide sequence ctgtcagaggtgaaattct, the Babesia specific oligonucleotide sequence ccttggtaatggttaataggaa, the sheep Babesia undetermined species specific oligonucleotide sequence cgggtttcgtctacttcgc, and the Babesia motasi specific oligonucleotide sequence gaatgatgccgacttaaaccct, and a pair of primers are fixed on the film.
Description
Technical field
The present invention relates to a kind of Test paper for detecting Theileria luwenshuni, T.uilenbergi and ovine Piroplasma worm, and a kind of rapid detection Theileria luwenshuni, T.uilenbergi and ovine Piroplasma worm method.
Background technology
Theileriosis in sheep is a kind of tick transmissibility bloodprotozoonoses being caused sheep and goat by Theileria SP (Theileriahirci), parasitizes in ox, sheep and other animal epithelial cell, lymphocyte and red corpuscle.Within 1914, be found in Egypt at first, all find this cause of disease in many countries in African, Europe, Asia subsequently.First theileriosis in sheep Xi Yangfu state of China etc. is found in Tibetan Autonomous Prefecture of Garze, Sichuan Province universe Ning County in nineteen fifty-seven.In China, confirm that the theileriosis cause of disease of sheep is not above any one after deliberation, but novel species, tentatively name as Theileria luwenshuni (T.luwenshuni) and T.uilenbergi (T.uilenbergi), the communication media of these two kinds of polypides is Qinghai blood tick.For the peculiar cause of disease of China.
Generally speaking, the diagnosis of Taylor worm mainly comprises three kinds of methods: (l) is by the method for blood smear and clinical symptom, such as: Akinboade OA, DipeoluOO.Comparison of blood smear and indirectfluorescent antibody techniques in detection ofhaemoparasite infections in trade cattlein Nigeria [J] .Vet Parasitol.1984,14 (2): 95-104; Darghouth ME, Bouattour A, BenMiled L, Sassi L.Diagnosis of Theileriaannulata infection of cattle in Tunisia:comparison ofserology and blood smears [J] .Vet Res.1996; 27 (6): 613-21.(2) some serological methods are applied; this method is that complement fixation test (CFT) (CFT) and indirect fluorescent antibody test (IFAT) detect; but these methods be difficult to get rid of not of the same race between cross reaction, and often there will be false positive and undetected.See Bruning A.Equine piroplasmosis an update on diagnosis [J] .Br Vet J, 1996,152:139 ~ 151, or Papadopoulos B, Brossard M, Perie NM (1996) Piroplasms ofdomestic animals in the Macedonia region ofGreece.3.Piroplasms ofsmall ruminants.Vet Parasitol 63:67-74.(3) round pcr, detect the most frequently used molecular diagnosis method of Taylor worm at present, there is susceptibility compared with the method for routine high, high specificity, recall rate advantages of higher, see AlhassanA, Pumidonming W, Okamura M, Hirita H, Battsetseg B, Fujisald F, Yokoyama N, Igarashi I (2005) Development of a single-round and multiplex PCR method for thesimultaneous detection ofBabesiacaballi and Babesiaequi in horse blood.Vet Parasitol129:43-49, Altay K, Dumanli N, Holman PJ, Aktas M (2005) Detection ofTheileriaovis infected sheep by nested PCR.Vet Parasitol 127:99-104.But PCR method can not detect the generation of polyinfection usually simultaneously.The cause of disease Theileria luwenshuni of China and T.uilenbergi, have extremely strong pathogenic and lethality.And investigation finds that this cause of disease is widely distributed, directly threatens the development of China's sheep husbandry.So, formulate effective detection forecast system very urgent and necessary to the control of this disease.
Chinese invention patent application 200810018313.4 discloses a kind of ELISA diagnostic kit detecting theileriosis in sheep and preparation method thereof, and the method comprises: the solid support that can be combined with testing sample; Be coated in the Theileria SP merozoite antigen on the solid support that can be combined with testing sample, every hole 0.1ug; As the anti-sheep IgG of rabbit of the use enzyme labelling that two resist; Standard Theileria SP positive serum; Standard Theileria SP negative serum; Gelatin; Substrate dilution; 30%H
2o
2; Colorless substrate; Stop buffer; Phosphate buffered saline buffer.Through envelope antigen, washing, close, washing, air-dry after technique such as sealing 4 DEG C of preservations etc. be prepared from.The present invention has the distinctive high specific of somatic antigen; The stdn that this disease that achieves this ELISA diagnostic kit detects, automatization and be applicable to the early diagnosis of theileriosis in sheep and large-scale field sera epidemiology survey.Can early diagnosis this disease, generally within 5 days, just can detect specific antibody after infection, detect the time advance 5-10 days that the earliest time of serum antibody is compared conventional microscope and detected.But the method for this patent application cannot distinguish ill sheep sense
Dye be which kind of Taylor worm actually, this can affect the treatment only of ill sheep and prevention work.The detection method used time of this patent is longer on the other hand, has influence on applying of this method.
