CN105018574A - Rapid fluorescence PCR detection kit for Chlamydia trachomatis - Google Patents
Rapid fluorescence PCR detection kit for Chlamydia trachomatis Download PDFInfo
- Publication number
- CN105018574A CN105018574A CN201410156165.8A CN201410156165A CN105018574A CN 105018574 A CN105018574 A CN 105018574A CN 201410156165 A CN201410156165 A CN 201410156165A CN 105018574 A CN105018574 A CN 105018574A
- Authority
- CN
- China
- Prior art keywords
- chlamydia trachomatis
- quality control
- sequence
- control product
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of in-vitro nucleic acid detection and aims to provide a rapid detection kit applicable to Chlamydia trachomatis in a clinical sample and used for assisted diagnosis of Chlamydia trachomatis. A rapid fluorescence PCR detection kit for Chlamydia trachomatis comprises a PCR liquid, a negative quality control material, a positive quality control material, a weak positive quality control material, lysate and proteinase K, wherein the PCR liquid contains TaqDNA polymase for hot starting, forward and reverse primers and SYBRGreenI pigment, and the forward and reverse primers are specific primers designed for specific sequence of Chlamydia trachomatis and are capable of specifically amplifying a target DNA sequence, so that the clinical diagnosis purpose is achieved. The kit disclosed by the invention can be used for simply and rapidly detecting the infection of Chlamydia trachomatis in the clinical sample and has the characteristics of high specificity and high sensitivity.
Description
Technical field
The invention belongs to external field of nucleic acid detection, the invention provides for detect chlamydia trachomatis in clinical sample (
chlamydia trachomatis, be called for short CT) fluorescent PCR kit, for the clinical early diagnosis of chlamydia trachomatis.
Background technology
Chlamydia trachomatis (
chlamydia trachomatis) be a class of chlamydiaceae, between virus and Rickettsiae, by bacterial filter, there is the prokaryotic microorganism in special sexual cell endoparasitism and specific life cycle.Chlamydozoan has avidity to the chrotoplast on mucous membrane especially columnar epithelial cell, therefore easily causes a binding film and urogenital system mucosa infection.
China's chlamydia trachomatis infection occupies the 3rd of sexually transmitted disease (STD) (STD), and its sickness rate has the trend increased year by year.At present, chlamydia trachomatis infection has become a serious social concern.Chlamydozoan has become modal a kind of pathogenic agent in venereal disease on the one hand, and it can occur serious persistent infection phenomenon on the other hand.One of feature of chlamydia trachomatis infection is that most of the infected does not have obvious clinical symptom, the highest have scorching and 50% the male urethra infection of the woman uterus of 70% to be asymptomatic carrier, because of no conscious sympton, these people are a high-risk Potential infection source socially.There is scholar to report, through the baby of chlamydia trachomatis Positive Mothers birth canal birth, have the probability of 50% ~ 70% to obtain choamydiae infection, after injecting chlamydia trachomatis vaccine, local specific immunity can be brought out, but its provide protection only can maintain 1 ~ 2 year simultaneously.High incidence, high constituent ratio are the basic Epidemic range of current domestic chlamydia trachomatis infection.So diagnosis clothing trachoma pathogen infection has great meaning ahead of time.
In addition, chlamydia trachomatis is the cofactor of HIV spread, and the women's generation HIV infecting CT is high compared with the women infected without CT 3 ~ 5 times, and treatment CT can reduce the propagation of HIV.
The chlamydia trachomatis detection method of hospital and feeler mechanism's routine is culture method, method of direct smear, immunological method, as immunofluorescence technique, enzyme-linked immunosorbent assay etc.Culture method accurately and reliably, but often needs 2 ~ 3 days, and culture cycle is long, and complex operation, affect by sample collection method and mode of transport etc. and usually cause the shortcomings such as positive rate is low, can not meet the paces of modern medicine quick diagnosis treatment; Method of direct smear is simple to operate, but Detection accuracy is poor, depends on subjective judgement; Although immunological method such as colloidal gold technique, enzyme-linked immunosorbent assay etc. have the advantages such as simple and efficient, there is the shortcomings such as poor specificity, sensitivity is low, false positive rate is high, and be not suitable for clinical diagnosis and make a definite diagnosis foundation, can only as first visit method.
