CN105018441A - Method for crystallizing influenza virus RNA polymase - Google Patents
Method for crystallizing influenza virus RNA polymase Download PDFInfo
- Publication number
- CN105018441A CN105018441A CN201410162712.3A CN201410162712A CN105018441A CN 105018441 A CN105018441 A CN 105018441A CN 201410162712 A CN201410162712 A CN 201410162712A CN 105018441 A CN105018441 A CN 105018441A
- Authority
- CN
- China
- Prior art keywords
- sequence
- subunit
- influenza virus
- rna polymerase
- truncate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a method for crystallizing influenza virus RNA polymase, which comprises the steps of carrying out coexpression on a PB1 subunit encoding gene, a PA subunit encoding gene and a PB2 truncated subunit encoding gene of influenza virus RNA polymase in an insect cell to obtain RNA polymase; and purifying and crystallizing to obtain a influenza virus RNA polymase crystal. An experiment proves that PB2 truncated protein segments which have different lengths and amino ends retained and other two subunit full-length proteins are subjected to coexpression purification and complex assembling, a small truncated complex can use different strains to obtain crystal at multiple truncating circumstances. The method lays a foundation for structure analysis of influenza virus RNA polymase and also has important meanings for anti-influenza virus drug screening and design and research and development process of broad spectrum vaccines and drugs.
Description
Technical field
The present invention relates to biological technical field, relate to the method for influenza virus RNA polymerase crystallization, particularly relate to a kind of expression of influenza virus RNA polymerase complex body, purifying and crystallization method.
Background technology
Influenza virus, especially influenza A virus is the large problem threatening human society always, it has host range widely and comprises people, pig, horse and bird etc., the mankind and animal upper respiratory tract infection can be caused, i.e. influenza, because it can borrow air to propagate rapidly, cause global being for several times very popular in eighties of last century.Influenza virus belongs to orthomyxovirus section, and be the segmented genomic viral of minus strand single stranded RNA, its gene element is 8 sections, finds at least codified 16 albumen at present.Although there is many anti-influenza virus medicaments and vaccine at present, these medicines and vaccine mainly for influenza surface protein, as HA, NA and M2.Because influenza virus can change its surface antigen by sudden change or gene recombination under drug pressure, these surface proteins will have resistance through the strain of sudden change, thus may cause uncontrollable influenza pandemic.In order to solve the resistance problems of medicine and vaccine, people change thinking in consideration and research and develop broad spectrum Tamiflu.
Along with the research of infected by influenza replicanism, eye concentrates on the ribonucleoprotein RNP of virus by people gradually.Influenza virus RNP is the core component that influenza virus is copied.Different from virus surface proteins, the RNP of influenza virus is more conservative, and it is made up of viral genome, RNA polymerase and the multiple nucleoprotein be wrapped on virus genome RNA, is responsible for transcribing and copying of virus.Influenza virus polymerase is the core machine that influenza virus is copied, the size that it is made up of PA, PB1 and PB2 tri-subunits is about the ternary complex of 250 kilodaltons (KDa), the RNA of three types can be produced, cRNA, vRNA and mRNA respectively, this polysaccharase had both participated in virus genomicly transcribing reproduction process in the vital movement of virus, and have article to report this mixture also participates in the assembling of virus simultaneously.
Although people pass through biological chemistry, genetics, information biology and structure biology infected by influenza polysaccharase have carried out the further investigation of each side, propose more and more meticulousr model, in the working mechanism of polysaccharase, still have a lot of key issue to there is no method solve, such as: polysaccharase how regulatory transcription and reproduction process; In a replication process, how two polymerase molecule are coordinated to start and termination copies; In addition, polysaccharase also participates in the assembling of virus and resists host immune system.In order to address these problems, extremely need the polysaccharase one-piece construction of an atom definition, but due to influenza virus polymerase be the mixture of a 250KD, in order to exercise its several functions, multiple conformation may be had, this causes great obstacle to the acquisition of structure biology research, especially crystalline structure, even if therefore have passed through the effort of many decades, does not still have the structure of the overall mixture of influenza virus polymerase to be reported.
At present, people are at expression of recombinant proteins purifying, crystal optimization and structure elucidation aspect have accumulated a large amount of experiences, and under normal circumstances, purifying obtains the protein of the stable uniform of q.s and obtains the Main Bottleneck that crystallization remains macromolecule crystal structural analysis thus.
Summary of the invention
The object of this invention is to provide a kind of method of influenza virus RNA polymerase crystallization.
Method provided by the invention, comprise the steps: as first by encoding gene coexpression, purifying in insect cell of the PB1 subunit coding gene of influenza virus RNA polymerase, PA subunit coding gene and PB2 subunit truncate, obtain RNA polymerase, again described RNA polymerase is combined with RNA and forms complex body, again by described complex body crystallization, obtain influenza virus RNA polymerase crystal;
Described PB2 subunit truncate is made up of PB2 subunit 1 to N amino acids residue from N-terminal; Arbitrary natural number in N=37-280.
In aforesaid method, described PB2 subunit truncate is made up of PB2 subunit 1 to N amino acids residue from N-terminal; Arbitrary natural number in N=37-130.
In aforesaid method, described PB2 subunit truncate is following 1) or 2) or 3):
1) for PB2 yldeneamino acid sequence from N-terminal first 37 amino-acid residue formed albumen;
2) for PB2 yldeneamino acid sequence from N-terminal first 130 amino-acid residue formed albumen;
3) for PB2 yldeneamino acid sequence from N-terminal first 103 amino-acid residue formed albumen.
In aforesaid method, described insect cell is High Five cell;
Described influenza virus is influenza A, and the virus strain of described influenza A is specially H5N1, H1N1 or H3N2.
In aforesaid method, described by the encoding gene of the PB1 subunit coding gene of influenza virus RNA polymerase, PA subunit coding gene and PB2 subunit truncate coexpression employing Bac-to-BacBac-to-Bac baculovirus expression system in insect cell, donor plasmid in described Bac-to-BacBac-to-Bac baculovirus expression system is pFastBac, intestinal bacteria are DH10Bac, and insect cell is Sf9.
In aforesaid method, the aminoacid sequence of described PB1 subunit is for shown in sequence in sequence table 1;
The aminoacid sequence of described PA subunit is for shown in sequence in sequence table 3;
The aminoacid sequence of described PB2 subunit is for shown in sequence in sequence table 2;
1) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-37 position;
2) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-130 position;
3) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-103 position.
In aforesaid method, the nucleotides sequence of the encoding gene of described PB1 subunit to be classified as in sequence table shown in sequence 4;
The nucleotides sequence of the encoding gene of described PA subunit to be classified as in sequence table shown in sequence 6;
1) nucleotides sequence of the encoding gene of the described PB2 subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-111 position;
2) nucleotides sequence of the encoding gene of the described PB2 subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-390 position;
3) nucleotides sequence of the encoding gene of the described PA subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-309 position.
In aforesaid method, described purifying be described RNA polymerase that coexpression is obtained successively through affinity chromatography, ion exchange chromatography and gel chromatography, obtain the RNA polymerase after purifying;
The damping fluid that described crystallization adopts by final concentration be the PEG1000-20000 of 2%-30%, final concentration is that the TrisHCL damping fluid that 50mM-500mMNaCL and concentration are 100mM, pH value is 8.5 forms;
The temperature that described crystallization adopts is 4 DEG C-20 DEG C.
The RNA polymerase crystal prepared by above-mentioned method is also the scope of protection of the invention.
The application of above-mentioned RNA polymerase crystal in anti-influenza virus medicament screening or vaccine design and preparation is also the scope of protection of the invention.
Experiment of the present invention proves, present invention utilizes different lengths to retain other two subunit PA of N-terminal PB2 protein truncation body and influenza virus RNA polymerase complex body and PB1 full-length proteins and carry out coexpression, purifying and complex body and assemble the different microcomplex obtained, these microcomplexs all can form influenza virus RNA polymerase crystal add vRNA post crystallization.Therefore infer, no matter use which kind of Influenza virus strain, this interval interior any truncate of PB2 yldeneamino end all may help to obtain the crystallization of influenza virus RNA polymerase complex body.