Summary of the invention
The invention provides a kind of detection film of DNA for detecting Theileria luwenshuni, T.uilenbergi and ovine Piroplasma worm, and the preparation method of this detection film and using method.
The present invention for detecting Theileria luwenshuni, the DNA detection film of T.uilenbergi and ovine Piroplasma worm is the specific oligonucleotide being fixed with Theileria luwenshuni and T.uilenbergi on BiodyneC film.
DNA detection film for detecting Theileria luwenshuni, T.uilenbergi and ovine Piroplasma worm of the present invention, BiodyneC film is also fixed with Babesia specific oligonucleotide and the general specific oligonucleotide of Taylor worm.
The present invention is for detecting Theileria luwenshuni, T.uilenbergi, the DNA detection film of ovine Piroplasma worm, Theileria luwenshuni specific oligonucleotide sequences fixing on BiodyneC film is atcttctttttgatgagttg, fixing T.uilenbergi specific oligonucleotide sequences is tgcattttccgagtgttact, fixing ovine Piroplasma worm specific oligonucleotide sequences is ctgtcagaggtgaaattct, fixing Babesia specific oligonucleotide sequences is ccttggtaatggttaataggaa, fixing sheep Babesia U sp specific oligonucleotide sequences is cgggtttcgtctacttcgc, fixing Mohs Babesia specific oligonucleotide sequences is gaatgatgccgacttaaaccct.
The present invention for detecting Theileria luwenshuni, the preparation method of DNA detection film of T.uilenbergi and ovine Piroplasma worm is that synthetic goes out the specific oligonucleotide of Theileria luwenshuni and T.uilenbergi respectively, obtained each oligonucleotide 5 ' end amine groups is modified, then it is covalently bound to respectively on the BiodyneC film with negative charge; Or synthetic goes out the specific oligonucleotide of Babesia specific oligonucleotide, the general specific oligonucleotide Theileria luwenshuni of Taylor worm and T.uilenbergi respectively, obtained each oligonucleotide 5 ' end amine groups is modified, then it is covalently bound to respectively on the BiodyneC film with negative charge.
Detection film of the present invention detects Theileria luwenshuni, the method of T.uilenbergi and ovine Piroplasma worm is the DNA profiling extracted with sheep blood to be detected, the clip size that conservative region design pair for amplification at Taylor worm and two ends, Babesia 18S rRNA gene order V4 hypervariable region goes out is the primer of 480bp-491bp, a wherein primer biotin labeling, carry out pcr amplification again, obtain biotin labeled PCR primer, the oligonucleotide of biotin labeled PCR primer and the Taylor worm be fixed on BiodyneC film and Babesia is hybridized, after enhanced chemiluminescence is hatched, the film after hybridization is placed in exposure cassette again, film is put X-ray film expose, again development and fixing process are carried out to film, determine whether tested sheep has and suffer from corresponding disease according to the strength signal that film produces.
The present invention has following effect:
Adopt detection film of the present invention can detect easily and distinguish Theileria luwenshuni and T.uilenbergi, simultaneously owing to detection film of the present invention being also fixed with the specific oligonucleotide of ovine Piroplasma worm, therefore the present invention can detect the existence of multiple worm kind simultaneously, can detect tested zoogenetic infection simultaneously and have a kind of or multiple pyriform worm, this control for flock of sheep disease and prophylactic treatment have positive meaning.