The PCR method that developed recently gets up then has the advantages such as highly sensitive, high specificity, has been widely used in foranalysis of nucleic acids, genetics detects and clinical detection field.Especially on the basis of former regular-PCR, the real-time fluorescence PCR technology grown up, by the dynamic monitoring introducing specific probe and fluorescent signal, the whole process of the amplification of PCR primer and analysis can be completed by single tube inner sealing again, and real-time dynamic monitoring and automatic analysis result can be carried out to pcr amplification product, avoiding the process after PCR, is the molecular method quantification detection technique of a kind of advanced person.Fluorescence PCR assay has broad variety, and its quantitative manner is also different, is mainly divided into fluorescence dye embedded technology, fluorescent probe technique and self quenching fluorescence technology etc.
Summary of the invention
The object of the invention is to provide a kind of chlamydia trachomatis fluorescent PCR quick detection kit, and it is the test kit of the rapid detection being applicable to chlamydia trachomatis in clinical sample, can be used for the auxiliary diagnosis of chlamydia trachomatis infection.
For achieving the above object, the technical scheme that the present invention takes is as follows: a kind of chlamydia trachomatis fluorescent PCR quick detection kit, and test kit comprises PCR reaction solution, negative quality control product, positive quality control product, weak positive quality control product, lysate and Proteinase K Solution; The forward primer of chlamydia trachomatis specific, reverse primer and SYBR Green I dyestuff is contained in PCR reaction solution;
Forward primer sequence is: 5'-CTATACAGAATCTAATGGCGGAATG-3',
Reverse primer sequences is: 5'-TAGCAAGCAAACACTGACCTTG-3',
Lysate comprises: 5.0mM NaOH, 10.0mM Tris-HCl(pH8.0), 0.2mM EDTA (pH8.0), 1% (V/V) TritonX-100,0.5% (V/V) NP40,0.5% (V/V) Tween20;
Positive quality control product and weak positive quality control product are the plasmid pCR2.1 carriers containing inserting chlamydia trachomatis specific conserved sequence, after breeding, quantitatively dilute with sterile TE buffer after extraction purification spectrophotometric determination concentration and purity in this recombinant plasmid transformed to bacillus coli DH 5 alpha;
Negative quality control product is sterilizing deionized water.
PCR reaction solution also comprises warm start Taq archaeal dna polymerase, dATP, dTTP, dGTP, dCTP tetra-kinds of Nucleotide.
This test kit is stored in less than-20 DEG C, reduces multigelation as far as possible.
The derived sequence of above-mentioned forward primer, reverse primer is also protection scope of the present invention; described derived sequence comprises the complementary strand sequence of primer sequence, simultaneously to 5' end and 3' direction extension one to several base or can also delete a sequence obtained to several base.
What the present invention adopted is SYBR Green dyestuff embedded technology.Its principle of work is: SYBR Green I dyestuff can be combined with the ditch region of double-stranded DNA, and greatly strengthen in conjunction with its fluorescence rear, its maximum absorption is about 497nm, and emission wavelength is maximum is about 520nm.The intensity of fluorescence and the amount of DNA double chain present linear relationship, and therefore SYBR Green I dyestuff is applicable to the increase of monitoring DNA cloning product in real time very much.
Chlamydia trachomatis fluorescent PCR quick detection kit provided by the invention, can specific amplification target DNA sequence thus reach clinical diagnosis object for chlamydia trachomatis specific gene conserved sequence design Specific PCR primers.
The present invention has the following advantages compared with other detection technique existing:
The features such as 1, relative to Standard PCR technology, this product has easy and simple to handle, and result is clear, product is without detected through gel electrophoresis, and complete stopped pipe operation, effectively reduces the risk that PCR primer is polluted;
2, relative to probe method Fluorescence PCR assay, this product adopts SYBR Green dye method, cheap, significantly reduces production cost;
3, detection speed is fast, and whole experimental implementation only needs 2 ~ 3 hours, simple to operate.
