CN105018573A - Fluorescent quantitative PCR detection kit for chlamydia trachomatis - Google Patents
Fluorescent quantitative PCR detection kit for chlamydia trachomatis Download PDFInfo
- Publication number
- CN105018573A CN105018573A CN201410156164.3A CN201410156164A CN105018573A CN 105018573 A CN105018573 A CN 105018573A CN 201410156164 A CN201410156164 A CN 201410156164A CN 105018573 A CN105018573 A CN 105018573A
- Authority
- CN
- China
- Prior art keywords
- chlamydia trachomatis
- quality control
- copies
- sequence
- control product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a fluorescent quantitative PCR detection kit for chlamydia trachomatis in clinic samples, used for assisted diagnosis of chlamydia trachomatis. The kit comprises a PCR solution, a DNA polymerase solution, positive quality control, weakly positive quality control, negative quality control, positive quantitative reference, lysate and protease K, wherein the PCR solution contains forward and reverse primers and the fluorescence probe are specific primers and probe designed for the specific sequence of chlamydia trachomatis and are capable of amplifying a target DNA sequence specifically so as to conveniently and quickly detect chlamydia trachomatis infection in clinic samples. The kit has the characteristics of high specificity and high sensitivity.
Description
Technical field
The invention belongs to external field of nucleic acid detection, the invention provides for detect chlamydia trachomatis in clinical sample (
chlamydia trachomatis, be called for short CT) PCR kit for fluorescence quantitative, for the clinical early diagnosis of chlamydia trachomatis.
Background technology
Chlamydia trachomatis (
chlamydia trachomatis, CT) and be a class of chlamydiaceae, between virus and Rickettsiae, by bacterial filter, there is the prokaryotic microorganism in special sexual cell endoparasitism and specific life cycle.Chlamydozoan is to the chrotoplast on mucous membrane, and especially columnar epithelial cell has avidity, therefore easily causes a binding film and urogenital system mucosa infection.
China's chlamydia trachomatis infection occupies the 3rd of sexually transmitted disease (STD) (STD), and its sickness rate has the trend increased year by year.At present, chlamydia trachomatis infection has become a serious social concern.Chlamydozoan has become modal a kind of pathogenic agent in venereal disease on the one hand, and it can occur serious persistent infection phenomenon on the other hand.One of feature of chlamydia trachomatis infection is that most of the infected does not have obvious clinical symptom, the highest have scorching and 50% the male urethra infection of the woman uterus of 70% to be asymptomatic carrier, because of no conscious sympton, these people are a high-risk Potential infection source socially.There is scholar to report, through the baby of chlamydozoan Positive Mothers birth canal birth, have the chance of 50%-70% to obtain choamydiae infection, after injecting chlamydia trachomatis vaccine, local specific immunity can be brought out, but its provide protection only can maintain 1-2 simultaneously.High incidence, high constituent ratio are the basic Epidemic range of current domestic chlamydia trachomatis infection.So diagnosis of chlamydial infection has great meaning ahead of time.
In addition, chlamydia trachomatis is the cofactor of HIV spread, and the women's generation HIV infecting CT is high compared with the women infected without CT 3 ~ 5 times, and treatment CT can reduce the propagation of HIV.
The chlamydia trachomatis detection method of hospital and feeler mechanism's routine is culture method, method of direct smear, immunological method, as immunofluorescence technique, enzyme-linked immunosorbent assay etc.Culture method accurately and reliably, but often needs 2-3 days, and culture cycle is long, and complex operation, affect by sample collection method and mode of transport etc. and usually cause the shortcomings such as positive rate is low, can not meet the paces of modern medicine quick diagnosis treatment; Method of direct smear is simple to operate, but Detection accuracy is poor, depends on subjective judgement; Although immunological method such as colloidal gold technique, enzyme-linked immunosorbent assay etc. have the advantages such as simple and efficient, there is the shortcomings such as poor specificity, sensitivity is low, false positive rate is high, and be not suitable for clinical diagnosis and make a definite diagnosis foundation, can only as first visit instrument.