Method great advantage of the present invention is when can detect Taylor worm and Babesia simultaneously, and only needs work PCR, if there is amplified production, illustrates that animal is infected a certain of Babesia or Taylor worm or several kinds certainly.In addition, after PCR primer and probe hybridization, the kind of the polypide that tested animal infects can also be described, this control for disease and prevention have more positive meaning.Susceptibility of the present invention is higher than PCR, and can distinguish genus and the kind of cause of disease simultaneously, and this characteristic is significant in epidemiology survey.Owing to can remove with the PCR primer of probe hybridization, therefore Hybond membrane can Reusability, it is reported that this film at least can use more than 20 times, in addition, on a film, can solidify 45 probes, detects 45 PCR primer, its relative inexpensiveness simultaneously.
The method adopting detection film of the present invention to carry out detecting very simple, and it is less to detect the used time, and its testing cost is relative also lower, and loss will be far smaller than prior art.
Accompanying drawing explanation
Fig. 1 is the standard positive sample detection result figure of the ill sheep of part
Embodiment
One. the detection film preparation containing Taylor worm and the acid of Babesia specific oligonucleotide:
Design according to the gene order that the V4 hypervariable region of fixed 18SrRNA gene order is designed for four specific oligonucleotide probes of Mohs Babesia, Babesia Keshen strain species indeterminata, Theileria luwenshuni worm kind different from T.uilenbergi, and called after: B.m, B.spXJ, T.l and T.u, in addition, for general probe catch-all and the Taylor worm general probe of all pyriform worms, Babesia general probe Tall, Ball are also designed synthesis respectively.All oligonucleotide probe N-(trifluoroacetamidohexyl-cyanoethyl, N, N-diisopropyl phosphoramidite [TFA])-C6 amine groups connection modification, the probe of synthesis is dissolved in 0-800pmol/150ul 500mM NaHCO
3(pH 8.4), finds optimum concn and is used for hybridization.
Some oligonucleotide 5 ' synthesize after holding and being modified by amine groups.They can be covalently bound on the Biodyne C film with negative charge.Concrete way is as follows:
(1) preparation of specific oligonucleotide
Oligonucleotide probe is synthesized by our design requirements by specialized company, and we are after variable region designs, and the sequence of probe is issued specialized company, is synthesized by them, and the present invention is by the precious biotech firm in Lanzhou synthetic oligonucleotide probe.The Taylor worm wherein adopted and Babesia sequence oligonucleotide probe and optimum concentration range are in table 1.
Table 1 Taylor worm and Babesia sequence oligonucleotide probe and optimum concn
Be the NaHCO of 8.4 with 500mM, pH
3the specific oligonucleotide that 149ul dilutes Taylor worm and Babesia is stand-by.
(2) preparation of film
BiodyneC film is cut into 14.5cm × 14.5cm size, with marking pen Marking film can take one's bearings in operation afterwards.Fresh 16% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (referred to as EDAC) is prepared with deionized water, add 10mlEDAC, hatch 10 minutes activated b iodyneC films, under room temperature, rotate culturing bottle.
Film is placed in plastic containers to shake with deionized water and washes two minutes, then put into clean trace instrument.Screw handle.
By liquid residual in suction removing hole.The oligonucleotide solution that 150ul dilutes is added the hole slot of trace instrument, wherein first does not add oligonucleotide with last hole.
Ink 2 × SSPE damping fluid is diluted in the ratio be applicable to (adopting the ratio of 1: 100 in the present invention), adds first hole and last hole.
After all samples all add, incubated at room temperature 2 minutes.
By the oligonucleotide solution in each hole slot of suction removing and first and the ink dilution liquid of last hole slot.
From trace instrument, striping is removed, then with freshly prepared 100mM NaOH with tweezers
250ml hatches 10 minutes in plastic containers, and constantly shake container makes film passivation.
Use rinsed with deionized water film.
With SDS 60 DEG C of rinsings 5 minutes of 250ml 2x SSPE/ mass ratio 0.1% in plastic containers, gentle agitation solution bottle during rinsing.
With EDTA100ml rinsing film in plastic containers that 20mM, pH are 8.0, room temperature with gentle shakes 15 minutes, namely obtains detection film of the present invention.It is preserved film until use (seal with plastics or pack with packing film and avoid film dehydration) at 4 DEG C.
Two, the detection contrast experiment of film is detected
1, the preparation of ovine Piroplasma worm merozoite
Choosing test, except spleen sheep 4, is inoculated with the blood rbc jugular vein containing Theileria luwenshuni, T.uilenbergi, Mohs Babesia and Keshen strain Babesia U sp of Liquid nitrogen storage, infects except spleen sheep.