Method of the present invention solves a major issue for a long time, the i.e. how complex body of effective expression purifying one containing most of influenza virus RNA polymerase complex component, this albumen composition particularly containing complete PB1 structure, and make it crystallization, the structure elucidation that this method is not only influenza virus polymerase lays the foundation, meanwhile, to the design research and development process of resisiting influenza virus drug screening, broad spectrum vaccine and medicine also by significant and using value.
Accompanying drawing explanation
Fig. 1 is collection of illustrative plates in the influenza virus RNA polymerase complex body purge process containing PB2-37 truncate
Fig. 2 is the influenza virus RNA polymerase complex body purifying SDS-PAGE electrophoretogram containing PB2-37 truncate
Fig. 3 is the influenza virus RNA polymerase complex molecules sieve purifying collection of illustrative plates containing PB2-130 truncate
Fig. 4 is the purification result of the influenza virus RNA polymerase complex body containing PB2-130 truncate
Wherein, Fig. 4 A is the influenza virus RNA polymerase complex body electrophorogram containing PB2-130 truncate, and 1-2 is that nickel column chromatography rear electrophoresis, 3 is ion-exchange rear electrophoresis, 4-5 is sieve chromatography rear electrophoresis
Fig. 4 B is ion-exchange collection of illustrative plates, and blue curve (curve above) is for sample is in the absorbing state of UV280; Red curve (curve below) represents UV260 and absorbs; Black curve represents the increase process of ion-exchange salt concn.
Fig. 4 C is molecular sieve purification collection of illustrative plates, UV280 and UV260 absorbing state when wherein black curve representative does not add RNA, and blue curve representative adds complex eluate UV280 and UV260 absorbing state after RNA.
Fig. 5 is the electrophoretogram after the influenza virus RNA polymerase complex body purifying containing different PB2 truncate
Fig. 6 is influenza virus RNA polymerase complex body Electronic Speculum result containing PB2-130 truncate and crystallization picture
Wherein A and B is the Electron microscope observations of disome and limbs, C is crystallization photo after limbs add vRNA, D is crystallization electrophoresis detection figure
Fig. 7 is the crystallization picture of the influenza virus RNA polymerase complex body containing different PB2 truncate
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Test insect expression vector pFASTBAC and pFastBac-Dual used and cell culture medium SF900II SFM all purchased from Invitrogen company.Required RNA synthesizes by Takara company, nickel affinity column is purchased from Qiagen company (Ni-NTA Agarose, catalog number: 30230), SP cationic exchange coloum (HITRAP SP HP, catalog number: 17-1152-01) and Superdex20016/60 gel chromatography column (HiLoad16/600Superdex200pg, catalog number: 28-9893-35) purchased from GE company.Detect PA, PB1 and PB2 antibody used by expressing corresponding protein polypeptide, immunize rabbit obtains polyclonal antibody, good through experimental verification specificity.
What insect cell expression system adopted is the Bac-to-Bac baculovirus expression system of Invitrogen company
baculovirus Expression System, catalog number (Cat.No.): 10359-016), wherein donor plasmid is pFastBac, the intestinal bacteria carrying out recombinant virus structure are DH10Bac (this bacterial strain contains the shuttle plasmid Bacmid that can shift between bacterium and insect and increase and the Helper plasmid expressing transposase), and insect cell is Sf9.Insect cell medium used is the SF900II SFM of Invitrogen company.
Embodiments of the invention all for Influenza virus strain Influenza virus/A/Guangdong/goose/196 (H5N1) (hereinafter referred to as: H5N1), but three subunits of the influenza virus RNA polymerase of remaining influenza virus especially in influenza A strain also can carry out crystallization by method of the present invention.
Polymeric three subunits of RNA polymerase of H5N1 comprise PB1 albumen, PA albumen and PB2 albumen, and the aminoacid sequence of PB1 albumen is sequence 1, and the nucleotides sequence of its encoding gene is classified as sequence 4; The aminoacid sequence of PA albumen is sequence 3, and the nucleotides sequence of its encoding gene is classified as sequence 6; The aminoacid sequence of PB2 albumen is sequence 2, and the nucleotides sequence of its encoding gene is classified as sequence 5.
The crystallization of embodiment 1, influenza virus RNA polymerase containing PB2-37 truncate
Pre-crystallized polymeric three subunits of influenza virus RNA polymerase of the present embodiment comprise PB1 albumen, PA albumen and PB2-37 truncate;
The aminoacid sequence of PB2-37 truncate be sequence 2 from N-terminal 1-37 amino acids, its encoding gene is that sequence 5 is from 5 ' end 1-111 position Nucleotide.
One, the acquisition of influenza virus RNA polymerase
1, the expression of each subunit of influenza virus RNA polymerase
1), the structure of the recombinant vectors of each subunit of expression of influenza viral rna polymerase
General theory, synthesizes H5N1, WSN, PR8,1918, H3N2 gene DNA respectively by method for synthesizing gene gene order disclosed in NCBI website.For respective sequence, design dna primer respectively, carry out pcr amplification, obtain the gene of each subunit of influenza virus RNA polymerase of each virus, according to the Bac-to-Bac system instruction manual handbook of Invitrogen, by molecular cloning method, by three kinds of subunit PB1, PB2 and PA gene is cloned on pFastBac expression vector respectively, at these genes of insect cell expression.Wherein PB1 and PA is full-length gene, and PB2 is for blocking body gene.
Because the later stage will carry out ni-sepharose purification, therefore need to add HIS label at the carboxyl terminal of subunit PB2-37 or PB1, all test for two kinds, find in complex body expression process, only on any one subunit of subunit PB2-37 and PB1, PB1 and PB2 subunit need be there is no need and all contains histone label simultaneously containing histidine-tagged albumen.
HIS label is added at the carboxyl terminal of subunit PB2-37, the carboxyl terminal primer of amplification subunit PB2-37 encoding gene is 5 ' ATCTCGAGTTAGTGGTGGTGGTGGTGGTGTCCTGATGTGTATTTCTTGATTAT3 ', containing terminator, containing 6 series connection histidine-tagged;
Do not add HIS label at the carboxyl terminal of subunit PB2-37, the carboxyl terminal primer of amplification subunit PB2-37 encoding gene is: 5 ' ATCTCGAGTTATCCTGATGTGTATTTCTTGATTAT3 ';
Add HIS label at the carboxyl terminal of subunit PB1, the carboxyl terminal primer of amplification subunit PB1 encoding gene is:
5 ' ATCTCGAGCATGTGGTGGTGGTGGTGGTGTTTTTGCCGTCTGAGCTCTTCAATGG3 ', adds six continuously arranged Histidines (6HIS) before terminator codon;
Do not add HIS label at the carboxyl terminal of subunit PB1, the carboxyl terminal primer of amplification subunit PB1 encoding gene is:
5’ATCTCGAGCTATTTTTGCCGTCTGAGCTCTTCAATGG3’。
Experiment below adds HIS label to be at the carboxyl terminal of PB1.
(1) acquisition of recombinant vectors pFastBac-PB2-37
Aminoterminal primer sequence is: 5 ' ATGGATCCATGGAGAGAATAAAAGAATTAAGAG3 '; Carboxyl terminal primer is: 5 ' ATCTCGAGTTATCCTGATGTGTATTTCTTGATTAT3 '
With the encoding gene of PB2 albumen for template, carry out pcr amplification with above-mentioned aminoterminal primer and carboxyl terminal primer, obtain PCR primer.
By this PCR primer respectively enzyme be connected to after cutting on the cloning site on carrier pFastBac plasmid, thus construct and express the PB2 aminoterminal recombinant vectors containing 1-37 amino acids residue segment.