The PCR method that developed recently gets up then has the advantages such as highly sensitive, high specificity, has been widely used in foranalysis of nucleic acids, genetics detects and clinical detection field.Especially on the basis of former regular-PCR, the real-time fluorescence PCR technology grown up, by the dynamic monitoring introducing specific probe and fluorescent signal, the whole process of the amplification of PCR primer and analysis can be completed by single tube inner sealing again, and real-time dynamic monitoring and automatic analysis result can be carried out to pcr amplification product, avoiding the process after PCR, is the molecular method quantification detection technique of a kind of advanced person.Fluorescence PCR assay has broad variety, and its quantitative manner is also different, is mainly divided into fluorescence dye embedded technology, fluorescent probe technique and self quenching fluorescence technology etc.
Summary of the invention
The object of the invention is to provide the fluorescent quantificationally PCR detecting kit of a kind of highly sensitive, specificity good, simple to operate, detection speed is fast chlamydia trachomatis, for the auxiliary diagnosis of chlamydia trachomatis infection in clinical sample.
For achieving the above object, technical scheme provided by the invention is as follows: the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis, test kit comprises PCR reaction solution, archaeal dna polymerase liquid, negative quality control product, positive quality control product, weak positive quality control product, positive quantitatively reference product, lysate and Proteinase K Solution, includes the forward primer of chlamydia trachomatis specific, reverse primer and fluorescent probe in PCR reaction solution;
Forward primer sequence: 5'-GCATGAGTCAGGACGAGTT-3',
Reverse primer sequences: 5'-CGAAACTAAATGTGCGAGAGC-3',
Fluorescent probe sequence: 5'-FAM-TTAGCCACCGATGAAGACCCGTTAC-TAMRA-3',
Lysate is 5.0mM NaOH, 10.0mM Tris-HCl(pH8.0), 0.2mM EDTA (pH8.0), 1% (V/V) TritonX-100,0.5% (V/V) NP40,0.5% (V/V) Tween20;
Archaeal dna polymerase liquid is the Taq DNA polysaccharase and the UDG enzyme that include warm start;
Positive quality control product and weak positive quality control product are the plasmid pCR2.1 carrier containing inserting chlamydia trachomatis specific conserved sequence, quantitatively dilute with sterile TE buffer after extraction purification spectrophotometric determination concentration and purity after propagation in this recombinant plasmid transformed to bacillus coli DH 5 alpha, wherein the concentration of CT positive quality control product is 5.0 × 10
7the concentration of the weak positive quality control product of copies/ml, CT is 5.0 × 10
3copies/ml;
CT is positive, and quantitatively reference product is the plasmid pCR2.1 carrier containing inserting chlamydia trachomatis specific conserved sequence, and concentration is respectively P1:5.0 × 10
6copies/ml, P2:5.0 × 10
5copies/ml, P3:5.0 × 10
4copies/ml, P4:5.0 × 10
3copies/ml; Negative quality control product is sterilizing deionized water.
PCR reaction solution also comprises: dATP, dUTP, dGTP, dCTP tetra-kinds of Nucleotide and the damping fluid containing magnesium ion.
This test kit is stored in-20 DEG C and following, reduces multigelation as far as possible.
The derived sequence of the forward primer that PCR reaction solution comprises, reverse primer and probe is also protection scope of the present invention, and described derived sequence is to 5' end and 3' direction extension one to several base or deletes a sequence obtained to several base.
Described probe sequence 5' end mark fluorescent reporter group FAM can be replaced the one in TET, JOE, HEX or VIC; The fluorescent quenching group TAMRA of described probe sequence 3' end mark can be replaced the one in DABCYL or BHQ.
What the present invention adopted is Taqman probe method technology, this technology is relative to fluorescence dye embedded technology and self quenching fluorescence technology, specificity is stronger, simultaneously not by the impact of primer dimer, due to the step of not Water demand solubility curve, detection time is shorter, is therefore more suitable for Clinical practice.
The present invention is directed to chlamydia trachomatis specific gene conserved sequence design Specific PCR primers, can specific amplification target DNA sequence thus reach clinical diagnosis object, can detect chlamydia trachomatis infection in clinical sample simply and rapidly, the present invention's major advantage compared with other detection technique is as follows:
The features such as 1, relative to Standard PCR technology, the present invention has easy and simple to handle, and result is clear, product is without detected through gel electrophoresis, and complete stopped pipe operation, effectively reduces the risk that PCR primer is polluted,
2, introduce UDG enzyme antipollution system simultaneously, effectively can reduce Aerosol Pollution and the false positive issue that causes that product formed,
3, detection speed is fast, and whole experimental implementation only needs 2 ~ 3 hours, simple to operate.