Infection sheep after, every day intramuscular injection of dexamethasone, 4/sheep first, later 2/sheep, penetrates once every day, until Infestation rat raise till.From infection, measure the body temperature of sheep every morning, from rising from body temperature, every day coats blood sheet from auricular vein, and methyl alcohol fixes twice, after the female Sa dyeing of a Ji, with microscopy red corpuscle Infestation rat.When red corpuscle Infestation rat reaches more than 10.0%, carotid artery bloodletting, 20.0% Sodium Citrate anti-freezing, obtains blood sample to be detected.
The Separation & Purification of polypide:
(1) add 300ul blood in the centrifuge tube of 1.5ml filling 900ul BRCCellLysisSolution, incubated at room 10 minutes, hatch in process and put upside down centrifuge tube for several times, until liquid clear.
(2) centrifugal 1 minute of 13000rpm, abandons supernatant, retains visible precipitation below and about 10 ~ 20 μ l liquid, with vortex instrument vortex 20 seconds, throw out is suspended.
(3) often add 300ulCellLysisSolution in pipe, piping and druming mixing makes all cells cracking.
(4) 100ul Protein PreciptationSolution is added in cell pyrolysis liquid.
(5) vortex 20 seconds, to occurring brown precipitation particle.
(6) centrifugal 5 minutes of 13000rpm.
(7) supernatant liquor is moved in the centrifuge tube of new mark, add 300 μ l Virahols, put upside down 50 times.
(8) centrifugal 5 minutes of 13000rpm.
(9) abandon supernatant, clean paper handkerchief is inverted, remaining liquid is blotted.
(10) add 300 μ l 70% ethanol, put upside down centrifuge tube for several times with the little agglomerate of eluted dna.
(11) centrifugal 3 minutes of 13000rpm, carefully removes ethanol, thieving paper blots remaining liq.
(12) vacuum-drying is carried out with vacuum-drying instrument.
(13) 100 μ l DNAHydrationSolution are added.
(14) 4 DEG C are spent the night or 60 DEG C of incubations 1 hour, obtain DNA to be measured.
(15)-20 DEG C save backup.
2, the design of primer
Studying intensively with keen determination according to contriver, through repeatedly trial and error and design trial and error again, the clip size finally gone out at the conservative region design pair for amplification at Taylor worm and two ends, Babesia 18S rRNA gene order V4 hypervariable region is the primer of 600bp,
RLB-F(5’-acgggtaacggggaattagggttcgattccggagagggagcc-3’)，
RLB-R(biotin-5’-cgaccatactccccccagaacccaaagactttgatttctctc-3’)，
Above-mentioned downstream primer is at 5 ' end biotin labeling, the feature of above-mentioned pair of primers is respectively have 42bp length, higher than the length of general used 15-30bp, its reason uses this to detect better effects if to primer for pathogenic protozoon, and repeatability is more excellent.
3, pcr amplification
The reaction system of gene fragment pcr amplification and program:
Centrifugal 10 seconds of 12000rpm after all sample mix, is placed in PCR amplification instrument and increases according to following circulation:
Get PCR primer 1.5ul at the sepharose (containing 0.5%ug/ml ethidium bromide) of 1.0%, under the voltage of 75 volts, carry out electrophoretic analysis, observe amplification.
※ note: the present invention's damping fluid used is the Tris-HCl (pH 8.55) of 200mM, 160mM (NH
4)
2sO
4and 20mMMgCl
2
For the determination of PCT reaction system, the present inventor is after test of many times, find that the concentration of primer plays vital effect for the final result detected, in the reaction soln of 100 μ l, when the content of upstream and downstream primer is greater than 50pmol, to false positive be there will be, if when control well the concentration of primer at below 50pmol time, the accuracy that detects for pathogenic protozoon just reaches the highest.
4, detect
The oligonucleotide of biotin labeled PCR primer and the Taylor worm be fixed on Biodyne C film and Babesia is hybridized.If there is Taylor worm or Babesia, then with oligonucleotide specific effect after hatch with streptavidin-peroxidase and ECL-detection (enhanced chemiluminescence) after film inside the grid of black can see development, operation steps is as follows:
(1) prepare damping fluid below, with deionized water dilution, all damping fluids want preheating before using.(amount by a film):
250ml2×SSPE/0.1％SDS，60℃，
500ml2×SSPE/0.5％SDS，60℃，
500ml2×SSPE/0.5％SDS，42℃.
