CN105018504A - Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial - Google Patents
Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial Download PDFInfo
- Publication number
- CN105018504A CN105018504A CN201510346941.5A CN201510346941A CN105018504A CN 105018504 A CN105018504 A CN 105018504A CN 201510346941 A CN201510346941 A CN 201510346941A CN 105018504 A CN105018504 A CN 105018504A
- Authority
- CN
- China
- Prior art keywords
- linker
- aox
- luciferase
- primer
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention belongs to the technical field of microbial fermentation, provides a transformed luciferase gene, and particularly relates to a recombinant vector containing the transformed luciferase gene, a construction method of the recombinant vector, engineering bacterial containing the recombinant vector, and a method for producing luciferase through the engineering bacterial. According to the present invention, the nucleotide sequence of the luciferase gene f1 is transformed from the firefly luciferase nucleotide sequence, and is represented by SEQ ID NO.1; the recombinant vector is pET22b-fl-linker-aox, the Rhizopus oryzae aox gene fragment is transformed into the original vector pET22b through the linker connection to obtain the recombinant vector, the vector comprises fl-linker-aox, and the sequence is represented by SEQ ID NO.2; and the preferred codons of the escherichia coli are utilized to carry out codon optimization on the firefly luciferase, such that the smooth and efficient expression of the luciferase gene in the late escherichia coli can be easily achieved.
Description
Technical field
The invention belongs to technical field of microbial fermentation, relate to a kind of improved luciferase gene, be specifically related to the method for producing luciferase containing the recombinant vectors of this gene, the construction process of this carrier, the engineering bacteria containing this carrier and this project bacterium.
Background technology
Luciferase (firefly luciferase, LUC) is the general name of the class of enzymes of catalytic fluorometry element or alkanoic oxy-luminescence in organism.The high-performance bio catalyzer of Photinus pyralis LUC to be a kind of can be by chemical energy luminous energy.As far back as 1884, Dubois found fluorescence after Lampyridea grinding can disappear very soon, can reappear fluorescence again after adding the fresh extract of Lampyridea afterbody.After this, he confirms the interaction that there is fluorescein and luciferase in extract, and points out under the condition having oxygen molecule, ATP, and firefly luciferase enzyme can be oxidized and send the fluorescence being convenient to Sensitive Detection by catalytic fluorometry element.Chemical reaction is as follows:
Fluorescein+ATP+O
2=oxyluciferin+AMP+PPi+CO
2+ light
Having under excessive enzyme and excess substrate existent condition, luminous intensity is measured to the ATP existed in reaction and is directly proportional.This characteristics of luminescence makes Photinus pyralis LUC in the research of various mensuration ATP and widely uses in producing, at present, Photinus pyralis LUC is used as biosensor, be developed to ATP quick detection kit, for the bacterial cell polluted in rapid detection blood, milk powder, food production line, medical environment equal samples.Luciferase sold in the market is many to be extracted from Lampyridea afterbody, be vulnerable to the restriction in region and season, and the breeding cycle is long, aquaculture cost is high, aftertreatment also will through centrifugation, and multiple chemical extraction step such as column chromatography purification, just can obtain final crystal preparation.Utilize engineering bacteria fermentation to produce luciferase there is cycle short, not low by season, regional impact, cost, process to be easy to the plurality of advantages such as Authority Contro1, receive the extensive concern of people.As far back as 1985, the people such as Jeffery cloned firefly luciferase gene first, and constructed the recombinant vectors pkw101 containing firefly luciferase enzyme gene, successfully realized expressing in E.coli, obtained the activated luciferase of tool.1993, the people such as Lu constructed the intestinal bacteria of a strain capable of high-efficiency secretion luciferase, thus make genetic engineering bacterium large-scale production luciferase become possibility.At present, Promega, Sigma and Shenyang Zhong Kejing horse company have released one after another and have come from the luciferase of Recombinant organism.But compared with the luciferase coming from Lampyridea, it is low to there is protein content in the luciferase utilizing engineered method to produce, and the defects such as thermostability is poor, seriously constrain the application of luciferase.The present invention utilizes engineered method to transform Photinus pyralis LUC, build new luciferase gene engineering bacteria, experimental result shows, the genetic engineering bacterium constructed by the present invention effectively overcomes the poor stability that current gene engineering method produces luciferase, the defect that expression amount is low.