In a word, test kit provided by the invention have highly sensitive, specificity good, simple to operate and the feature such as to understand fast, be a kind of test kit being applicable to chlamydia trachomatis rapid detection in clinical sample.
Accompanying drawing explanation
Fig. 1 is the Linear Experiment data plot of chlamydia trachomatis immue quantitative detection reagent box, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity; S1-S7 respectively indicated concentration is 5.0 × 10
8copies/ml, 5.0 × 10
7copies/ml, 5.0 × 10
6copies/ml, 5.0 × 10
5copies/ml, 5.0 × 10
4copies/ml, 5.0 × 10
3copies/ml, 5.0 × 10
2the positive quality control product amplification curve of copies/ml, each 3 repeating datas; CK is negative quality control product;
Fig. 2 is this kit standard curve synoptic diagram according to Linear Experiment data fitting, and in figure, X-coordinate lg plasmid concentration represents the logarithmic value of positive reference material concentration, and ordinate zou CT value represents amplification cycles number;
Fig. 3 is the specificity experiments data plot of chlamydia trachomatis immue quantitative detection reagent box, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity; A represents CT positive quality control product amplification curve, B represents specificity reference material amplification curve, and specificity reference material is respectively escherichia coli, beta hemolytic streptococcus, Klebsiella pneumonia, streptococcus aureus, pseudomonas aeruginosa, Candida albicans, enterococcus faecalis and gonococcus;
Fig. 4 is the negative experimental data of chlamydia trachomatis immue quantitative detection reagent box.In figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity, and A represents CT positive quality control product amplification curve, and B represents the amplification curve of 25 aseptic deionized water repeated sample;
Fig. 5 is the Precision Experiment data plot of chlamydia trachomatis immue quantitative detection reagent box, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity, and S2 is 10 parts of concentration is 5.0 × 10
7the positive reference material amplification curve of copies/ml, S6 is 10 parts of concentration is 5.0 × 10
3the positive reference material amplification curve of copies/ml, CK represents negative quality control product;
Fig. 6 is the detectability experimental data figure of chlamydia trachomatis immue quantitative detection reagent box, and in figure, X-coordinate cycle represents amplification cycles number, and ordinate zou △ Rn represents fluorescence intensity, and S6 is 25 parts of concentration is 5.0 × 10
3the positive reference material amplification curve of copies/ml, CK represents negative quality control product.
Embodiment
This test kit adopts Taqman probe method fluorescence quantitative PCR detection technique, chlamydia trachomatis characteristic sequences in rapid detection clinical sample, thus judges the existence of chlamydia trachomatis.We design multipair primer and probe for different conserved sequence, and carry out experimental verification to it, finally have selected highly sensitive, that specificity is good pair of primers and probe.In embodiment, unaccounted ordinary method and condition can with reference to " Molecular Cloning: A Laboratory guide " third editions or according to the step of advising in reagent manufacturer specification and condition below.