Through order-checking, this recombinant vectors is for inserting between BamHI and the XhoI restriction enzyme site of expression vector pFASTBAC carrier by sequence in sequence table 5 from the encoding gene of the PB2-37 truncate albumen shown in 5 ' end 1-111 position Nucleotide, express PB2-37 truncate albumen, the recombinant vectors obtained, called after pFastBac-PB2-37.
(2) acquisition of recombinant vectors pFastBac-PB1
Design dna primer, wherein 5 ' end primer is: ATGGATCCATGTCAATCCGACTTTACTTTTCTT;
Hold on primer 3 ', before terminator codon, add six continuously arranged Histidines (6HIS) and be: ATCTCGAGCATGTGGTGGTGGTGGTGGTGTTTTTGCCGTCTGAGCTCTTCAATGG.
With the full-length gene of PB1 synthesis for template, carry out pcr amplification with above-mentioned primer, obtain PCR primer, PCR primer is cloned on carrier pFastBac, obtains recombinant vectors.
Through order-checking, this recombinant vectors, for the PB1 subunit coding gene shown in sequence in sequence table in sequence table 4 and the DNA molecular that adds 6 his label coding gene fusion after it are inserted the recombinant vectors pFastBac-PB1 that in expression vector pFASTBAC, BamHI and XhoI restriction enzyme site obtains, is restructuring donor plasmid pFastBac-PB1.
(3) acquisition of recombinant vectors pFastBac-PA
Aminoterminal primer is: 5 ': ATGGATCCATGGAAGACTTTGTGCGACAATGCTT; Carboxyl terminal primer is: ATCTCGAGCTATTTTAGTGCATGTGTGAGGAAGGAG.
With the full-length gene of PA synthesis for template, carry out pcr amplification with above-mentioned primer, obtain PCR primer, PCR primer is cloned on carrier pFastBac, obtains recombinant vectors.
Through order-checking, this recombinant vectors, for this recombinant vectors is for inserting the recombinant vectors obtained between BamHI and the XhoI restriction enzyme site of expression vector pFASTBAC by the encoding gene of PA subunit shown in sequence in sequence table in sequence table 6, is restructuring donor plasmid pFastBac-PA.
2), the preparation of recombinant baculovirus
(1) acquisition of recombination bacillus coli and recombinant shuttle plasmid
According to the laboratory manual that Invitrogen provides, using above-mentioned 1) recombinant vectors pFastBac-PB1, pFastBac-PA and pFastBac-PB2-37 of preparing be as donor plasmid transform Escherichia coli strain DH10Bac respectively, goal gene is recombinated with shuttle plasmid Bacmid under the assistance of the transposase of Helper plasmid expression, obtains recombinant bacterium PB1, recombinant bacterium PA and recombinant bacterium PB2-37.
Extracting the Bacmid plasmid of recombinant bacterium PB1, is recombinant shuttle vector Bacmid-PB1;
Extracting the plasmid of recombinant bacterium PA, is recombinant shuttle vector Bacmid-PA;
Extracting the plasmid of recombinant bacterium PB2-37, is recombinant shuttle vector Bacmid-PB2-37.
(2) preparation of recombinant baculovirus
Influenza virus RNA polymerase three subunits can form complex body closely.
By recombinant shuttle vector Bacmid-PB2-37, Bacmid-PB1, Bacmid-PA transfection insect cell Sf9 clone respectively, within 72 hours, collect supernatant liquor respectively, obtain the recombinant baculovirus of expressing the recombinant baculovirus of PB2-37, the recombinant baculovirus of expressing PB1, expression PA, obtain the virus of the first-generation (P1) each subunit expression thus.
By the recombinant baculovirus of the expression PB2-37 of above-mentioned generation, express PB1 recombinant baculovirus, express the recombinant baculovirus of PA respectively by twice transfection insect cell system Sf9 cell to carry out virus amplification, the recombinant baculovirus that the P3 representative obtaining increasing reaches the recombinant baculovirus of PB2-37, P3 representative reaches PB1, P3 representative reach the recombinant baculovirus of PA.
Detect titre, P3 can reach more than 107pfu/mL for virus titer, may be used for protein expression purifying.If virus titer is lower, available P3 infects Sf9 clone again for virus, obtains the higher P4 of titre for baculovirus for protein expression.
3), the expression of influenza virus RNA polymerase
By above-mentioned 2) obtain P3 representative reaches the recombinant baculovirus of PB2-37, P3 representative reaches PB1 recombinant baculovirus, P3 representative reaches after the mixing of the titre amount (titre is 108pfu/mL) such as the recombinant baculovirus of PA by 10viruspaticles/Cell (MOI=10; MOI:multiplicity of infection) transfection insect cell High Five, 48 h before harvest nutrient solutions, 500 × g4 DEG C of centrifugal 10 minutes collecting cell.The cell of above-mentioned results is dissolved in (25mM Tris in lysis buffer according to 1:10 (quality: volume), 250mM NaCl, pH8.0), use sonicated cells, specifically in 0 DEG C of ice liquid, the container that cell suspension is housed is placed in insulation, under 30w power/50mL cell solution ratio, stop 6 seconds modes according to ultrasonic 3 seconds and amount to the abundant cracking of the ultrasonication mode of 30 minutes, afterwards, 40,000 × g4 DEG C centrifugal 30 minutes, and collecting cell lysate supernatant liquor, is the supernatant liquor containing PB2-37 truncate influenza virus RNA polymerase.Can repeatedly centrifugal 2 times to remove impurity as far as possible.
Above-mentioned lysis buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 250mM NaCl, 25mM Tris, and the pH value regulating lysis buffer is 8.0.
2, the affinity chromatography purifying of influenza virus RNA polymerase
The supernatant liquor containing PB2-37 truncate influenza virus RNA polymerase obtained above-mentioned 1 is drawn in the beaker of precooling, and add the nickel post magnetic bead (Nickel Beads) that appropriate lysis buffer is cleaned, 4 DEG C in conjunction with 1 hour.Within centrifugal 3 minutes, collect Beads for 500 × g4 DEG C, with lysis buffer cleaning Beads5 time.Add elution buffer wash-out Beads, collect elutriant; 30,000 × g4 DEG C centrifugal 30 minutes, gets supernatant liquor, is the PB2-37 truncate influenza virus RNA polymerase of purifying.
Be that the concentrated and purified PB2-37 truncate influenza virus RNA polymerase of 30,000 daltonian super filter tube is to 1mL with molecular weight cut-off.
Above-mentioned elution buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 25mM4-hydroxyethyl piperazine ethanesulfonic acid, 200mM NaCl, 250mM imidazoles, 10% glycerol; The pH value regulating elution buffer is 7.8.
The PB2-37 truncate influenza virus RNA polymerase SDS-PAGE of above-mentioned purifying is detected.
As shown in Figure 2, Lane1,2,3 represents the PB2-37 truncate influenza virus RNA polymerase after the PB2-37 truncate influenza virus RNA polymerase after 5 microgram purifying, 2.5 microgram purifying, the PB2-37 truncate influenza virus RNA polymerase after 3 microgram purifying to result respectively; Can find out, obtain molecular weight and be about the PB1 subunit band of 80KD, the PA band being slightly smaller than 80KD and the PB2 band (4KD) containing 37 amino-acid residues may be seen indistinctly, show, obtain PB2-37 truncate influenza virus RNA polymerase.
Reclaim the band of each subunit respectively, send to and carry out albumen n end order-checking, verify really obtain three subunits of H5N1 influenza virus RNA polymerase, showing that the band of the object size of electrophoresis detection obtains is really three subunits of H5N1 influenza virus RNA polymerase.
Calculate content, often liter of nutrient solution can obtain the purifying RNA polysaccharase (PA-PB2-PB2-37) of 1mg.