500ml2 × SSPE, room temperature.
(2) PCR primer of 20 μ l is added in 130 μ l2 × SSPE/0.1%SDS.
(3) then the PCR primer 99 DEG C of heat shocks after dilution cool for 10 minutes immediately in ice.
(4) 250ml2 × SSPE/0.1%SDS60 DEG C of rinsing film 5 minutes are used.
(5) in trace instrument according to becoming vertical direction to put into film and support air cushion with oligonucleotide.
(6) by liquid residual in the method removing trace instrument of suction.
(7) fill hole slot by the PCR primer after dilution, hybridize 10 minutes for 60 DEG C in the horizontal plane.
(8) by aspirating the sample removed in trace instrument, then with tweezers, film is taken out.
(9) with 250ml 2xSSPE/0.5%SDS 60 DEG C, 10 minutes, rinsing film twice.
(10) place film in revolving bottle, make it cool, in order to avoid next step because of peroxidase effect inactivation.
(11) add 2.5ul streptavidin peroxidase (500U/ml) and be attached to 10ml
2in × SSPE/0.5%SDS, this solution is added 42 DEG C of hatching film 45-60 minute in revolving bottle.
(12) with 2xSSPE/0.5%SDS solution 42 DEG C of rinsings in 10 minutes twice of 250ml.
(13) with 2xSSPE at room temperature 5 minutes rinsing films twice of 250ml.
(14) add 1ml immunoblotting luminol reagent A in a 5ml test tube, add the reagent B of 1ml subsequently, mix.
(15) film is placed in plastic cloth or packing film, drips the region that A, B mixed solution contains oligonucleotide and PCR primer hybridization on film, use plastic layer mulch film, plastic membrane sealing device closed film.
(16) place the film closed in exposure cassette, put an X-ray film and (give a discount to recognize direction later in the left hand corner of film) on film, expose 30 minutes.
(17) take out X-ray film and put into developing solution development 5 minutes, then use deionized water rinsing 2 minutes, to proceed in stop bath fixing 5 minutes subsequently, then use deionized water rinsing, fully wash away observations after stop bath.
(18) if the signal on film is too weak or too strong, can extend or shorten the time shutter is directly exposed to another film by film.The PCR primer of hybridizing can remove from film.A film can reuse about 15 times.
Result judges: by the 18SrRNA gene V4 hypervariable region of all worm strains of listing in pcr amplification table 1, the DNA fragmentation produced and the oligonucleotide probe be fixed on film carry out nucleic acid hybridization, oligonucleotide probe is through optics luminous function, film produces the signal of some strength, all probes only combine with their respective target sequences, different kinds, between genus and strain, there is no cross reaction, very clearly produce hybridization signal with corresponding worm kind or strain.Simultaneously, in order to detect the specificity of establishing probe, the east Taylor worm of ox and the genome of sheep and water has been selected to do feminine gender and blank respectively, result shows, east Taylor worm only hybridizes with pyriform worm general probe and Taylor worm general probe, and other probe does not have the generation of cross reaction.Each Taylor worm kind can by three nucleotide probe identifications: pyriform worm general probe (ca841-859), Taylor worm general probe (T-all811-832), and Theileria luwenshuni probe (T-l628-647) or T.uilenbergi probe (T-u678-697).Each Babesia also can by three probe identifications: pyriform worm general probe (ca841-859), this general probe of BABEI (B-all745-766), and Mohs Babesia probe (B.m466-487) or Babesia U sp probe (B.sp.Kashi637-655).
Concrete detected result is see in Fig. 1, figure: Ca is pyriform worm general probe (catch all), 1-6 road is respectively: Taylor worm general probe, Babesia general probe, Mohs Babesia probe, Babesia U sp probe, Theileria luwenshuni probe, T.uilenbergi probe, wherein 1-13 row respectively: Mohs BABEI this (Chengde strain), Mohs Babesia (Lintan strain), Mohs Babesia (Ning County's strain), Mohs Babesia (God blessings strain), Babesia U sp (Keshen strain), Theileria luwenshuni (Weiyuan strain), Theileria luwenshuni (fiber crops work as strain), Theileria luwenshuni (Ning County's strain), T.uilenbergi (Zhang Jiachuan strain), T.uilenbergi (Longde strain), east Taylor worm (Lushi's strain), sheep genomic control, water contrasts.