the preparation of embodiment 1 test kit
1,the Design and synthesis of test kit Auele Specific Primer
According to the online CT sequence (GenBank:CP006677.1) announced, biological software Primer Premier 5 software and Oligo 7 software is utilized to design chlamydia trachomatis PCR primer for chlamydia trachomatis conservative gene trpB fragment, and carry out sequence alignment with the online Blast of software Mega4 and NCBI, ensure often pair of primer specificity and reasonableness.Primer entrusts precious biotechnology (Dalian) company limited to synthesize, and adopt PAGE purifying, test kit Auele Specific Primer nucleotide sequence is as follows:
Forward primer: 5'-GCATGAGTCAGGACGAGTT-3',
Reverse primer: 5'-CGAAACTAAATGTGCGAGAGC-3',
Fluorescent probe: 5'-FAM-TTAGCCACCGATGAAGACCCGTTAC-TAMRA-3',
2, the Design & preparation of CT plasmid positive quality control product
In the peripheral sequence of above-mentioned CT primer amplified sequence, redesign pair for amplification primer, this primer amplification fragment can cover the CT primer amplified region of design completely.This peripheral primer entrusts precious biotechnology (Dalian) company limited to synthesize, and adopt PAGE purifying, this peripheral primer nucleotide sequences is as follows:
Forward primer: 5'-AGGTGGCTCCAACGCTAT-3',
Reverse primer: 5'-TCTGTTTCTGCGGATGATTT-3',
The specific nucleotide sequences of this primer amplification is adopted to be:
5'-AGGTGGCTCCAACGCTATTGGATTTTTCCATCATTTTATCCCGAATCCAAAAGTCCAATTAATTGGAGTGGAAGGGGGAGGACTGGGCATTTCTTCAGGAAAACATGCAGCACGTTTTGCAACAGGGCGACCTGGAGTATTCCACGGATTTTATTCGTATCTTCTTCAAGATGACGATGGACAAGTATTACAAACTCACTCCATTTCCGCTGGATTAGATTATCCTTCAGTTGGGCCAGATCATGCCGAAATGCATGAGTCAGGACGAGTTTTTTATACATTAGCCACCGATGAAGACCCGTTACGAGCTTTTTTCCTGCTTACTAGAAACGAGGGGATTATTCCTGCATTGGAGTCTTCACATGCTCTCGCACATTTAGTTTCGATTGCTCCTTCTCTACCAAAGGAACAAATCGTCATCGTTAACTTATCTGGAAGAGGTGATAAGGATCTTCCACAAATCATCCGCAGAAACAGA -3' 478bp。
Above-mentioned peripheral primer and CT positive clinical sample DNA lysate is utilized to carry out pcr amplification, to be connected on plasmid pCR2.1 carrier after the PCR primer purifying obtained, then be transformed in bacillus coli DH 5 alpha competent cell, after blue hickie primary dcreening operation, positive bacterium colony is accredited as again through PCR, after enlarged culturing, extract positive recombinant plasmid, as the raw material preparing positive quality control product and the quantitative reference product of the positive after two-way DNA sequencing qualification.
Plasmid pCR2.1 carrier is obtained by commercial sources, purchased from Invitrogen company; Bacillus coli DH 5 alpha competent cell is obtained by commercial sources, purchased from TAKARA company.
3, the preparation of quality control product
The raw material of preparation positive quality control product adopts TE damping fluid 10 times of gradient dilutions after measuring concentration and purity, preparation positive quality control product and weak positive quality control product, and positive quality control product adopts concentration to be 5.0 × 10
7the recombinant plasmid of copies/ml; Weak positive quality control product adopts 5.0 × 10
3the recombinant plasmid of copies/ml; Negative quality control product adopts aseptic deionized water preparation.
The raw material of the positive quantitatively reference product of preparation adopts TE damping fluid 10 times of gradient dilutions after measuring concentration and purity, and the positive quantitatively reference product of preparation, positive quantitatively reference product concentration is respectively P1:5.0 × 10
6copies/ml, P2:5.0 × 10
5copies/ml, P3:5.0 × 10
4copies/ml, P4:5.0 × 10
3copies/ml.
4, the preparation of PCR reaction solution
The configuration of primer and probe: by centrifugal 1 minute of the primer dry powder that newly synthesizes, add appropriate aseptic deionized water (calculating according to resultant quantity), primer is dissolved into the mother liquor of 100 μMs, again the mother liquor of 100 μMs is diluted to 10 μMs of mother liquors during use.Probe mark has fluorophor, therefore needs to keep in Dark Place.
The composition of PCR reaction solution: the ratio of each component of system reference table 1 of 20 μ l is configured.
5, the preparation of archaeal dna polymerase liquid
By the warm start Taq archaeal dna polymerase (2.5U/ μ l) bought and UDG enzyme (5U/ μ l) according to 10:1 ~ 20:1(volume ratio) mix, carry out mark, preserve in-20 DEG C and following refrigerator.