Two, the extensive expression of influenza virus RNA polymerase, purifying
1, influenza virus RNA polymerase is expressed on a large scale
Use the Tissue Culture Flask of waves reactor or Erlenmeyer flask or other type, use SF900II SFM substratum suspension culture 20L High Five cell, when cell density grows to 2 × 106cells/mL, the P3 representative obtained above-mentioned one reaches the recombinant baculovirus of PB2-37, P3 representative reaches the recombinant baculovirus of PB1, add by 1% (volume/volume) after P3 representative reaches titre amount (titre the is 108pfu/mL) mixing such as the recombinant baculovirus of PA, cultivate 60 hours for 27 DEG C, use whizzer at 4 DEG C, centrifugal 10 minutes collecting cells under centrifugal force 4000g.
In culturing process, open the oxygen supply system of waves reactor to the continuous supplemental oxygen of culture bag.As used Erlenmeyer flask or other cell type culturing bottle then only need keep ventilating, do not need special oxygenating mode.
Above-mentioned collecting cell is dissolved in lysis buffer according to 1:10 (quality: volume), ultrasonication method smudge cells, sonicated cells is used to be that the container that cell suspension is housed is placed in insulation in 0 DEG C of ice liquid, under 30w power/50mL cell solution ratio, according to the abundant cracking of mode stopping 6 seconds modes for ultrasonic 3 seconds and amount to ultrasonication 10-30 minute, afterwards, 40,000 × g4 DEG C centrifugal 60 minutes, collecting cell lysate supernatant liquor, is the supernatant liquor containing PB2-37 truncate influenza virus RNA polymerase.
Above-mentioned lysis buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 250mM NaCl, 25mM Tris, and the pH value regulating lysis buffer is 8.0.
2, the purifying of influenza virus RNA polymerase
A: affinity chromatography
The supernatant liquor containing PB2-37 truncate influenza virus RNA polymerase obtained above-mentioned 1 is drawn in the beaker of precooling, and add the nickel post magnetic bead (Nickel Beads) that appropriate lysis buffer is cleaned, 4 DEG C in conjunction with 3 hours.Within centrifugal 3 minutes, collect Beads for 500 × g4 DEG C, with lysis buffer cleaning Beads5 time.Now Beads can be added in the chromatography column of the sky of a corresponding size, clean with scavenging solution further.(supernatant liquor of centrifugal acquisition also directly can add in the pillar containing nickel post magnetic bead and combines by this step, then carry out rinsing on post and elution process so that affinity purification object complex body) after cleaning fully, add elution buffer and rinse Beads, now protein complexes is eluted from beads, usually need with 2 times-5 times Beads volume wash-out target proteins, collect elutriant, obtain affinitive layer purification PB2-37 truncate influenza virus RNA polymerase (electrophoresis detection, result is consistent with Fig. 2, illustrates and obtains target protein).
Be that 30,000 daltonian super filter tube is concentrated into 5mL with molecular weight cut-off, obtain concentrating sample after affinity chromatography.
By concentrating sample 16,000 × g4 DEG C centrifugal 30 minutes, collects supernatant liquor (after concentrated, albumen polymeric precipitation, is collected in the albumen existed in supernatant liquor and carries out following experiment).
Above-mentioned elution buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 25mM4-hydroxyethyl piperazine ethanesulfonic acid, 200mM NaCl, 250mM imidazoles, 10% glycerol; The pH value regulating elution buffer is 7.8.
B, ion exchange chromatography
Need to be further purified by the target protein of affinity chromatography preliminary purification, the method for first-selected cation-exchange chromatography.
Process is as follows: in the tomography devices such as AKTA FPLC or AKTA Purifier, use low salt buffer balance cation exchange column HiTrap S HP (containing medium beads5mL, come from GE Healthcare, chromatography column diameter is about 1 centimetre, be about is 3 centimetres), supernatant liquor after the concentrating sample obtained by above-mentioned A with the loading ring of the FPLC system Purifier10 purchased from GE company is centrifugal) input horizon analysis system, after the affinity chromatography that above-mentioned A is obtained, concentrating sample supernatant liquor slowly flows through ion exchange column, and target protein will be combined on ion exchange column.To be on the safe side, collect the sample not being attached to ion exchange column, again this stream can be worn sample loading, further combine to obtain, continuation low salt buffer cleans ion exchange column afterwards, till ultraviolet absorption value does not have considerable change.Adjustment buffer solution elution mode, with 200mM to 400mM salt concn linear gradient elution sample.
Result as shown in Figure 1A, the elutriant (corresponding Peak1 peak) that collection 200mM to 400mM wash-out obtains is PB2-37 truncate influenza virus RNA polymerase (electrophoresis detection after cation exchange chromatography, result is consistent with Fig. 2, illustrates and obtains target protein).
Be that 30,000 daltonian super filter tube is concentrated into 1mL by influenza virus RNA polymerase molecular weight cut-off after cation exchange chromatography, obtain concentrating sample after ion exchange chromatography.
By concentrating sample 16,000 × g4 DEG C centrifugal 30 minutes, collects supernatant liquor.
Above-mentioned low salt buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 25mM4-hydroxyethyl piperazine ethanesulfonic acid, 200mM NaCl; PH value is 7.8;
Above-mentioned high-salt buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 25mM4-hydroxyethyl piperazine ethanesulfonic acid, 1M NaCl; PH7.8.
C, gel chromatography
With gel chromatography damping fluid balanced gel chromatography column Superdex20016/60 molecular sieve (GE healthcare, 1.6 centimetres, post footpath, column length 60 centimetres) concentrating sample supernatant liquor injects gel chromatography system, by the flow velocity gel chromatography elution buffer elution samples of per minute 1mL after the ion exchange chromatography that obtained by above-mentioned B.
Observe ultraviolet absorption value, according to occurring that sample is collected in the position that ultraviolet absorption peak is corresponding.
Result is as Figure 1B, and under collecting 280nM or 260nM, 66 ± 2mL place goes out elutriant corresponding to peak (electrophoresis detection, result is consistent with Fig. 2, illustrates and obtains target protein), is purifying PB2-37 truncate influenza virus RNA polymerase.
Above-mentioned gel chromatography elution buffer is prepared as follows: following solute is dissolved in the solution obtained in water according to following final concentration: 25mM HEPES, 200mM NaCl, 1mM EDTA, and the pH value regulating gel chromatography damping fluid is 7.8.
With molecular weight cut-off be the daltonian super filter tube of 30,000-concentrated and purified PB2-37 truncate influenza virus RNA polymerase to 1mL, obtain concentrated PB2-37 truncate influenza virus RNA polymerase.
By concentrating sample 16,000 × g4 DEG C centrifugal 30 minutes, collects supernatant liquor.
Three, influenza virus RNA polymerase is combined with the nucleic acid promoter double-stranded RNA of influenza virus
In order to crystallization, must by influenza virus RNA polymerase bind nucleic acid, in virus, usual influenza virus RNA polymerase and its promoter nucleic acid (RNA) combine usually, specific as follows:
1, the acquisition of promoter nucleic acid (RNA)
First, two chains of cRNA or the vRNA promoter of resultant current Influenza Virus, totally four RNA, sequence is respectively: Article 1: 5'-AGUAGAAACAAGGGUG-3' contains 16 Nucleotide; Article 2: 5'-CACCCUGCUUUUGCU-3', containing 15 Nucleotide; Article 3: 5'-AGCAAAAGCAGGGUG-3', containing 15 Nucleotide; Article 4: 5'-CACCCUUGUUUCUACU-3', containing 16 Nucleotide.Wherein, first and second RNA is two marriage chains of vRNA promoter, and they press 1:1 mixed in molar ratio, forms vRNA promoter.
3rd is two articles of marriage chains of cRNA promoter with Article 4 RNA, and they press 1:1 mixed in molar ratio, formation cRNApromoter.
Two of vRNA promoter chains are pressed 1:1 mixing, (Annealing) operation of carrying out annealing (95 DEG C 5 minutes after, transfer to rapidly 0 DEG C of insulation), obtains vRNA promoter.