Summary of the invention
The restriction being subject to region and season is produced in order to overcome current Photinus pyralis LUC, and the shortcoming such as the breeding cycle is long, aquaculture cost is high, primary and foremost purpose of the present invention is the construction process providing a kind of genetic engineering bacterium containing firefly luciferase gene, obtains the high Photinus pyralis LUC of stability with utilizing this project bacterium energy high yield.
Object of the present invention is achieved through the following technical solutions
1. the invention provides a kind of improved luciferase gene, this luciferase gene fl nucleotide sequence is formed by Photinus pyralis LUC nucleotide sequence alterations, and its sequence is as shown in SEQ ID NO.1.
2. the present invention also provides the recombinant expression vector provided containing above-mentioned 1.
3. above-mentioned 2 recombinant expression vectors provided, this heavily loaded carrier is pET22b-fl, between NdeI and the XhoI site of initial carrier pET22b, insert improved luciferase gene fl.
4. above-mentioned 2 recombinant expression vectors provided, this recombinant vectors is pET22b-fl-linker-aox, connected in Rhizopus oryzae aox gene fragment fl-linker-aox importing initial carrier pET22b by linker and obtain recombinant vectors, fl-linker-aox sequence is as shown in SEQ ID NO.2.
5. the construction process of the above-mentioned 4 recombinant vectors pET22b-fl-linker-aox provided, comprises the steps:
(1) with luciferase gene fl for template, design primer 1 and primer 2, obtains by the method for PCR the PCR primer that one end is connected with the luciferase gene fl of linker;
(2) with Rhizopus oryzae aox gene for template, design primer 3 and primer 4, by the method for PCR, obtains the PCR primer that one end is connected with the Rhizopus oryzae aox gene of linker;
(3) PCR primer mixing step (1), (2) obtained, as template, carry out PCR with primer 1,4 and obtain fl-linker-aox, glue reclaims PCR primer, connect PMD19-T Vector, obtain recombinant vectors T-fl-linker-aox.
6. the construction process described in above-mentioned 5, wherein,
Step (1) described primer 1 sequence is GGAATTC
cATATGaTGGAAGACGCC,
The sequence TTACAATTTGGACTTGGCGGTGGCG of primer 2
Step (2) described primer 3 sequence is GGCGGTGGCG ATGCCGTACGACATG, primer 4 sequence C CGCTCGAGTTATGCTGTCGATGGG
7. the present invention also provides a kind of engineering bacteria producing luciferase, and this project bacterium is proceeded in e. coli bl21 (DE3) by carrier described in above-mentioned any one of 2-4 and obtains.
8. the present invention also provides a kind of high stable to produce the method for luciferase, the method comprises the steps: (1) proceeds to e. coli bl21 (DE3) by recombinant expression vector pET22b-fl-linker-aox, obtains and produces luciferase engineering bacteria E1;
(2) engineering bacteria E1 is transferred in the fresh liquid LB substratum of the AMP being added with 1uL/ML, 200rmp/min, 37 DEG C carry out shake-flask culture, incubation time is 12-14 hour, obtain seed liquor;
(3) seed liquor that step (2) obtains is connected to NBS fermentor tank with the amount of volume ratio 3-5%, 37 DEG C of fermentation culture, dissolved oxygen is controlled at 20%-40% by association air flow and rotating speed, after glucose consumption is complete, stream adds fresh feed liquid, and fermentation culture is produced luciferase engineering bacteria E1 and obtained luciferase.
9. above-mentioned 8 high stables provided produce the method for luciferase, and wherein, the substratum that step (3) carries out fermentation culture is: soy peptone 10 ~ 12g/L, glucose 10 ~ 20g/L, Na
2hPO
44 ~ 6g/L, K
2hPO
41 ~ 3g/L, NH
4cl 0.5 ~ 1g/L, NaCl 0.1 ~ 0.5g/L, MgSO
47H
2o 0.1 ~ 0.5g/L.
Beneficial effect:
1. the present invention utilizes colibacillary preference codon, carries out codon optimized to Photinus pyralis LUC, be beneficial to this luciferase gene can in later stage colibacillus engineering smooth high expression.
2. the pET22b-fl-linker-aox of the present invention's acquisition, because firefly luciferase gene is under the control of efficient promoter PT7 and lactose operon lacOperator, when IPTG exists, Photinus pyralis LUC of the present invention can by efficient inducible transcription, and transcribes the mRNA obtained and contain ribosome bind site RBS.