The using method of embodiment 2 test kit
1, sample requirement
A. sample collection: autoclaved special swab, stretch into 1-2 cm on male urethral orifice or women's uterine neck mouth, rotate a circle, stop and take out after about 10 seconds, cotton swab head is put into the sample freezen protective pipe filling 1 ml stroke-physiological saline solution, cut off swab from neck, swab head is made to immerse in salt solution, rinsing repeatedly, obtains sample rinsing liquid
B. deposit: sample rinsing liquid should be preserved below-20 DEG C, sample Ying Yu less than-70 DEG C preservation that cannot detect in three months; Sample should establish special counter or special storehouse to preserve separately,
C. transport: adopt curling stone to add ice bag or bubble chamber and add ice bag and be sealed into row transport,
2, sample preparation and sample process district
Get 500 μ l sample rinsing liquids, centrifugal 2 minutes of 10,000 rpm, inhale with pipettor and abandon supernatant, retain precipitation; ?
50 μ l DNA cleavage liquid (guaranteeing before use to add 1 μ l Proteinase K by every 49 μ l DNA cleavage liquid) are added in above-mentioned centrifugation, after vibrator vibrates 10 seconds, in 95 DEG C of boiling water baths 10 minutes, 10,000 rpm got supernatant 2ul for centrifugal 1 minute for detecting; If sample split product did not use the same day, suggestion was kept at less than-20 DEG C.
3, pattern detection
First after PCR reaction solution is put thaw at RT mixing by PCR area in preparation, n × 17.8 μ l PCR reaction solution is drawn according to response sample pipe number n (sample number=number of samples+3), n × 0.2 μ l archaeal dna polymerase liquid, join a centrifuge tube and shake mixing, after brief centrifugation, be sub-packed in n PCR reaction tubes, often pipe 18 μ l, sample application zone is transferred to after lid upper tube cap, then in each PCR reaction tubes, 2 μ l samples are added successively in sample process district, sample comprises sample, positive quality control product, weak positive quality control product, positive quantitatively reference product and negative quality control product, total system is made to reach 20 μ l, cover tightly pipe lid, mixing, the low-speed centrifugal several seconds, shift reaction pipe is to detection zone, reaction tubes is pressed the order of sample, positive quality control product, weak positive quality control product, positive quantitatively reference product and negative quality control product, be placed in successively on fluorescent PCR detector (ABI StepOne Plus), carry out PCR amplified reaction immediately.
4, the programming of fluorescent PCR instrument is carried out according to table 2
5, reference value (term of reference)
Generally being as the criterion with instrument default value, can suitably adjusting when there are the Special Circumstances such as the noise of a few sample amplification curve is too large.ABI 7300 or the setting of ABI StepOne (Plus) baseline: the fluorescent signal getting 3-15 circulation.Threshold setting: make threshold line exceed the vertex of the amplification curve (random noise line) of normal negative quality control product, and CT value is Undet.
6, quality control standard
A) negative quality control product: CT value=40 or be shown as " Undet ", is judged as feminine gender,
B) positive quality control product: 16≤CT value≤25, and have good amplification curve, be judged as the positive.Qualitative reference value is 5 × 10
6copies/ml ~ 5 × 10
7copies/ml,
C) weak positive quality control product: 30≤CT value≤37, and have good amplification curve, be judged as the positive.Qualitative reference value is 5 × 10
2copies/ml ~ 5 × 10
3copies/ml.
Meet above three conditions, judgment experiment is " effectively " simultaneously.
7, result judges
(1) sample CT=40 or be shown as " Undet ", be judged as feminine gender, or interpretation is the amount that CT content in sample is less than detectability;
(2) pattern detection result: sample has good amplification curve, 5.0 × 10
3copies/ml≤DNA carrying capacity≤5.0 × 10
8during copies/ml, report by actual detection limit, or CT≤37, interpretation is positive;
(3) pattern detection result: sample has good amplification curve, DNA carrying capacity > 5.0 × 10
8copies/ml, copy number is only for reference, report > 5.0 × 10
8copies/ml or interpretation are positive;
(4) pattern detection result: sample has good amplification curve, DNA carrying capacity < 5.0 × 10
3during copies/ml, suggestion detects again, if the result obtained is still DNA carrying capacity < 5.0 × 10
3during copies/ml, copy number is only for reference, report < 5.0 × 10
3copies/ml; During 37≤CT value < 40, suggestion detects again, if CT value≤37, is judged as the positive, otherwise is negative.