In a word, test kit provided by the invention have highly sensitive, specificity good, simple to operate, fast the advantage such as to understand, stopped pipe operation simultaneously, reducing the possibility of the pollution that subsequent reactions product brings, is a kind of test kit being applicable to the rapid detection of chlamydia trachomatis in clinical sample.
Accompanying drawing explanation
Fig. 1 is the sensitivity experiment data plot of chlamydia trachomatis detection kit, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity, and S1-S7 indicated concentration is 5.0 × 10
5copies/ μ l, 5.0 × 10
4copies/ μ l, 5.0 × 10
3copies/ μ l, 5.0 × 10
2copies/ μ l, 5.0 × 10copies/ μ l, 5.0copies/ μ l, 5.0 × 10
-1the positive quality control product amplification curve of copies/ μ l, CK is negative quality control product;
Fig. 2 is the specificity experiments data plot of chlamydia trachomatis detection kit, in figure, X-coordinate cycle represents amplification cycles number, ordinate zou △ Rn represents fluorescence intensity, A represents CT positive quality control product amplification curve, B represents specificity reference material amplification curve, and specificity reference material is respectively escherichia coli, beta hemolytic streptococcus, Klebsiella pneumonia, streptococcus aureus, pseudomonas aeruginosa, Candida albicans, enterococcus faecalis and gonococcus;
Fig. 3 is the negative experimental data figure of chlamydia trachomatis detection kit, in figure, X-coordinate cycle represents amplification cycles number, ordinate zou △ Rn represents fluorescence intensity, and A represents CT positive quality control product amplification curve, and B represents the amplification curve of 20 aseptic deionization repeated sample;
Fig. 4 is the Precision Experiment data plot of chlamydia trachomatis detection kit, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity, and S2 is 10 parts of concentration is 5.0 × 10
4the positive reference material amplification curve of copies/ μ l, the positive reference material amplification curve of S6 to be 10 parts of concentration be 5.0 × 10copies/ μ l, CK represents negative quality control product;
Fig. 5 is the detectability experimental data figure of chlamydia trachomatis detection kit, in figure, X-coordinate cycle represents amplification cycles number, ordinate zou △ Rn represents fluorescence intensity, and the positive reference material amplification curve of S6 to be 20 parts of concentration be 5.0copies/ μ l, CK represents negative quality control product.
Embodiment
Test kit provided by the invention adopts SYBR Green dye method fluorescent PCR detection technique, chlamydia trachomatis characteristic sequences in rapid detection clinical sample, thus judges the existence of chlamydia trachomatis.We design multipair primer for different conserved sequence, and carry out experimental verification to it, finally have selected highly sensitive, that specificity is good pair of primers.In embodiment, unaccounted ordinary method and condition can with reference to " Molecular Cloning: A Laboratory guide " third editions or according to the step of advising in reagent manufacturer specification and condition below.
the preparation of embodiment 1 test kit
1, the Design and synthesis of test kit Auele Specific Primer
According to the online CT sequence (GenBank:CP006677.1) announced, biological software Primer Premier 5 software and Oligo 7 software is utilized to design chlamydia trachomatis PCR primer for chlamydia trachomatis conservative gene trpB fragment, and carry out sequence alignment with the online Blast of software Mega4 and NCBI, ensure often pair of primer specificity and reasonableness.Primer entrusts precious biotechnology (Dalian) company limited to synthesize, and adopt PAGE purifying, test kit Auele Specific Primer nucleotide sequence is as follows:
Forward primer: 5'-CTATACAGAATCTAATGGCGGAATG-3',
Reverse primer: 5'-TAGCAAGCAAACACTGACCTTG-3',
2, the Design & preparation of CT plasmid positive quality control product