According to the standard positive test of setting up, through showing the detected result of the ill sheep of part: find after hybridization, all infection have the sample of Taylor worm or Babesia all can see the hybridization signal generation of one or more kind.Simultaneously, the general oligonucleotide probe (catch-all) of pyriform worm can show, if PCR primer and general probe generation hybridization signal, and do not have species specific probe to produce hybridization signal, then can be judged as a novel species or new genotypic discovery, equally, the Theileria specific probe (T-all) of design can detect the existence of all Taylor worms that sample infects, comprise: Theileria SP and different kinds, the Babesia of design belongs to the existence that specific probe (B-all) can detect all sheep Babesia kinds that sample infects.Meanwhile, four Species specific probes (B.motasi of design; B.spKashi; T.luwenshuni; T.uilenbergi) the worm kind that more detailed diagnosis animal infects or worm strain, research shows, the present invention can detect current already present all ovine Piroplasma worm worm kinds.
The present invention shows, be fixed on Biodyne C film according to the versatility primer pair of the pyriform worm 18SrRNA gene order design pyriform worm reported and ovine Piroplasma worm species specificity oligonucleotide probe, PCR method and RLB method being combined, it is a kind of special to establish, responsive diagnostic method, the strain of corresponding pyriform worm can be identified, or plant genus; Its susceptibility is apparently higher than PCR method and ELISA method.Detected by the field sample of six different areas gathered 117 parts, and the PCR method of primer amplified and ELISA method compare, the recall rate of RLB is apparently higher than other two kinds of methods, the method can detect the kind of pyriform worm and the situation of polyinfection, for the detection of piroplasmosis, Species identification and epidemiology survey provide instrument.
Adopt the present invention to put the blood examination of sheep collection in a suitable place to breed to part field, it the results are shown in Table 2
Through to adopting the sample of the inventive method test positive to carry out determined dna sequence, demonstrate the exactness of its result.Recall rate of the present invention is apparently higher than existing two kinds of technology as seen from Table 2.In addition, epidemic situation and the detected result of sample section are relevant, this further demonstrates reliability of the present invention.
RLB and PCR that six, table 2. is regional, ELISA method detected result compares.
Claims (3)
1., for detecting a diagnostic kit for Theileria luwenshuni, T.uilenbergi and ovine Piroplasma worm, comprising:
Biodyne c film, described Biodyne c film is fixed with by Theileria luwenshuni specific oligonucleotide sequences atcttctttttgatgagttg, T.uilenbergi specific oligonucleotide sequences tgcattttccgagtgttact, ovine Piroplasma worm specific oligonucleotide sequences ctgtcagaggtgaaattct, Babesia specific oligonucleotide sequences ccttggtaatggttaataggaa, sheep Babesia U sp specific oligonucleotide sequences cgggtttcgtctacttcgc, one or more specific oligonucleotide sequences selected in the group that Mohs Babesia specific oligonucleotide sequences gaatgatgccgacttaaaccct is formed,
And, pair of primers,
RLB-F(5’-acgggtaacggggaattagggttcgattccggagagggagcc-3’)，
RLB-R(biotin-5’-cgaccatactccccccagaacccaaagactttgatttctctc-3’)，
The concentration of described pair of primers is respectively 1 ~ 5pmol/ μ l, in the PCR reaction system of 100 μ l, and each comfortable below the 50pmol of content of described pair of primers.
2. diagnostic kit as claimed in claim 1, it is characterized in that, synthetic goes out described specific oligonucleotide sequences respectively, 5 ' end amine groups of each described specific oligonucleotide sequences obtained by synthetic is modified, then is covalently bound to respectively by described specific oligonucleotide sequences on the BiodyneC film with negative charge.