3. the present invention connects the aox gene introduced and derive from filamentous fungus Rhizopus oryzae on recombinant expression vector pET22b-fl basis by linker, thus in intestinal bacteria body, introduce the alternating oxidation approach that is different from standard respiratory chain, effectively can reduce the effect of Oxdative stress, reduction system ROS level, remove the murder by poisoning to cell, facilitate the expression of cell, thus improve output and the stability of enzyme.
In a word, utilize the method for this project bacterium fermentative production luciferase, to have the expression amount of enzyme high for present method compared with existing production method, and the advantages such as stability is strong are a kind of methods of efficient production luciferase, is suitable for industrial production application.
Accompanying drawing explanation
Fig. 1 fl-linker-aox building process;
Fig. 2 pET22b-fl-linker-aox building process;
Fig. 3 pET22b-fl-linker-aox recombinant vectors electrophorogram;
M represents Marker, and 1,2,3,4,5,6 represent pET22b-fl-linker-aox recombinant vectors
Embodiment
Below in conjunction with embodiment, the present invention will be further described, and the experimental technique of unreceipted actual conditions in the following example, usually according to the known approaches of this area.
Embodiment 1:
1, the acquisition of firefly luciferase gene
According to the gene order of North America Photinus pyralis LUC, under the prerequisite not changing its aminoacid sequence, carry out codon optimized to it, to adapt to colibacillary expression system, artificial directly this gene of synthesis (Jin Sirui biotech firm), called after luciferase gene fl.Be connected with PMD-19T (TAKARA) by this gene, reaction conditions is as follows: cumulative volume 5uL, PMD19-T carrier 1uL, DNA 1uL, ddH
2o3uL, 16 DEG C, reaction more than 30min, order-checking (Jin Sirui biotech firm).Sequencing result shows that the luciferase gene fl nucleotide sequence obtained is as shown in SEQ ID NO.1, and the carrier after restructuring contains luciferase gene fl, called after T-fl.
2, firefly luciferase gene recombinant vectors pET22b-fl-linker-aox
(1) with the genomic dna of luciferase gene fl for template, design primer 1 and primer 2, obtains by the method for PCR the PCR primer fl-linker that one end is connected with the luciferase gene fl of linker;
PCR system is: 2 × Taq Plus master mix (Taq enzyme aqueous premix) 12.5uL, template DNA 2uL, primer 1 1uL, primer 2 1uL, ddH
2o 8.5uL.PCR reaction process is: 1) 95 DEG C of denaturation 5min; 2) 94 DEG C of denaturation 30s; 3) 55 DEG C of annealing 30s; 4) 72 DEG C extend 1.5min; Step 2)-4) repeat 29 circulations; 5) 72 DEG C are continued to extend 7min, are cooled to 4 DEG C.Glue reclaims PCR primer.
(2) with the genomic dna of aox for template, design primer 3 and primer 4, by the method (annealing time presses 1000bp/min design, and all the other are the same) of PCR, obtain the PCR primer linker-aox that one end is connected with the Rhizopus oryzae aox gene of linker;
Be below primer sequence described in above-mentioned 1-4, straight line portion is linker, and wavy line part is restriction enzyme site:
Primer 1: upstream primer GGAATTC
cATATGaTGGAAGACGCC
Primer 2: downstream primer TTACAATTTGGACTT
gGCGGTGGCG
Primer 3: upstream primer
gGCGGTGGCGaTGCCGTACGACATG
Primer 4: downstream primer CCG
cTCGAGtTATGCTGTCGATGGG
(3) by the PCR primer mixing in step (1), (2), as template, with primer 1 and primer 4 for primer, obtained by the method (method is same as above) of PCR, glue reclaims PCR primer fl-linker-aox (concrete acquisition step as shown in Figure 1), connect PMD19-T Vector, obtain recombinant vectors T-fl-linker-aox.Then e. coli bl21 (DE3) bacterial strain is transformed into, be coated with the LB substratum plate containing 50mg/L penbritin, be separated the transformant of anti-penbritin, order-checking qualification, sequencing result shows that the Nucleotide obtained comprises fl-linker-aox, and sequence is as shown in SEQ ID NO.2.
(4) recombinant vectors T-fl-linker-aox and pET22b is carried out double digestion respectively, restriction enzyme site is NdeI and XhoI, and double digestion reaction system is as follows: ddH
2o 30uL, 10 × M 5uL, DNA gene 12uL, NdeI 1uL, XhoI 1uL, 37 DEG C are reacted more than 4 hours, obtain digestion products 1 and 2.