In the peripheral sequence of above-mentioned CT primer amplified sequence, redesign pair for amplification primer, this primer amplification fragment can cover the CT primer amplified region of design completely.This peripheral primer entrusts precious biotechnology (Dalian) company limited to synthesize, and adopt PAGE purifying, this peripheral primer nucleotide sequences is as follows:
Forward primer: 5'-CTATACAGAATCTAATGGCGGAATG-3',
Reverse primer: 5'-GAGTAAATGAGTGTGTTGTTGCCC-3',
The specific nucleotide sequences of this primer amplification is adopted to be:
5'-CTATACAGAATCTAATGGCGGAATGGGAGATTCTCAAAACTCAGCAAAGTTTTTTATC
TGAACTAGATTGTATTTTGAAAAACTATGCGGGGAGACAAACTCCTCTGACTGAAGTTAAGAATTTTGCTCGAGCTATTGATGGCCCTAGAGTATTTCTTAAACGCGAAGATCTTTTGCATACAGGAGCACATAAACTGAATAATGCTCAAGGTCAGTGTTTGCTTGCTAAATATCTTGGGAAAACACGTGTTGTAGCTGAAACAGGTGCGGGACAACATGGAGTAGCAACAGCAACAGCGTGTGCTTATCTAGGATTAGATTGTGTAGTATACATGGGAGCAAAAGATGTGGAACGACAGAAACCAAATGTAGAGAAAATGCGCTTTTTAGGTGCTGAAGTCGTTTCTGTAACAAAAGGATCTTGTGGACTCAAAGATGCAGTTAATCAAGCTCTACAAGATTGGGCAACAACACACTCATTTACTC-3'486bp。
Above-mentioned peripheral primer and CT positive clinical sample DNA lysate is utilized to carry out pcr amplification, to be connected on plasmid pCR2.1 carrier after the PCR primer purifying obtained, then be transformed in bacillus coli DH 5 alpha competent cell, after blue hickie primary dcreening operation, positive bacterium colony is accredited as again through PCR, after enlarged culturing, extract positive recombinant plasmid, as the raw materials of positive quality control product after two-way DNA sequencing qualification.
Plasmid pCR2.1 carrier is obtained by commercial sources, purchased from Invitrogen company; Bacillus coli DH 5 alpha competent cell is obtained by commercial sources, purchased from TAKARA company.
3, the preparation of quality control product
Positive quality control product by positive quality control product raw materials, adopt TE damping fluid to dilute preparation; Positive quality control product adopts concentration to be 1.0 × 10
6the recombinant plasmid of copies/ μ l; Weak positive quality control product adopts 1.0 × 10
2the recombinant plasmid of copies/ μ l; Negative quality control product adopts aseptic deionized water preparation.
4, the preparation of PCR reaction solution
The configuration of primer: by centrifugal 1 minute of the primer dry powder that newly synthesizes, add appropriate aseptic deionized water (calculating according to resultant quantity), primer is dissolved into the mother liquor of 100 μMs, again the mother liquor of 100 μMs is diluted to 10 μMs of mother liquors during use.
The composition of PCR reaction solution: the system of 20 μ l is configured according to the ratio of each component of table 1.
The using method of embodiment 2 test kit
1, sample requirement
A. sample collection: autoclaved special swab, stretch into 1-2 cm on male urethral orifice or women's uterine neck mouth, rotate a circle, stop and take out after about 10 seconds, cotton swab head is put into the sample freezen protective pipe filling 1ml stroke-physiological saline solution, cut off swab from neck, make swab head immerse in salt solution, rinsing repeatedly, obtains sample rinsing liquid.
B. deposit: gained sample rinsing liquid should-20 DEG C of preservations, sample Ying Yu less than-70 DEG C preservation that cannot detect in 24 hours.Sample should establish special counter or special storehouse to preserve separately.
C. transport: adopt curling stone to add ice bag or bubble chamber and add ice bag and be sealed into row transport.
2, sample preparation
Get 500 μ l sample rinsing liquids, centrifugal 2 minutes of 10,000rpm, inhale with pipettor and abandon supernatant, retain precipitation; 50 μ l DNA cleavage liquid (guaranteeing before use to add 1 μ l Proteinase K by every 49 μ lDNA lysates) are added in above-mentioned centrifugation, vibrator vibrated after 10 seconds, in 95 DEG C of boiling water baths 10 minutes, 10, centrifugal 1 minute of 000rpm, gets supernatant 2 μ l for detecting; If sample split product did not use the same day, suggestion was kept at-20 DEG C.