3. diagnostic kit as claimed in claim 1 or 2, is characterized in that,
With the DNA profiling that sheep blood to be detected extracts, use described pair of primers to carry out pcr amplification to described DNA profiling, obtain biotin labeled PCR primer,
Described biotin labeled PCR primer and the described specific oligonucleotide acid be fixed on BiodyneC film are hybridized,
After enhanced chemiluminescence is hatched, the BiodyneC film after hybridization is positioned in exposure cassette again, film is put X-ray film expose, again development and fixing process are carried out to film, whether judge in tested isolated blood containing corresponding pathogenic protozoon according to the strength signal that film produces.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510317918.3A CN105018599A (en) | 2015-06-11 | 2015-06-11 | Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510317918.3A CN105018599A (en) | 2015-06-11 | 2015-06-11 | Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018599A true CN105018599A (en) | 2015-11-04 |
Family
ID=54408897
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510317918.3A Pending CN105018599A (en) | 2015-06-11 | 2015-06-11 | Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018599A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550446A (en) * | 2009-01-07 | 2009-10-07 | 中国农业科学院兰州兽医研究所 | Detecting membrane used for detecting Theileria luwenshuni, Theileria uilenbergi and ovine Piroplasma |
| CN101597650A (en) * | 2009-06-01 | 2009-12-09 | 中国农业科学院兰州兽医研究所 | Detect detection film and the method for cattle and sheep pyriform worm in the blood tick body of Qinghai |
| CN102181556A (en) * | 2011-04-15 | 2011-09-14 | 中国农业科学院兰州兽医研究所 | Kit for detecting equine piroplasmosis and preparation method and using method thereof |
-
2015
- 2015-06-11 CN CN201510317918.3A patent/CN105018599A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550446A (en) * | 2009-01-07 | 2009-10-07 | 中国农业科学院兰州兽医研究所 | Detecting membrane used for detecting Theileria luwenshuni, Theileria uilenbergi and ovine Piroplasma |
| CN101597650A (en) * | 2009-06-01 | 2009-12-09 | 中国农业科学院兰州兽医研究所 | Detect detection film and the method for cattle and sheep pyriform worm in the blood tick body of Qinghai |
| CN102181556A (en) * | 2011-04-15 | 2011-09-14 | 中国农业科学院兰州兽医研究所 | Kit for detecting equine piroplasmosis and preparation method and using method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 牛庆丽 等: "吕氏泰勒虫和尤氏泰勒虫内转录间隔区基因序列的测定与系统进化分析", 《中国兽医科学》 * |
| 牛庆丽: "羊梨形虫核糖体RNA内转录间隔区序列的测定及反向线状印迹技术的建立", 《中国优秀硕士学位论文全文数据库》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102181556B (en) | Kit for detecting equine piroplasmosis and preparation method and using method thereof | |
| US20170131270A1 (en) | Target detection | |
| CN104789569A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104789568A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN104694668A (en) | Gene chip and detection method for detecting FMDV, VSV, SVDV, PPRV and BTV | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN101251537A (en) | Kit for testing neutralizing antibody racing ELISA in human and animal rabies | |
| CN104017909A (en) | Oligonucleotide microarray for identification of pathogens | |
| CN108085365A (en) | A kind of immuno-PCR assay method of abscisic acid | |
| CN105063760A (en) | Gene chip for identification of seven swine disease pathogens and detection method thereof | |
| CN101550446A (en) | Detecting membrane used for detecting Theileria luwenshuni, Theileria uilenbergi and ovine Piroplasma | |
| EP4308721A1 (en) | Rna separation and related techniques for determining viruses such as coronaviruses | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN101382554A (en) | Method for detecting bio bar code for bluetongue virus | |
| CN107271441A (en) | A kind of method of utilization dark field microscope direct visual perception Cryptosporidium | |
| CN105755135B (en) | A kind of No. 17 chromosome centromere probe reagent boxes of people and its preparation method and application | |
| CN101597650A (en) | Detect detection film and the method for cattle and sheep pyriform worm in the blood tick body of Qinghai | |
| CN105018599A (en) | Detection film for detecting T. luwenshuni, T. uilenbergi and sheep Piroplasmea | |
| CN104388570A (en) | Piezoelectric thin film technology-based nucleic acid single-gene mutation detection method | |
| CN114460287A (en) | Detection method and kit for neutralizing antibody | |
| CN103667508B (en) | A kind of novel isothermal loop mediation shigella nucleic acid label detection reagent | |
| CN106319091A (en) | Multiple-FIA (fluorescence immunoassay) method and kit for quickly distinguishing CDV (canine distemper virus), CPV (canine parvovirus) and RV (rabies virus) | |
| CN104789570A (en) | DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer | |
| CN105296643A (en) | Isothermal amplification detection kit and detection method for duck meat derived component nucleic acid | |
| CN105986040A (en) | Kit for HCV virus genotyping detection and SNP locus detection of IL28B, use method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151104 |
|
| RJ01 | Rejection of invention patent application after publication |