Connect digestion products 1 and 2 with T4DNA ligase enzyme, obtain recombinant vectors pET22b-fl-linker-aox (concrete acquisition step as shown in Figure 2), ligation system is as follows: 10 × T4DNA ligase enzyme damping fluid 2.5uL, DNA fragmentation 8uL, carrier 2uL, T4DNA ligase enzyme 1uL, ddH
2o 11.5uL, 16 DEG C of reaction overnight.Then e. coli bl21 (DE3) bacterial strain is transformed into, be coated with the LB substratum plate containing 50mg/L penbritin, be separated the transformant of anti-penbritin, carry recombinant vectors, judge whether fl-linker-aox has connected upper pET22b recombinant vectors by recombinant vectors size, if there is the fragment of about 8000bp size, illustrate that fl-linker-aox has connected pET22b recombinant vectors.
Embodiment 2
Prepare the detection of Photinus pyralis LUC and characteristic thereof
1, the acquisition of firefly luciferase gene engineering strain and the abduction delivering of albumen and purifying
(1) acquisition of firefly luciferase gene engineering strain
PET22b-fl-linker-aox recombinant vectors is transformed into the competent cell of e. coli bl21 (DE3) (TAKARA), then be applied to the LB solid medium of the penbritin (AMP) containing 50mg/L, cultivate in 37 DEG C of constant incubators and obtain the single bacterium colony of intestinal bacteria.Be separated the transformant of anti-penbritin; Extract recombinant vectors, leakage of electricity is swum, judge whether pET22b-fl-linker-aox recombinant vectors successfully imports in intestinal bacteria according to recombinant vectors size, if there is about 8000bp fragment, illustrate that pET22b-fl-linker-aox recombinant vectors has successfully imported in intestinal bacteria, as shown in Figure 3, be E1 by this Strain Designation.
(2) abduction delivering of Photinus pyralis LUC and purifying
In super clean bench, single bacterium colony of picking E1 bacterial strain is in the fresh liquid LB substratum of 50mL being added with 50uL AMP, 37 DEG C, 200rmp, 14-16h is cultivated in concussion, as seed, the fresh LB substratum (adding 50uLAMP) of 50mL is received by the inoculum size of 5% (volume ratio), 37 DEG C, it is 14 ~ 1.5 that 200rmp concussion is cultured to OD value, then the IPTG 100uL that final concentration is 1mol/L is added, carry out induction 7h, collect A, B, C, D tetra-pipe 2mL bacterium liquid, then the centrifugal 1min of 12000rmp, abandon supernatant, bacterium mud 2mL pH be 7.0 PBS damping fluid resuspended, then in re-suspension liquid, 10uL N,O-Diacetylmuramidase and DNA enzymatic is respectively added, liquid nitrogen multigelation 5 times, broken thalline, the centrifugal 1min of 12000rmp, supernatant liquor is crossed nickel post and is carried out purifying.
2, the enzyme live birth rate of Photinus pyralis LUC, enzyme live, the detection of purity
Carry out enzyme activity determination respectively to the enzyme after above-mentioned 4 pipe purifying, 3 repetitions are established in experiment
Enzyme standard reaction condition alive: 2uL enzyme liquid, the fluorescein (Promega) of 0.15mg/mL, 1mMDTT, 5mM MgSO
4, 25mM Tricine (pH7.8), 10
-6mATP, reacts 10s under room temperature, and by the work output (RLU) of light in Promega hand-held ATP luminescence record detector record 10 second, represent that enzyme is lived with light work output RLU (Relative light unit), average enzyme work can reach 8.9 × 10
10rLU/mg purifying protein, carries out SDS-PAGE electrophoresis by collection liquid, and carries out gray scale scanning quantitatively and calculate, and the purity of zymoprotein is greater than 98%.After room temperature places 1 month, using the same method, it is alive to measure enzyme, and average enzyme work is 8.27 × 10
10rLU/mg, has higher stability.