Equally, two of cRNA promoter chains are pressed 1:1 mixing, (Annealing) operation of carrying out annealing (95 DEG C 5 minutes after, transfer to rapidly 0 DEG C of insulation), obtains cRNA promoter.
2, influenza virus RNA polymerase is combined with promoter double-stranded RNA
Add vRNA promoter in the concentrating sample supernatant liquor that C method gel chromatography above-mentioned two obtains, in 0 DEG C, be incubated 0.5 hour, obtain the PB2-37 truncate influenza virus RNA polymerase in conjunction with vRNA promoter.
By the above-mentioned PB2-37 truncate influenza virus RNA polymerase in conjunction with vRNA promoter according to above-mentioned two C method gel chromatography, shown in result Fig. 1 C, under collecting 280nM or 260nM, 66 ± 2mL place goes out elutriant corresponding to peak, for purifying is in conjunction with the influenza virus RNA polymerase of vRNA promoter, explanation add RNA promoter after protein complex go out peak position still for the PB2-37 truncate influenza virus RNA polymerase of 66mL, description taken in conjunction vRNA promoter is monomer (about 165KD).
Adopt and use the same method by vRNA promoter in conjunction with PB2-37 truncate influenza virus RNA polymerase, result is consistent with above-mentioned.
Four, the crystallization of influenza virus RNA polymerase
The PB2-37 truncate influenza virus RNA polymerase in conjunction with vRNA promoter obtained by three and the PB2-37 truncate influenza virus RNA polymerase in conjunction with cRNApromoter, after concentrated, reach 20mg/mL concentration, may be used for carrying out crystallization experiment.
Adopt the crystalline reagents box (hampton reaserch company) be purchased, by the PB2-37 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-37 truncate influenza virus RNA polymerase in conjunction with cRNA promoter after above-mentioned concentrating, all crystallizations under crystallization buffer condition is 5%PEG20000,100mMTrisHCL (pH8.5), 250mMNaCL and 16 DEG C temperature environment.
In conjunction with vRNA promoter PB2-37 truncate influenza virus RNA polymerase crystallization figure as shown in Figure 7 A, in conjunction with cRNApromoter PB2-37 truncate influenza virus RNA polymerase crystallization figure as shown in Figure 7 B, can find out, all obtain the influenza virus RNA polymerase crystal being similar to rectangle outward appearance.
In order to determine for the purpose of this, whether protein crystal is influenza virus RNA polymerase crystal, after taking out crystal, use precipitation agent repetitive scrubbing, remove the protein solution be bonded on crystal, the crystal cleaned carries out SDS-PAGE electrophoretic analysis, result shown in result with Fig. 2 is consistent, illustrates that this crystal is PB2-37 truncate influenza virus RNA polymerase crystallographic.
The crystallization of embodiment 2, influenza virus RNA polymerase containing PB2-130 truncate
Pre-crystallized polymeric three subunits of influenza virus RNA polymerase of the present embodiment comprise PB1 albumen, PA albumen and PB2-130 truncate;
The aminoacid sequence of PB2-130 truncate be sequence 2 from 5 ' end 1-130 amino acids, corresponding nucleotides sequence is classified as sequence 5 from 5 ' end 1-390 position Nucleotide.
One, the acquisition of influenza virus RNA polymerase
1, the expression of each subunit of influenza virus RNA polymerase
1), the structure of the recombinant vectors of each subunit of expression of influenza viral rna polymerase
Because the later stage will carry out ni-sepharose purification, therefore need to add HIS label at the carboxyl terminal of subunit PB2-130 or PB1, all test for two kinds, find in complex body expression process, only on any one subunit of subunit PB2-130 and PB1, PB1 and PB2 subunit need be there is no need and all contains histone label simultaneously containing histidine-tagged albumen.
HIS label is added at the carboxyl terminal of subunit PB2-130, the carboxyl terminal primer of amplification subunit PB2-130 encoding gene be 5 ' ATCTCGAGCTAGTGGTGGTGGTGGTGGTGGAAGGTTCCATGTTTTAACCTTTCAAC C3 ' containing terminator, histidine-tagged containing 6 series connection;
Do not add HIS label at the carboxyl terminal of subunit PB2-130, the carboxyl terminal primer of amplification subunit PB2-130 encoding gene is: 5 ' ATCTCGAGCTAGAAGGTTCCATGTTTTAACCTTTCAACC3 ';
Experiment below adds HIS label to be at the carboxyl terminal of PB1.
(1) acquisition of recombinant vectors pFastBac-PB2-130
Aminoterminal primer sequence is: 5 ' ATGGATCCATGGAGAGAATAAAAGAATTAAGAG3 '; Carboxyl terminal primer is: 5 ' ATCTCGAGCTAGAAGGTTCCATGTTTTAACCTTTCAACC3 ' (containing terminator, not containing histidine-tagged).
With the encoding gene of PB2 albumen for template, carry out pcr amplification with above-mentioned aminoterminal primer and carboxyl terminal primer, obtain PCR primer.
By this PCR primer respectively enzyme be connected to after cutting on the cloning site on carrier pFastBac plasmid, thus construct and express the PB2 aminoterminal recombinant vectors containing 1-130 amino acids residue segment.
Through order-checking, this recombinant vectors is for inserting between BamHI and the XhoI restriction enzyme site of expression vector pFASTBAC carrier by sequence in sequence table 5 from the encoding gene of the PB2-130 truncate albumen shown in 5 ' end 1-390 position Nucleotide, express PB2-130 truncate albumen, the recombinant vectors obtained, called after pFastBac-PB2-130.
(2) acquisition of recombinant vectors pFastBac-PB1: identical with embodiment 1 method.
(3) acquisition of recombinant vectors pFastBac-PA: identical with embodiment 1 method.
2) preparation of recombinant baculovirus: substantially identical with embodiment 1 method, replace with pFastBac-PB2-130 unlike by pFastBac-PB2-37, obtain P3 representative reaches the recombinant baculovirus of PB2-130, P3 representative reaches PB1 recombinant baculovirus, P3 representative reaches the recombinant baculovirus of PA.
3), the expression of influenza virus RNA polymerase
According to the method for embodiment 1, by above-mentioned 2) obtain P3 representative reaches the recombinant baculovirus of PB2-130, P3 representative reaches PB1 recombinant baculovirus, P3 representative proceeds to cell High Five after reaching the mixing of the titre amount (titre is 108pfu/mL) such as the recombinant baculovirus of PA, cracking, obtains the supernatant liquor containing PB2-130 truncate influenza virus RNA polymerase.
2, the nickel affinity chromatography purifying of influenza virus RNA polymerase
The supernatant liquor containing PB2-130 truncate influenza virus RNA polymerase obtained above-mentioned 1 carries out affinity chromatography purifying according to the method for above-described embodiment 1, obtains the PB2-130 truncate influenza virus RNA polymerase of purifying.
The PB2-130 truncate influenza virus RNA polymerase SDS-PAGE of above-mentioned purifying is detected.
Result as shown in Figure 5,1-130 is the PB2-130 truncate influenza virus RNA polymerase of purifying, can find out, obtain 130 amino-acid residue bands that molecular weight is about the PB1 subunit band of 80KD, the PA band being slightly smaller than 80KD and 14KD PB2, show, obtain PB2-130 truncate influenza virus RNA polymerase.
Reclaim the band of each subunit respectively, send to and carry out albumen n end order-checking, verify really obtain three subunits of H5N1 influenza virus RNA polymerase, showing that the band of the object size of electrophoresis detection obtains is really three subunits of H5N1 influenza virus RNA polymerase.
Calculate content, often liter of nutrient solution can obtain the purifying RNA polysaccharase (PA-PB1-PB2-130) of 0.8mg.
