CN105002105B - High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application - Google Patents
High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application Download PDFInfo
- Publication number
- CN105002105B CN105002105B CN201410167194.4A CN201410167194A CN105002105B CN 105002105 B CN105002105 B CN 105002105B CN 201410167194 A CN201410167194 A CN 201410167194A CN 105002105 B CN105002105 B CN 105002105B
- Authority
- CN
- China
- Prior art keywords
- gene
- seq
- ptsg
- bacterium
- galr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses high-biomass and/or Seedling height speed recombinant bacterium and its construction method and applications.The construction method of the recombinant bacterium includes carrying out the transformation of A1, A2 and A3 to recipient bacterium or carrying out the transformation of the A1 and the A2 to the recipient bacterium, obtains biomass and/or the speed of growth is higher than the recombinant bacterium of the recipient bacterium；The A1 is to knock out the phosphotransferase G subunit genes of the recipient bacterium；The A2 is by the galactolipin repressor gene knockout of the recipient bacterium；The A3 is to import glucokinase gene into the recipient bacterium；The recipient bacterium is Escherichia coli, Bacillus acidi lactici, streptococcus or haemophilus.The fast recombinant bacterium of high-biomass and/or the speed of growth that the present invention is built and production neurosporene recombinant bacterium are the fields such as biological study, medicine are with high application prospect and Development volue.
Description
Technical field
The present invention relates to high-biomass and/or Seedling height speed recombinant bacterium and its construction method and applications.
Background technology
The growth of engineered strain is the key that industrial fermentation.Thalli growth speed can extend manufacture cycle slowly, reduce efficiency,
Cost is improved, the large-scale application of bacterial strain is unfavorable for.And the cell density that thalline fermentation is finally reached is also vital.Cause
A kind of this speed of growth of urgent need is fast, the big bacterial strain of accessible cell density.
Terpenoid is the compound for structural unit by isoprene.The route of synthesis of terpenoid is divided into MVA
Approach and MEP approach.MEP approach is divided into two stages：1. generating intermediate isopentenyl pyrophosphate (Isopentenyl
Diphosphate IPP) and its double bond isomer dimethyl propyl pyrophosphoric acid (Dimethylallyl pyrophosphate
DMAPP in the) stage, 2. terpenes generate and its modification stage.Gene crtE, crtI and crtB can carry out continuously being catalyzed reaction,
Convert DMAPP to neurosporene.Using neurosporene as substrate, the product of a variety of high added values, such as tomato red can be produced
Element and astaxanthin.Lycopene is most strong one of antioxidant, can be with effectively preventing because of aging, and immunity degradation causes
Various diseases.In nature, astaxanthin has strongest natural anti-oxidation, has anti-oxidant, anti-aging, antitumor, pre-
A variety of effects such as anti-cardiovascular and cerebrovascular disease.Natural lycopene and astaxanthin complex process are obtained, it is of high cost, it is not suitable for advising greatly
Mould produces.And produced using microbial fermentation technology, cost can be effectively reduced, is economized on resources, further investigation is worth.
Invention content
A technical problem to be solved by this invention is to provide the structure of high-biomass and/or the recombinant bacterium of Seedling height speed
Construction method and its obtained recombinant bacterium.
The construction method of recombinant bacterium provided by the present invention includes carrying out the transformation of A1, A2 and A3 to recipient bacterium or to institute
The transformation that recipient bacterium carries out the A1 and the A2 is stated, biomass is obtained and/or the speed of growth is higher than the recombination of the recipient bacterium
Bacterium；
The A1 is by phosphotransferase G subunits (the phosphotransferase system ptsG of the recipient bacterium
Subunit, ptsG) gene knockout；
The A2 is by galactolipin repressor (Galactose repressor, GalR) gene knockout of the recipient bacterium；
The A3 is that glucokinase (glucokinase, Glk) gene is imported into the recipient bacterium；
The recipient bacterium is Escherichia coli, Bacillus acidi lactici, streptococcus or haemophilus.
In the construction method of above-mentioned recombinant bacterium, the biomass can be come with the quantity of recombinant bacterium contained in unit zymotic fluid
It embodies, the quantity of the recombinant bacterium can be indicated with Colony Forming Unit (cfu).
In the construction method of above-mentioned recombinant bacterium, the recipient bacterium can be Escherichia coli BW25113.