3, pattern detection
First after PCR reaction solution is put thaw at RT mixing by PCR area in preparation, count n(sample number=number of samples+3 per sample by every pipe 18 μ l) carry out packing; Then in each reaction tubes that PCR reaction solution is housed, add 2 μ l samples respectively successively in sample process district, sample comprises sample, negative quality control product, positive quality control product, weak positive quality control product, makes the total system of reaction tubes reach 20 μ l,
Cover tightly pipe lid, mixing, low-speed centrifugal several seconds; Reaction tubes, to detection zone, is pressed negative control, positive control and sample order by shift reaction pipe, is placed in successively on fluorescent PCR detector (ABI StepOne Plus or ABI 7300), carries out pcr amplification reaction immediately.
4, the programming of fluorescent PCR instrument is carried out by table 2
5, reference value (term of reference)
Generally being as the criterion with instrument default value, can suitably adjusting when there are the Special Circumstances such as the noise of a few sample amplification curve is too large.ABI 7300 or the setting of ABI StepOne (Plus) baseline: the fluorescent signal getting 3-15 circulation.Threshold setting: make threshold line exceed the vertex of the amplification curve (random noise line) of normal negative quality control product, and CT value is Undet.
6, quality control standard
A) negative quality control product: CT value=40 or be shown as " Undet ", is judged as feminine gender;
B) positive quality control product: 16≤CT value≤25, and have good amplification curve, be judged as the positive;
C) weak positive quality control product: 30≤CT value≤37, and have good amplification curve, be judged as the positive.
Meet above three conditions, judgment experiment is " effectively " simultaneously.
7, result judges
(1), the CT=40 of sample or be shown as " Undet ", be judged as feminine gender;
(2), CT value≤37 of sample, be judged as the positive;
(3) if 37<CT is value <40, advise re-starting experiment to sample to be tested, again after experiment, if CT value≤37, be judged as the positive, otherwise be negative.
The assessment of performance of embodiment 3 test kit
1, sensitivity experiment
CT sensitivity reference product (5.0 × 10
5copies/ μ l), be made up of the plasmid containing CT object fragment, adopt TE damping fluid, the gradient dilution that above-mentioned sensitivity reference product carries out 10 times is obtained following gradient solution: S1 is 5.0 × 10
5copies/ μ l, S2 are 5.0 × 10
4copies/ μ l, S3 are 5.0 × 10
3copies/ μ l, S4 are 5.0 × 10
2copies/ μ l, S5 are 5.0 × 10copies/ μ l, S6 be 5.0copies/ μ l, S7 is 5.0 × 10
-1copies/ μ l is as sensitivity reference product, and use sensitivity reference product to detect, detection limit is 5.0copies/ μ l, i.e. 10copies/ reaction, experimental result is shown in Fig. 1.Fig. 1 shows: the CT sensitivity reference product of this test kit is 1.0 × 10
6have good linear relationship between copies/ μ l to 1.0 × 10copies/ μ l, the detection limit of this test kit is 5.0copies/ μ l simultaneously, i.e. 10 copies/reaction.
2, specificity experiments
Select to there is the common causative of identical infection site as specificity quality control product with CT, what adopt is standard Quality Control bacterium and the deactivation positive clinical sample of deactivation, standard bacteria is purchased in Chinese medicine bacterium preservation administrative center (CMCC), eight species specificity quality control products are in table 3, this eight species specificity quality control product is detected, the detected result of all specificity quality control products is feminine gender, and experimental result is shown in Fig. 2.Fig. 2 shows: this eight species specificity reference material does not all have typically " S " type amplification curve, illustrates that this test kit specificity is good.
3, negative experiment
" nucleic acid amplification detects survey test kit " regulation: the sample of detection manufacturing enterprise production concentration value 20 times, at least 17 times detected result meets the requirements, and requires will to be all negative for feminine gender simultaneously.Therefore prepared 20 parts of aseptic deionized waters to detect as negative reference product, result shows to be all negative, and experimental result is shown in Fig. 3.Fig. 3 shows: this test kit feminine gender experiment is good, and non-false positive increases.