Two, the extensive expression of influenza virus RNA polymerase, purifying
1, influenza virus RNA polymerase is expressed on a large scale
High Five cell, cultivation, cracking is added by 1% (volume/volume) after reaching the mixing of the titre amount (titre is 108pfu/mL) such as the recombinant baculovirus of PA according to the recombinant baculovirus that P3 representative to be reached the recombinant baculovirus of PB2-130 by the method for embodiment 1, P3 representative reaches PB1, P3 representative, collect supernatant liquor, obtain the supernatant liquor containing PB2-130 truncate influenza virus RNA polymerase.
2, the purifying of influenza virus RNA polymerase
A: affinity chromatography
The supernatant liquor containing PB2-130 truncate influenza virus RNA polymerase obtained above-mentioned 1 according to the method for embodiment 1 carries out affinity chromatography, with 2 times-5 times Beads volume wash-out target proteins, collect elutriant, obtain affinitive layer purification PB2-130 truncate influenza virus RNA polymerase.
Electrophoresis detection, result, as shown in the swimming lane 1 and 2 of Fig. 4 A, can be found out, obtains 130 amino-acid residue bands that molecular weight is about the PB1 subunit band of 80KD, the PA band being slightly smaller than 80KD and 14KD PB2, show, obtain PB2-130 truncate influenza virus RNA polymerase.
B, ion exchange chromatography
According to the method for embodiment 1, the PB2-130 truncate influenza virus RNA polymerase after above-mentioned A purifying is carried out ion exchange chromatography, with 200mM to 400mM salt concn linear gradient elution sample.
As shown in Figure 4 B, the elutriant (corresponding main peak) that collection 200mM to 400mM wash-out obtains is PB2-130 truncate influenza virus RNA polymerase after cation exchange chromatography to result.
Electrophoresis detection, result, as shown in the swimming lane 3 of Fig. 4 A, illustrates and obtains target protein.
C, gel chromatography
According to the method for embodiment 1, the supernatant liquor of the PB2-130 truncate influenza virus RNA polymerase after above-mentioned B purifying is carried out gel chromatography, result as shown in Figure 3, be approximately 58 milliliters of places under collecting 280nM or 260nM and go out elutriant corresponding to peak, corresponding molecular weight is complex body disome size, it is different that the influenza virus RNA polymerase complex body sample containing PB2-37 that this and purifying are expressed goes out peak position, is purifying PB2-130 truncate influenza virus RNA polymerase.
Electrophoresis detection, result, as shown in the swimming lane 5 and 6 of Fig. 4 A, illustrates and obtains target protein.
Three, influenza virus RNA polymerase is combined with the nucleic acid promoter double-stranded RNA of influenza virus
1, the acquisition of promoter nucleic acid (RNA): identical with embodiment 1.
2, influenza virus RNA polymerase is combined with promoter double-stranded RNA
Substantially the same manner as Example 1, unlike replacing with purifying PB2-130 truncate influenza virus RNA polymerase, obtain the PB2-130 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-130 truncate influenza virus RNA polymerase in conjunction with cRNA promoter.
By the PB2-130 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-130 truncate influenza virus RNA polymerase gel chromatography in conjunction with RNA.
Shown in result Fig. 4 C, collect the lower 53 milliliters of places of 280nM and go out elutriant corresponding to peak, for PB2-130 truncate influenza virus RNA polymerase (the limbs form in conjunction with vRNA promoter, molecular weight is about 720KD), collect lower 68 milliliters of 280nM and go out elutriant corresponding to peak, for PB2-130 truncate influenza virus RNA polymerase (monomeric form, molecular weight is about 180KD), 58 milliliters of places go out elutriant corresponding to peak, for the PB2-130 truncate influenza virus RNA polymerase (dimeric form in conjunction with vRNA promoter, molecular weight is about 360KD), show that PB2-130 truncate influenza virus RNA polymerase mainly exists with disome (when not adding RNA promotor) and limbs (after adding RNA promotor) form, instead of the monomer existence form of PB2-37 truncate influenza virus RNA polymerase.
PB2-130 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-130 truncate influenza virus RNA polymerase result in conjunction with cRNA promoter are without significant difference.
PB2-130 truncate influenza virus RNA polymerase disome and limbs are carried out Electron microscope observation, and as shown in Figure 6 A and 6B, 6A is disome to result, and 6B is limbs.
Four, the crystallization of influenza virus RNA polymerase
Adopt the crystalline reagents box (hampton reaserch company) be purchased, by the PB2-130 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-130 truncate influenza virus RNA polymerase in conjunction with cRNA promoter after above-mentioned concentrating, all crystallizations under crystallization buffer condition is 2%PEG10000,100mMTrisHCL (pH8.5), 50mMNaCL and 4 DEG C temperature environment.
In conjunction with vRNA promoter PB2-130 truncate influenza virus RNA polymerase crystallization figure as shown in figures 6 c and 7 c, in conjunction with cRNA promoter PB2-130 truncate influenza virus RNA polymerase crystallization figure as illustrated in fig. 7d, can find out, all obtain the influenza virus RNA polymerase crystal being similar to rectangle outward appearance.
In order to determine for the purpose of this, whether protein crystal is influenza virus RNA polymerase crystal, after taking out crystal, use precipitation agent repetitive scrubbing, remove the protein solution be bonded on crystal, the crystal cleaned carries out SDS-PAGE electrophoretic analysis, result as shown in Figure 6 D, illustrates that this crystal is PB2-130 truncate influenza virus RNA polymerase crystal.
The crystallization of embodiment 3, influenza virus RNA polymerase containing PB2-103 truncate
Pre-crystallized polymeric three subunits of influenza virus RNA polymerase of the present embodiment comprise PB1 albumen, PA albumen and PB2-103 truncate;
The aminoacid sequence of PB2-103 truncate be sequence 2 from 5 ' end 1-103 amino acids, corresponding nucleotides sequence is classified as sequence 5 from 5 ' end 1-309 position Nucleotide.
One, the acquisition of influenza virus RNA polymerase
1, the expression of each subunit of influenza virus RNA polymerase
1), the structure of the recombinant vectors of each subunit of expression of influenza viral rna polymerase
Because the later stage will carry out ni-sepharose purification, therefore need to add HIS label at the carboxyl terminal of subunit PB2-130 or PB1, all test for two kinds, find in complex body expression process, only on any one subunit of subunit PB2-103 and PB1, PB1 and PB2 subunit need be there is no need and all contains histone label simultaneously containing histidine-tagged albumen.
HIS label is added at the carboxyl terminal of subunit PB2-103, the carboxyl terminal primer of amplification subunit PB2-103 encoding gene be 5 ' ATCTCGAGTTAGTGGTGGTGGTGGTGGTGCCCATTCCTGTTCCACCAACTTAC3 ' containing terminator, histidine-tagged containing 6 series connection;
Do not add HIS label at the carboxyl terminal of subunit PB2-103, the carboxyl terminal primer of amplification subunit PB2-103 encoding gene is: 5 ' ATCTCGAGTTACCCATTCCTGTTCCACCAACTTAC3 ';
Experiment below adds HIS label to be at the carboxyl terminal of PB1.
(1) acquisition of recombinant vectors pFastBac-PB2-130
With the encoding gene of PB2 albumen for template, carry out pcr amplification with above-mentioned aminoterminal primer and carboxyl terminal primer, obtain PCR primer.
By this PCR primer respectively enzyme be connected to after cutting on the cloning site on carrier pFastBac plasmid, thus construct and express the PB2 aminoterminal recombinant vectors containing 1-103 amino acids residue segment.
Through order-checking, this recombinant vectors is for inserting between BamHI and the XhoI restriction enzyme site of expression vector pFASTBAC carrier by sequence in sequence table 5 from the encoding gene of the PB-103 truncate albumen shown in 5 ' end 1-309 position Nucleotide, express PB-103 truncate albumen, the recombinant vectors obtained, called after pFastBac-PB2-103.
(2) acquisition of recombinant vectors pFastBac-PB1: identical with embodiment 1 method.