The assessment of performance of embodiment 2 test kit
1, Linear Experiment
See figures.1.and.2: CT sensitivity reference product (5.0 × 10
8copies/ml), be made up of the plasmid containing CT object fragment, the gradient dilution adopting TE damping fluid above-mentioned sensitivity reference product to be carried out 10 times obtains following gradient solution S1:5.0 × 10
8copies/ml, S2:5.0 × 10
7copies/ml, S3:5.0 × 10
6copies/ml, S4:5.0 × 10
5copies/ml, S5:5.0 × 10
4copies/ml, S6:5.0 × 10
3copies/ml, S7:5.0 × 10
2copies/ml, as linear reference product, uses linear reference product to detect, and detection limit is 5.0 × 10
3copies/ml, i.e. 10 copies/ reactions; Fig. 1 illustrate this test kit 1.0 × 10
9copies/ml to 1.0 × 10
4cT sensitivity reference product between copies/ml has good linear relationship, shows that the detection limit of this test kit is 5.0 × 10 simultaneously
3copies/ml, i.e. 10 copies/reaction; Fig. 2 illustrates that the linear equation of this test kit matching is: Y=-3.2943x+40.038, coefficient R
2=0.9993, wherein Y represents Ct value, and x represents the logarithmic value of positive reference material.
2, specificity experiments
Select to there is the common causative of identical infection site as specificity quality control product with CT, what adopt is standard Quality Control bacterium and the deactivation positive clinical sample of deactivation, standard bacteria is purchased in Chinese medicine bacterium preservation administrative center (CMCC), eight species specificity quality control products are in table 3, this eight species specificity quality control product is detected, the detected result of all specificity quality control products is feminine gender, and experimental result is see Fig. 3.Fig. 3 obviously finds out: this eight species specificity reference material does not all have typically " S " type amplification curve, illustrates that this test kit specificity is good.
3, negative experiment
" nucleic acid amplification detects survey test kit " regulation: the sample of detection manufacturing enterprise production concentration value 25 times, at least 22 times detected result meets the requirements, and requires will to be all negative for feminine gender simultaneously.Therefore, negative experiment has been prepared 25 parts of aseptic deionized waters and has been detected as negative reference product, and result shows to be all negative, and experimental result is see Fig. 4.Fig. 4 illustrates that this test kit feminine gender experiment is good, non-false positive.
4, Precision Experiment
" nucleic acid amplification detects survey test kit " regulation: each duplicate detection of sample of at least high and low 2 concentration levels of use 10 times, calculates C
tthe value variation coefficient (CV, %), the variation coefficient (CV, %)≤5%.The concentration of two gradient plasmid templates that this Precision Experiment adopts is respectively S2:5.0 × 10
7copies/ml, S6:5.0 × 10
3copies/ml, each repetition 10 samples, the concrete test kit specification sheets that adopts operates, and the mode adopting template to add separately respectively adds 2 μ l, variation coefficient Jun≤5% of result two groups of data, and experimental result is with reference to Fig. 5.By this figure, Fig. 5 illustrates that the precision of this test kit meets the requirement of " nucleic acid amplification detects survey test kit ".
5, detectability experiment
According to the display of sensitivity experiment result, this test kit can detect that 10copies/ reacts, and therefore adopts concentration to be 5.0 × 10
3the plasmid reference product S6 of copies/ml as sample, arrange 25 parallel, detect according to the operating process of test kit specification sheets, result shows that 25 parallel results are the positive, meet detectability requirement, therefore the detectability of this test kit is decided to be 10copies/ reaction, and experimental result is with reference to Fig. 6.Fig. 6 shows: the precision of this test kit detects and is limited to 10 copies/reaction.