4, Precision Experiment
" nucleic acid amplification detects survey test kit " regulation: each duplicate detection of sample of at least high and low 2 concentration levels of use 10 times, calculates C
tthe value variation coefficient (CV, %), the variation coefficient (CV, %)≤5%.
The concentration of two the gradient plasmid templates adopted is respectively S2:5.0 × 10
4copies/ μ l, S5:5.0 × 10copies/ μ l.Each repetition 10 samples, the concrete test kit specification sheets that adopts operates, and the mode adopting template to add separately respectively adds 2 μ l.Variation coefficient Jun≤5% of result two groups of data, experimental result is shown in Fig. 4.Fig. 4 shows: the precision of this test kit meets the requirement of " nucleic acid amplification detects survey test kit ".
5, detectability experiment
Show according to sensitivity experiment result, this test kit can detect that 10copies/ reacts, therefore concentration is adopted to be that the plasmid reference product S6 of 5.0copies/ μ l is as sample, arrange 20 parallel, operating process to specifications detects, and result shows that 19 parallel results are the positive, meets detectability requirement, therefore the detectability of this test kit is decided to be 10copies/ reaction, and experimental result is shown in Fig. 5.Fig. 5 shows: the precision of this test kit detects and is limited to 10 copies/reaction.
Claims (5)
1. a chlamydia trachomatis fluorescent PCR quick detection kit, is characterized in that: test kit comprises PCR reaction solution, negative quality control product, positive quality control product, weak positive quality control product, lysate and Proteinase K Solution; The forward primer of chlamydia trachomatis specific, reverse primer and SYBR Green I dyestuff is contained in described PCR reaction solution;
Forward primer sequence is: 5'-CTATACAGAATCTAATGGCGGAATG-3',
Reverse primer sequences is: 5'-TAGCAAGCAAACACTGACCTTG-3',
Described lysate comprises: 5.0mM NaOH, 10.0mM Tris-HCl(pH8.0), 0.2mM EDTA (pH8.0), 1% (V/V) TritonX-100,0.5% (V/V) NP40,0.5% (V/V) Tween20;
Described positive quality control product and described weak positive quality control product are the plasmid pCR2.1 carriers containing inserting chlamydia trachomatis specific conserved sequence, after breeding, quantitatively dilute with sterile TE buffer after extraction purification spectrophotometric determination concentration and purity in this recombinant plasmid transformed to bacillus coli DH 5 alpha; Described negative quality control product is sterilizing deionized water.
2. a kind of chlamydia trachomatis fluorescent PCR quick detection kit as claimed in claim 1, is characterized in that: described PCR reaction solution also comprises warm start Taq DNA polymerase, dATP, dTTP, dGTP, dCTP tetra-kinds of Nucleotide.
3. a kind of chlamydia trachomatis fluorescent PCR quick detection kit as claimed in claim 1 or 2, is characterized in that: the pCR2.1 vector plasmid of described insertion chlamydia trachomatis distinguished sequence, and the specific sequence inserted is:
5'-CTATACAGAATCTAATGGCGGAATGGGAGATTCTCAAAACTCAGCAAAGTTTTTTATCTGAACTAGATTGTATTTTGAAAAACTATGCGGGGAGACAAACTCCTCTGACTGAAGTTAAGAATTTTGCTCGAGCTATTGATGGCCCTAGAGTATTTCTTAAACGCGAAGATCTTTTGCATACAGGAGCACATAAACTGAATAATGCTCAAGGTCAGTGTTTGCTTGCTAAATATCTTGGGAAAACACGTGTTGTAGCTGAAACAGGTGCGGGACAACATGGAGTAGCAACAGCAACAGCGTGTGCTTATCTAGGATTAGATTGTGTAGTATACATGGGAGCAAAAGATGTGGAACGACAGAAACCAAATGTAGAGAAAATGCGCTTTTTAGGTGCTGAAGTCGTTTCTGTAACAAAAGGATCTTGTGGACTCAAAGATGCAGTTAATCAAGCTCTACAAGATTGGGCAACAACACACTCATTTACTC-3' 486bp。
4. a kind of chlamydia trachomatis fluorescent PCR quick detection kit as claimed in claim 3, is characterized in that: described forward primer sequence, reverse primer sequences also comprise its derived sequence.