(3) acquisition of recombinant vectors pFastBac-PA: identical with embodiment 1 method.
2) preparation of recombinant baculovirus: substantially identical with embodiment 1 method, replace with pFastBac-PB2-103 unlike by pFastBac-PB2-37, obtain P3 representative reaches the recombinant baculovirus of PB2-103, P3 representative reaches PB1 recombinant baculovirus, P3 representative reaches the recombinant baculovirus of PA.
3), the expression of influenza virus RNA polymerase
According to the method for embodiment 1, by above-mentioned 2) obtain P3 representative reaches the recombinant baculovirus of PB2-103, P3 representative reaches PB1 recombinant baculovirus, P3 representative proceeds to cell High Five after reaching the mixing of the titre amount (titre is 108pfu/mL) such as the recombinant baculovirus of PA, cracking, obtains the supernatant liquor containing PB2-103 truncate influenza virus RNA polymerase.
2, the nickel affinity chromatography purifying of influenza virus RNA polymerase
The supernatant liquor containing PB2-103 truncate influenza virus RNA polymerase obtained above-mentioned 1 carries out affinity chromatography purifying according to the method for above-described embodiment 1, obtains the PB2-103 truncate influenza virus RNA polymerase of purifying.
The PB2-103 truncate influenza virus RNA polymerase SDS-PAGE of above-mentioned purifying is detected.
Result as shown in Figure 5,1-103 is the PB2-103 truncate influenza virus RNA polymerase of purifying, can find out, obtain 103 amino-acid residue bands that molecular weight is about the PB1 subunit band of 80KD, the PA band being slightly smaller than 80KD and 11KD PB2, show, obtain PB2-103 truncate influenza virus RNA polymerase.
Reclaim the band of each subunit respectively, send to and carry out albumen n end order-checking, verify really obtain three subunits of H5N1 influenza virus RNA polymerase, showing that the band of the object size of electrophoresis detection obtains is really three subunits of H5N1 influenza virus RNA polymerase.
Calculate content, often liter of nutrient solution can obtain the purifying RNA polysaccharase (PA-PB1-PB2-103) of 5mg.
Two, the extensive expression of influenza virus RNA polymerase, purifying
1, influenza virus RNA polymerase is expressed on a large scale
High Five cell, cultivation, cracking is added by 1% (volume/volume) after reaching the mixing of the titre amount (titre is 108pfu/mL) such as the recombinant baculovirus of PA according to the recombinant baculovirus that P3 representative to be reached the recombinant baculovirus of PB2-103 by the method for embodiment 1, P3 representative reaches PB1, P3 representative, collect supernatant liquor, obtain the supernatant liquor containing PB2-103 truncate influenza virus RNA polymerase.
2, the purifying of influenza virus RNA polymerase
A: affinity chromatography
The supernatant liquor containing PB2-103 truncate influenza virus RNA polymerase obtained above-mentioned 1 according to the method for embodiment 1 carries out affinity chromatography, with 2 times-5 times Beads volume wash-out target proteins, collect elutriant, obtain affinitive layer purification PB2-103 truncate influenza virus RNA polymerase.
Electrophoresis detection, in the same size with the 1-103 of Fig. 5.Show, obtain PB2-103 truncate influenza virus RNA polymerase.
B, ion exchange chromatography
According to the method for embodiment 1, the PB2-103 truncate influenza virus RNA polymerase after above-mentioned A purifying is carried out ion exchange chromatography, with 200mM to 400mM salt concn linear gradient elution sample, result is consistent with Fig. 4 B, and the elutriant (corresponding main peak) that collection 200mM to 400mM wash-out obtains is PB2-103 truncate influenza virus RNA polymerase after cation exchange chromatography.
Electrophoresis detection, the 1-103 of result Fig. 5 is in the same size, illustrates and obtains target protein.
C, gel chromatography
According to the method for embodiment 1, the supernatant liquor of the PB2-103 truncate influenza virus RNA polymerase after above-mentioned B purifying is carried out gel chromatography by the method for embodiment 1, result is consistent with Fig. 3.
Electrophoresis detection, the 1-103 of result Fig. 5 is in the same size, illustrates and obtains target protein.
Three, influenza virus RNA polymerase is combined with the nucleic acid promoter double-stranded RNA of influenza virus
1, the acquisition of promoter nucleic acid (RNA): identical with embodiment 1.
2, influenza virus RNA polymerase is combined with promoter double-stranded RNA
Substantially the same manner as Example 1, unlike replacing with purifying PB2-103 truncate influenza virus RNA polymerase, obtain the PB2-103 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-103 truncate influenza virus RNA polymerase in conjunction with cRNA promoter.
By the PB2-103 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-103 truncate influenza virus RNA polymerase gel chromatography in conjunction with RNA.
Shown in result is consistent with Fig. 4 C, collecting the lower 53 milliliters of places of 280nM and go out elutriant corresponding to peak, is the PB2-103 truncate influenza virus RNA polymerase (limbs form, molecular weight is 720KD) in conjunction with vRNA promoter; Collect lower 68 milliliters of 280nM and go out elutriant corresponding to peak, for PB2-103 truncate influenza virus RNA polymerase (dimeric form, molecular weight is 360KD), collect lower 58 milliliters of 280nM and go out elutriant corresponding to peak, for PB2-103 truncate influenza virus RNA polymerase (monomeric form, molecular weight is 180KD); Show that PB2-103 truncate influenza virus RNA polymerase mainly exists with disome (when not adding RNA promotor) and limbs (after adding RNA promotor) form, instead of the monomer existence form of PB2-37 truncate influenza virus RNA polymerase.
PB2-103 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-103 truncate influenza virus RNA polymerase result in conjunction with cRNA promoter are without significant difference.
Four, the crystallization of influenza virus RNA polymerase
Adopt the crystalline reagents box (hampton reaserch company) be purchased, by the PB2-103 truncate influenza virus RNA polymerase in conjunction with vRNA promoter and the PB2-103 truncate influenza virus RNA polymerase in conjunction with cRNA promoter after above-mentioned concentrating, all crystallizations under crystallization buffer condition is 30%PEG20000,100mMTrisHCL (pH8.5), 500mMNaCL and 20 DEG C temperature environment.
In conjunction with vRNA promoter PB2-103 truncate influenza virus RNA polymerase crystallization figure as seen in figure 7e, in conjunction with cRNA promoter PB2-103 truncate influenza virus RNA polymerase crystallization figure as shown in Figure 7 F, can find out, all obtain the influenza virus RNA polymerase crystal being similar to rectangle outward appearance.
In order to determine for the purpose of this, whether protein crystal is influenza virus RNA polymerase crystal, after taking out crystal, use precipitation agent repetitive scrubbing, remove the protein solution be bonded on crystal, the crystal cleaned carries out SDS-PAGE electrophoretic analysis, result is consistent with the 1-103 of Fig. 5, illustrates that this crystal is PB2-103 truncate influenza virus RNA polymerase crystal.
Claims (10)
1. an influenza virus RNA polymerase complex body express, the method for purifying and crystallization, for first by encoding gene coexpression, purifying in vitro insect cell of the PB1 subunit coding gene of influenza virus RNA polymerase, PA subunit coding gene and PB2 subunit truncate, obtain RNA polymerase, again described RNA polymerase is combined with RNA and forms complex body, again by described complex body crystallization, obtain influenza virus RNA polymerase crystal;
Described PB2 subunit truncate is made up of PB2 subunit 1 to N amino acids residue from N-terminal; Arbitrary natural number in N=37-280.
2. method according to claim 1, is characterized in that:
Described PB2 subunit truncate is made up of PB2 subunit 1 to N amino acids residue from N-terminal; Arbitrary natural number in N=37-130.