Claims (6)
1. the fluorescent quantificationally PCR detecting kit of a chlamydia trachomatis, it is characterized in that: test kit comprises PCR reaction solution, archaeal dna polymerase liquid, negative quality control product, positive quality control product, weak positive quality control product, positive quantitatively reference product, lysate and Proteinase K Solution, includes the forward primer of chlamydia trachomatis specific, reverse primer and fluorescent probe in described PCR reaction solution;
Forward primer sequence: 5'-GCATGAGTCAGGACGAGTT-3',
Reverse primer sequences: 5'-CGAAACTAAATGTGCGAGAGC-3',
Fluorescent probe sequence: 5'-FAM-TTAGCCACCGATGAAGACCCGTTAC-TAMRA-3',
Described lysate is 5.0mM NaOH, 10.0mM Tris-HCl(pH8.0), 0.2mM EDTA (pH8.0), 1% (V/V) TritonX-100,0.5% (V/V) NP40,0.5% (V/V) Tween20;
Described archaeal dna polymerase liquid is the Taq DNA polysaccharase and the UDG enzyme that include warm start;
Described positive quality control product and weak positive quality control product are the plasmid pCR2.1 carrier containing inserting chlamydia trachomatis specific conserved sequence, quantitatively dilute with sterile TE buffer after extraction purification spectrophotometric determination concentration and purity after propagation in this recombinant plasmid transformed to bacillus coli DH 5 alpha, wherein the concentration of CT positive quality control product is 5.0 × 10
7the concentration of the weak positive quality control product of copies/ml, CT is 5.0 × 10
3copies/ml;
Described CT is positive, and quantitatively reference product is the plasmid pCR2.1 carrier containing inserting chlamydia trachomatis specific conserved sequence, and concentration is respectively P1:5.0 × 10
6copies/ml, P2:5.0 × 10
5copies/ml, P3:5.0 × 10
4copies/ml, P4:5.0 × 10
3copies/ml; Described negative quality control product is sterilizing deionized water.
2. by the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis according to claim 1, it is characterized in that: described PCR reaction solution also comprises: dATP, dUTP, dGTP, dCTP tetra-kinds of Nucleotide and the damping fluid containing magnesium ion.
3. by the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis described in claim 1 or 2, it is characterized in that: the specific sequence that the pCR2.1 vector plasmid of the described insertion chlamydia trachomatis distinguished sequence that described strong positive quality control product and weak positive quality control product, positive quantitatively reference product contain inserts is:
5'-AGGTGGCTCCAACGCTATTGGATTTTTCCATCATTTTATCCCGAATCCAAAAGTCCAATTAATTGGAGTGGAAGGGGGAGGACTGGGCATTTCTTCAGGAAAACATGCAGCACGTTTTGCAACAGGGCGACCTGGAGTATTCCACGGATTTTATTCGTATCTTCTTCAAGATGACGATGGACAAGTATTACAAACTCACTCCATTTCCGCTGGATTAGATTATCCTTCAGTTGGGCCAGATCATGCCGAAATGCATGAGTCAGGACGAGTTTTTTATACATTAGCCACCGATGAAGACCCGTTACGAGCTTTTTTCCTGCTTACTAGAAACGAGGGGATTATTCCTGCATTGGAGTCTTCACATGCTCTCGCACATTTAGTTTCGATTGCTCCTTCTCTACCAAAGGAACAAATCGTCATCGTTAACTTATCTGGAAGAGGTGATAAGGATCTTCCACAAATCATCCGCAGAAACAGA -3' 478bp。
4., by the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis according to claim 3, it is characterized in that: described PCR reaction solution also comprises the derived sequence of described forward primer sequence, reverse primer sequences and probe sequence.
5. by the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis according to claim 4, it is characterized in that: described derived sequence comprises to 5' end and 3' direction extension one to several base or deletes a sequence obtained to several base.