5. a kind of chlamydia trachomatis fluorescent PCR quick detection kit as claimed in claim 4, it is characterized in that: described derived sequence comprises the complementary strand sequence of primer sequence, simultaneously to 5' end and 3' direction extension one to several base or a sequence obtained to several base can also be deleted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410156165.8A CN105018574A (en) | 2014-04-17 | 2014-04-17 | Rapid fluorescence PCR detection kit for Chlamydia trachomatis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410156165.8A CN105018574A (en) | 2014-04-17 | 2014-04-17 | Rapid fluorescence PCR detection kit for Chlamydia trachomatis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018574A true CN105018574A (en) | 2015-11-04 |
Family
ID=54408873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410156165.8A Pending CN105018574A (en) | 2014-04-17 | 2014-04-17 | Rapid fluorescence PCR detection kit for Chlamydia trachomatis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018574A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157820A (en) * | 2019-04-28 | 2019-08-23 | 深圳市国赛生物技术有限公司 | A kind of primer, probe and kit detecting chlamydia trachomatis |
-
2014
- 2014-04-17 CN CN201410156165.8A patent/CN105018574A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110157820A (en) * | 2019-04-28 | 2019-08-23 | 深圳市国赛生物技术有限公司 | A kind of primer, probe and kit detecting chlamydia trachomatis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CN103409509B (en) | Group B streptococcus fluorescence PCR detection kit | |
| Loens et al. | Development of real-time multiplex nucleic acid sequence-based amplification for detection of Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella spp. in respiratory specimens | |
| Hou et al. | Characterisation of the bacterial community in expressed prostatic secretions from patients with chronic prostatitis/chronic pelvic pain syndrome and infertile men: a preliminary investigation | |
| CN104328212B (en) | The primer sets of ring mediated isothermal amplification method detection B group streptococcus and test kit | |
| CN102191321B (en) | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification | |
| CN105441589A (en) | Human parainfluenza virus I, II, III, and IV-type quadruple-PCR detection kit, and detection method thereof | |
| Draz et al. | Comparison of broad range 16S rDNA PCR to conventional blood culture for diagnosis of sepsis in the newborn | |
| CN101591707A (en) | A kind of Neisseria gonorrhea nucleic acid detection kit that utilizes the RNA constant-temperature amplification | |
| Sen et al. | Development of an internal control for evaluation and standardization of a quantitative PCR assay for detection of Helicobacter pylori in drinking water | |
| CN105018573A (en) | Fluorescent quantitative PCR detection kit for chlamydia trachomatis | |
| CN103160574A (en) | Klebsiella pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) | |
| CN105018571A (en) | Neisseria gonorrhoeae real-time fluorescent PCR rapid detection kit | |
| TWI362419B (en) | Nucleic acid detection | |
| CN102329866B (en) | PCR (polymerase chain reaction) fluorescence quantitative rapid test kit and method for chlamydia trachomatis | |
| CN105018574A (en) | Rapid fluorescence PCR detection kit for Chlamydia trachomatis | |
| CN102409098B (en) | Ureaplasma urealyticum PCR (Polymerase Chain Reaction) detection kit and detection method thereof | |
| CN102876774A (en) | Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid | |
| CN110468223B (en) | Primer, probe, kit and method for detecting nucleic acid of mycoplasma pneumoniae and bauxiella based on dUTP/UNG method | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN102094072A (en) | Fluorescent polymerase chain reaction (PCR) kit for detecting ureaplasma urealyticum infection by SYBR Green method | |
| CN104388558A (en) | Molecular beacon probe and detection method for quickly detecting streptococcus agalactiae | |
| CN103805702B (en) | A kind of for detecting the primer of ancylostome nucleic acid, fluorescent probe and test kit | |
| CN107058619A (en) | Bovine Respiratory Syncytial virus nano PCR detection kits and preparation method thereof | |
| Izumikawa et al. | Evaluation of a rapid immunochromatographic ODK0501 assay for detecting Streptococcus pneumoniae antigen in sputum samples from patients with lower respiratory tract infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151104 |
|
| WD01 | Invention patent application deemed withdrawn after publication |