3. method according to claim 2, is characterized in that:
Described PB2 subunit truncate is following 1) or 2) or 3):
1) for PB2 yldeneamino acid sequence from N-terminal first 37 amino-acid residue formed albumen;
2) for PB2 yldeneamino acid sequence from N-terminal first 130 amino-acid residue formed albumen;
3) for PB2 yldeneamino acid sequence from N-terminal first 103 amino-acid residue formed albumen.
4., according to described method arbitrary in claim 1-3, it is characterized in that:
Described insect cell is High Five cell;
Described influenza virus is influenza A, and the virus strain of described influenza A is specially H5N1, H1N1 or H3N2.
5., according to described method arbitrary in claim 1-4, it is characterized in that:
Described by the encoding gene of the PB1 subunit coding gene of influenza virus RNA polymerase, PA subunit coding gene and PB2 subunit truncate coexpression employing Bac-to-Bac baculovirus expression system in insect cell, donor plasmid in described Bac-to-Bac baculovirus expression system is pFastBac, intestinal bacteria are DH10Bac, and insect cell is Sf9.
6., according to described method arbitrary in claim 1-5, it is characterized in that:
The aminoacid sequence of described PB1 subunit is for shown in sequence in sequence table 1;
The aminoacid sequence of described PA subunit is for shown in sequence in sequence table 3;
The aminoacid sequence of described PB2 subunit is for shown in sequence in sequence table 2;
1) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-37 position;
2) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-130 position;
3) aminoacid sequence of the described PB2 subunit truncate shown in be in sequence table sequence 2 from N-terminal 1-103 position.
7., according to described method arbitrary in claim 1-6, it is characterized in that:
The nucleotides sequence of the encoding gene of described PB1 subunit to be classified as in sequence table shown in sequence 4;
The nucleotides sequence of the encoding gene of described PA subunit to be classified as in sequence table shown in sequence 6;
1) nucleotides sequence of the encoding gene of the described PB2 subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-111 position;
2) nucleotides sequence of the encoding gene of the described PB2 subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-390 position;
3) nucleotides sequence of the encoding gene of the described PA subunit truncate shown in be classified as in sequence table sequence 5 from 5 ' end 1-309 position.
8., according to described method arbitrary in claim 1-7, it is characterized in that:
Described purifying be described RNA polymerase that coexpression is obtained successively through affinity chromatography, ion exchange chromatography and gel chromatography, obtain the RNA polymerase after purifying;
The damping fluid that described crystallization adopts by final concentration be the PEG1000-20000 of 2%-30%, final concentration is that the TrisHCL damping fluid that 50mM-500mMNaCL and concentration are 100mM, pH value is 8.5 forms;
The temperature that described crystallization adopts is 4 DEG C-20 DEG C.
9. the RNA polymerase crystal prepared by the arbitrary described method of claim 1-8.
10. the application of RNA polymerase crystal according to claim 9 in anti-influenza virus medicament screening or vaccine design and preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410162712.3A CN105018441A (en) | 2014-04-22 | 2014-04-22 | Method for crystallizing influenza virus RNA polymase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410162712.3A CN105018441A (en) | 2014-04-22 | 2014-04-22 | Method for crystallizing influenza virus RNA polymase |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105018441A true CN105018441A (en) | 2015-11-04 |
Family
ID=54408746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410162712.3A Pending CN105018441A (en) | 2014-04-22 | 2014-04-22 | Method for crystallizing influenza virus RNA polymase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018441A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101514335A (en) * | 2008-02-22 | 2009-08-26 | 中国科学院生物物理研究所 | Expression and purification of influenza virus polymerase PA and crystal structure of complex of polypeptides at amino terminal of PA, carboxyl terminal of PA and amino terminal of PB1 |
| CN101970465A (en) * | 2007-10-09 | 2011-02-09 | 欧洲分子生物学实验室(Embl) | Soluble fragments of influenza virus pb2 protein capable of binding rna-cap |
| CN103118709A (en) * | 2010-03-26 | 2013-05-22 | 新兴产品开发盖瑟斯堡有限公司 | Ectodomains of influenza matrix 2 protein, expression system, and uses thereof |
-
2014
- 2014-04-22 CN CN201410162712.3A patent/CN105018441A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101970465A (en) * | 2007-10-09 | 2011-02-09 | 欧洲分子生物学实验室(Embl) | Soluble fragments of influenza virus pb2 protein capable of binding rna-cap |
| CN101514335A (en) * | 2008-02-22 | 2009-08-26 | 中国科学院生物物理研究所 | Expression and purification of influenza virus polymerase PA and crystal structure of complex of polypeptides at amino terminal of PA, carboxyl terminal of PA and amino terminal of PB1 |
| CN103118709A (en) * | 2010-03-26 | 2013-05-22 | 新兴产品开发盖瑟斯堡有限公司 | Ectodomains of influenza matrix 2 protein, expression system, and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| AF380163.1: "Influenza A virus (A/goose/Guangdong/3/97(H5N1)) segment 3 polymerase (PA) gene,complete cds", 《GENBANK》 * |
| AY035888.1: "Influenza A virus (A/duck/Guangdong/12/2000(H5N1)) polymerase basic protein2 (PB2) mRNA,complete cds", 《GENBANK》 * |
| AY035888.1: "Influenza A virus (A/goose/Guangdong/3/97(H5N1)) polymerase basic protein 1 (PB1) gene, complete cds", 《GENBANK》 * |
| TAO DENG等: "In Vitro Assembly of PB2 with a PB1-PA Dimer Supports a New Model of Assembly of Influenza A Virus Polymerase Subunits into a Functional Trimeric Complex", 《JOURNAL OF VIROLOGY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104404074B (en) | The preparation method of hoof-and-mouth disease virus capsid protein series connection coexpression and virus-like particle | |
| AU2008224877B2 (en) | Virus like particle purification | |
| CN103890177B (en) | HPV chimaeric particles | |
| US9663766B2 (en) | Methods for purifying adenovirus vectors | |
| CN112089831B (en) | Preparation method of recombinant novel coronavirus subunit vaccine | |
| CN113512096B (en) | Weever rhabdovirus recombinant G2 protein and application thereof | |
| CA2955877A1 (en) | Process for the purification of poliovirus from cell cultures | |
| CN111448315B (en) | Method for separating DNA by Cas protein system | |
| CN106554965A (en) | For preparing the nucleic acid construct and method of EV71 virus-like particles | |
| CN111378017B (en) | Subunit F protein of peste des petits ruminants virus and preparation method and application thereof | |
| CN105002149A (en) | Influenza virus RNA polymerase purifying or crystallizing method | |
| Schlaeppi et al. | A semi-automated large-scale process for the production of recombinant tagged proteins in the Baculovirus expression system | |
| CN114480441B (en) | Nucleotide sequence and application of recombinant protein nanoparticles expressed by nucleotide sequence in canine distemper virus vaccine | |
| CN105018441A (en) | Method for crystallizing influenza virus RNA polymase | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN111378016B (en) | Subunit H protein of peste des petits ruminants virus, preparation method and application thereof | |
| Jaatinen et al. | Integral membrane protein P16 of bacteriophage PRD1 stabilizes the adsorption vertex structure | |
| CN105734097B (en) | A kind of MIM-I-BAR protein extraction purification process | |
| CN101857871B (en) | Method for purifying recombinant VP1 antigen of enterovirus type 71 viruses | |
| CN112430273A (en) | Subunit fusion protein mG on rabies virus surface as well as preparation method and application thereof | |
| CN105755008A (en) | DNA molecule for coding porcine alpha interferon and expression and purification method of recombinant protein of porcine alpha interferon | |
| Boumaiza et al. | Development of an Optimized Process for Functional Recombinant SARS-CoV-2 Spike S1 Receptor-Binding Domain Protein Produced in the Baculovirus Expression Vector System | |
| CN116375806A (en) | Preparation method of B/Austria/1359417/2021 (B/Victoria linear) HA antigen | |
| CN103911388B (en) | Recombinate the production technology of Exenatide | |
| TWI712691B (en) | Dextran affinity tag and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151104 |