6. by the fluorescent quantificationally PCR detecting kit of a kind of chlamydia trachomatis according to claim 5, it is characterized in that: described probe sequence 5' end mark fluorescent reporter group FAM can be replaced the one in TET, JOE, HEX or VIC; The fluorescent quenching group TAMRA of described probe sequence 3' end mark can be replaced the one in DABCYL or BHQ.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410156164.3A CN105018573A (en) | 2014-04-17 | 2014-04-17 | Fluorescent quantitative PCR detection kit for chlamydia trachomatis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410156164.3A CN105018573A (en) | 2014-04-17 | 2014-04-17 | Fluorescent quantitative PCR detection kit for chlamydia trachomatis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018573A true CN105018573A (en) | 2015-11-04 |
Family
ID=54408872
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410156164.3A Pending CN105018573A (en) | 2014-04-17 | 2014-04-17 | Fluorescent quantitative PCR detection kit for chlamydia trachomatis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018573A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531628A (en) * | 2018-05-09 | 2018-09-14 | 南华大学 | It is a kind of detection chlamydia trachomatis kit and its application |
| CN110157820A (en) * | 2019-04-28 | 2019-08-23 | 深圳市国赛生物技术有限公司 | A kind of primer, probe and kit detecting chlamydia trachomatis |
| CN110982938A (en) * | 2019-12-21 | 2020-04-10 | 武汉百泰基因工程有限公司 | Fluorescent quantitative PCR kit for simultaneously detecting five TORCH pathogens and application thereof |
-
2014
- 2014-04-17 CN CN201410156164.3A patent/CN105018573A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108531628A (en) * | 2018-05-09 | 2018-09-14 | 南华大学 | It is a kind of detection chlamydia trachomatis kit and its application |
| CN110157820A (en) * | 2019-04-28 | 2019-08-23 | 深圳市国赛生物技术有限公司 | A kind of primer, probe and kit detecting chlamydia trachomatis |
| CN110982938A (en) * | 2019-12-21 | 2020-04-10 | 武汉百泰基因工程有限公司 | Fluorescent quantitative PCR kit for simultaneously detecting five TORCH pathogens and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN103409509B (en) | Group B streptococcus fluorescence PCR detection kit | |
| CN104328212B (en) | The primer sets of ring mediated isothermal amplification method detection B group streptococcus and test kit | |
| López-López et al. | Detection and differentiation of Entamoeba histolytica and Entamoeba dispar in clinical samples through PCR-denaturing gradient gel electrophoresis | |
| CN106191239A (en) | A kind of real-time PCR detection mycoplasma pneumoniae nucleic acid and the primer of medicament-resistant mutation, probe, method and test kit | |
| CN105441589A (en) | Human parainfluenza virus I, II, III, and IV-type quadruple-PCR detection kit, and detection method thereof | |
| Draz et al. | Comparison of broad range 16S rDNA PCR to conventional blood culture for diagnosis of sepsis in the newborn | |
| CN105018573A (en) | Fluorescent quantitative PCR detection kit for chlamydia trachomatis | |
| Sen et al. | Development of an internal control for evaluation and standardization of a quantitative PCR assay for detection of Helicobacter pylori in drinking water | |
| TWI362419B (en) | Nucleic acid detection | |
| Chen et al. | Visual and rapid identification of Chlamydia trachomatis and Neisseria gonorrhoeae using multiplex loop-mediated isothermal amplification and a gold nanoparticle-based lateral flow biosensor | |
| CN102329866B (en) | PCR (polymerase chain reaction) fluorescence quantitative rapid test kit and method for chlamydia trachomatis | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| Badiee et al. | Prospective screening in liver transplant recipients by panfungal PCR‐ELISA for early diagnosis of invasive fungal infections | |
| CN110343775A (en) | The primer of double check Gardner bacillus and trichomonas vaginalis, probe groups, kit and detection method | |
| CN105018571A (en) | Neisseria gonorrhoeae real-time fluorescent PCR rapid detection kit | |
| CN110468223B (en) | Primer, probe, kit and method for detecting nucleic acid of mycoplasma pneumoniae and bauxiella based on dUTP/UNG method | |
| CN102409098B (en) | Ureaplasma urealyticum PCR (Polymerase Chain Reaction) detection kit and detection method thereof | |
| CN104342487A (en) | Mycoplasma nucleic acid isothermal amplification method | |
| CN105018574A (en) | Rapid fluorescence PCR detection kit for Chlamydia trachomatis | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN110283921A (en) | Gardner bacillus, the primer of Candida albicans double check, probe groups, kit and detection method | |
| CN104388558A (en) | Molecular beacon probe and detection method for quickly detecting streptococcus agalactiae | |
| CN102220426A (en) | PCR (polymerase chain reaction) detection kit for hacmophilus parasuis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151104 |