3,5L ferment tank
The single bacterium colony choosing E1 bacterial strain carries out shake-flask culture in the fresh liquid LB substratum of the 50mL being added with 50uLAMP, and rotating speed is 200rmp/min, and temperature is 37 DEG C, and incubation time is 12-14 hour, obtains seed liquor.Above-mentioned seed liquor is connected to the NBS fermentor tank of 5L with the amount of 3-5% (v/v), 37 DEG C of fermentation culture, control dissolved oxygen at 20%-40% by association air flow and rotating speed, after glucose consumption is complete, stream adds fresh feed liquid.Seed culture medium is LB substratum, and fermention medium is: soy peptone 10 ~ 12g/L, glucose 10 ~ 20g/L, Na
2hPO
44 ~ 6g/L, K
2hPO
41 ~ 3g/L, NH
4cl 0.5 ~ 1g/L, NaCl 0.1 ~ 0.5g/L, MgSO
47H
2o 0.1 ~ 0.5g/L.After having fermented, measure OD and reach 57.4, thalline weight in wet base reaches 63.8g (DCW)/L, and the output of luciferase is: 20mg/L, by the work output (RLU) of light in Promega hand-held ATP luminescence record detector record 10 second, luciferase is than enzyme alive 8.5 × 10
10rLU/mg albumen, enzyme work after 1 month placed by 4 DEG C of refrigerators is 8.16 × 10
10rLU/mg purifying protein.
Can know; above-described embodiment is only in order to illustrate the illustrative embodiments that inventive principle adopts; but the present invention is not limited only to this; those skilled in the art are not departing under real situation of the present invention; can make various improvement and change, these improve and change and also belong to protection scope of the present invention.
Claims (9)
1. an improved luciferase gene, is characterized in that: this luciferase gene fl nucleotide sequence is formed by Photinus pyralis LUC nucleotide sequence alterations, and its sequence is as shown in SEQ ID NO.1.
2. containing recombinant expression vector according to claim 1.
3. recombinant expression vector according to claim 2, is characterized in that: described heavily loaded carrier is pET22b-fl, between NdeI and the XhoI site of initial carrier pET22b, insert improved luciferase gene fl.
4. recombinant expression vector according to claim 2, is characterized in that: described recombinant vectors is pET22b-fl-linker-aox, is connected in Rhizopus oryzae aox gene fragment fl-linker-aox importing initial carrier pET22b obtain recombinant vectors by linker; Fl-linker-aox sequence is as shown in SEQ ID NO.2.
5. the construction process of recombinant vectors pET22b-fl-linker-aox according to claim 4, is characterized in that, comprise the steps:
(1) with luciferase gene fl for template, design primer 1 and primer 2, obtains by the method for PCR the PCR primer that one end is connected with the luciferase gene fl of linker;
(2) with Rhizopus oryzae aox genomic dna for template, design primer 3 and primer 4, by the method for PCR, obtains the PCR primer that one end is connected with the Rhizopus oryzae aox gene of linker;
(3) PCR primer mixing step (1), (2) obtained, as template, carry out PCR with primer 1,4 and obtain fl-linker-aox, glue reclaims PCR primer, connect PMD19-T Vector, obtain recombinant vectors T-fl-linker-aox.
6. construction process according to claim 5, is characterized in that: step (1) described primer 1 sequence is GGAATTC
cATATGaTGGAAGACGCC,
The sequence TTACAATTTGGACTTGGCGGTGGCG of primer 2;
Step (2) described primer 3 sequence is GGCGGTGGCGATGCCGTACGACATG, primer 4 sequence C CGCTCGAGTTATGCTGTCGATGGG.
7. produce an engineering bacteria for luciferase, it is characterized in that: described engineering bacteria is proceeded in e. coli bl21 (DE3) by carrier described in any one of claim 2-4 and obtains.
8. high stable produces a method for luciferase, it is characterized in that: recombinant expression vector pET22b-fl-linker-aox is proceeded to e. coli bl21 (DE3) by (1), obtains and produces luciferase engineering bacteria E1;
(2) engineering bacteria E1 is transferred in the fresh liquid LB substratum of the AMP being added with 1uL/ML, 200rmp/min, 37 DEG C carry out shake-flask culture, incubation time is 12-14 hour, obtain seed liquor;
(3) seed liquor that step (2) obtains is connected to NBS fermentor tank with the amount of volume ratio 3-5%, 37 DEG C of fermentation culture, dissolved oxygen is controlled at 20%-40% by association air flow and rotating speed, after glucose consumption is complete, stream adds fresh feed liquid, and fermentation culture is produced luciferase engineering bacteria E1 and obtained luciferase.
9. high stable according to claim 8 produces the method for luciferase, and it is characterized in that, the substratum that step (3) carries out fermentation culture is: soy peptone 10 ~ 12g/L, glucose 10 ~ 20g/L, Na
2hPO
44 ~ 6g/L, K
2hPO
41 ~ 3g/L, NH
4cl0.5 ~ 1g/L, NaCl0.1 ~ 0.5g/L, MgSO
47H
2o0.1 ~ 0.5g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510346941.5A CN105018504A (en) | 2015-06-19 | 2015-06-19 | Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510346941.5A CN105018504A (en) | 2015-06-19 | 2015-06-19 | Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018504A true CN105018504A (en) | 2015-11-04 |
Family
ID=54408806
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510346941.5A Pending CN105018504A (en) | 2015-06-19 | 2015-06-19 | Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018504A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110257413A (en) * | 2019-07-19 | 2019-09-20 | 山东大学 | A kind of recombinant plasmid and its application in identification acidophilia thermophilic thiobacillus gene expression |
| CN110272911A (en) * | 2019-07-05 | 2019-09-24 | 四川大学 | Application of the AOX1a gene in terms of improving drought resistance in plants |
-
2015
- 2015-06-19 CN CN201510346941.5A patent/CN105018504A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110272911A (en) * | 2019-07-05 | 2019-09-24 | 四川大学 | Application of the AOX1a gene in terms of improving drought resistance in plants |
| CN110257413A (en) * | 2019-07-19 | 2019-09-20 | 山东大学 | A kind of recombinant plasmid and its application in identification acidophilia thermophilic thiobacillus gene expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105331642B (en) | Method for catalytically producing α -ketoglutaric acid by using L-glutamic acid oxidase | |
| CN109609474A (en) | A kind of amino acid dehydrogenase mutant and its application in synthesis L-glufosinate-ammonium | |
| CN106754850A (en) | Glutamic acid decarboxylase enzyme mutant and its application that heat endurance is improved | |
| CN109055327A (en) | Aldehyde Ketoreductase mutant and its application | |
| CN105062985A (en) | Carbonyl reductase mutant and application thereof | |
| CN104152505A (en) | Method for transforming and preparing 4-hydroxyl-L-isoleucine by using recombinant bacterial strains | |
| CN105238807A (en) | Construction of coenzyme efficient regeneration system and application thereof | |
| CN109468288A (en) | A kind of new blue multicopper oxidase of efficient degradation histamine | |
| CN103114110B (en) | Method for synthesizing bilirubin by utilizing immobilized enzyme | |
| CN105002147B (en) | The mutation glucose oxidase and its encoding gene and application that expression quantity improves | |
| CN102174557A (en) | Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same | |
| CN105018504A (en) | Transformed luciferase gene, recombinant vector containing transformed luciferase gene, engineering bacterial, construction method of recombinant vector, and fermentation method of engineering bacterial | |
| CN105255934A (en) | Strategy for efficiently coproducing alpha-aminobutyric acid and gluconic acid | |
| CN103103234A (en) | Method for synthesizing nicotinamide adenine dinucleotide (NAD) by immobilized enzyme | |
| CN103695443B (en) | A kind of Novel carbonyl reductase, its gene and application | |
| CN102382790A (en) | Recombinant bacillus subtilis for high yield of catalase (CAT), and construction method and application thereof | |
| CN111206011A (en) | Recombinant corynebacterium glutamicum and application thereof in production of L-glutamic acid | |
| CN105734027B (en) | A kind of xanthine dehydrogenase and its encoding gene and application | |
| CN104830744A (en) | Method for preparing (R)-phenylglycol from SD-AS sequence coupled (R)-carbonyl reductase and glucose dehydrogenase | |
| CN100429314C (en) | Plasmid pET28a(+)-P450BM3-gdh0310 capable of catalytic preparing indigo from indole, preparation process and use thereof | |
| CN105985935B (en) | A kind of xanthine dehydrogenase truncation body and its application | |
| CN105200022B (en) | The method of firefly luciferase thermal stability transformation | |
| CN103882045A (en) | Bacterial strain of producing pyruvic acid and construction method of bacterial strain | |
| CN106434710A (en) | Heatproof arginase gene expression sequence and application | |
| CN109929853B (en) | Application of thermophilic bacteria source heat shock protein gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151104 |
|
| RJ01 | Rejection of invention patent application after publication |