In the construction method of above-mentioned recombinant bacterium, the protein of the phosphotransferase G subunit genes coding B1 or B2：
B1, the protein that amino acid sequence forms shown in SEQ ID No.1；
There is phosphotransferase G subunit work(by what mutation obtained in B2, the amino acid sequence shown in SEQ ID No.1
The protein derived from B1 of energy；
The protein of galactolipin repressor the gene code C1 or C2：
C1, the protein that amino acid sequence forms shown in SEQ ID No.3；
By what mutation obtained there is galactolipin to inhibit subfunction in C2, the amino acid sequence shown in SEQ ID No.3
The protein derived from C1；
The protein of the glucokinase gene encoding D 1 or D2：
D1, the protein that amino acid sequence forms shown in SEQ ID No.5；
In D2, the amino acid sequence shown in SEQ ID No.5 by mutation obtain with glucokinase function
The protein derived from D1.
Any one of in the construction method of above-mentioned recombinant bacterium, the phosphotransferase G subunit genes are B11)-B13)
DNA molecular：
B11) its coded sequence is the cDNA molecule or genomic DNA of SEQ ID No.2；
B12) under strict conditions with B11) DNA molecular that limits hybridizes and encodes the phosphotransferase G subunits
CDNA molecules or genomic DNA；
B13) and B11) or B12) DNA molecular that limits is with 90% or more homogeneity and the coding phosphotransferase
The cDNA molecules or genomic DNA of G subunits；
The galactolipin repressor gene be C11)-C13) and any one of DNA molecular：
C11) its coded sequence is the cDNA molecule or genomic DNA of SEQ ID No.4；
C12) under strict conditions with C11) limit DNA molecular hybridize and encode the galactolipin repressor cDNA divide
Son or genomic DNA；
C13) and C11) or C12) DNA molecular that limits is with 90% or more homogeneity and the coding gala Glyco inhabiting
The cDNA molecules or genomic DNA of son；
The glucokinase gene be D11)-D13) and any one of DNA molecular：
D11) its coded sequence is that (SEQ ID No.6 are ptsGup-119- by 237-1205 of SEQ ID No.6
Glk-kan-ptsGdown segments, initial position are the 1st of glk initiation codons, and final position is glk terminator codons
Last 1) cDNA molecules or genomic DNA；
D12) under strict conditions with D11) DNA molecular that limits hybridizes and encodes the cDNA molecules of the glucokinase
Or genomic DNA；
D13) and D11) or D12) DNA molecular that limits is with 90% or more homogeneity and the coding glucokinase
CDNA molecules or genomic DNA.
It is above-mentioned to sport substitution and/or lack and or add one or several amino acid residues.
In an embodiment of the invention, the recombinant bacterium be to the Escherichia coli BW25113 carry out the A1,
The recombinant bacterium that the transformation of the A2 and A3 obtains, entitled BW25113 Δs ptsG Δs galRglk；In the another of the present invention
In one embodiment, the recombinant bacterium is that the transformation for carrying out the A1 and the A2 to the Escherichia coli BW25113 obtains
Recombinant bacterium, entitled BW25113 Δs ptsG Δs galR.
The construction method of the BW25113 Δs ptsG Δs galRglk includes following 1) -3), the BW25113 Δs ptsG Δs
The construction method of galR include it is following 1) and 2)：
1) by phosphotransferase G subunits (ptsG) gene knockout of the Escherichia coli BW25113, keep described big
Other genes of enterobacteria BW25113 are constant, obtain the mutant of the Escherichia coli BW25113, are named as BW25113
ΔptsG；
2) by galactolipin repressor (GalR) gene knockout of the BW25113 Δs ptsG, the large intestine bar is kept
Other genes of bacterium BW25113 Δs ptsG are constant, obtain the mutant of the BW25113 Δs ptsG, are named as BW25113
ΔptsGΔgalR；
3) glucokinase (Glk) gene is imported into the BW25113 Δs ptsG Δs galR, obtained described
The mutant of BW25113 Δ ptsG Δs galR is named as BW25113 Δ ptsG Δs galRglk.
In the construction method of above-mentioned recombinant bacterium, the glucokinase gene can be led by glucokinase gene expression cassette
Enter；The nucleotide sequence of the glucokinase gene expression cassette is that (initial position is by 61-1554 of SEQ ID No.6
The 1st of 119 promoters, final position are last 1 of terminator).
In the construction method of above-mentioned recombinant bacterium, the glucokinase gene can pass through DNA shown in SEQ ID No.6 points
Son imports.
Protection scope of the present invention is also belonged to by the recombinant bacterium of the construction method structure of any of the above-described kind of recombinant bacterium.
It is red that another technical problem to be solved by this invention is to provide a kind of production chain spore that structure neurosporene yield is high
The construction method of plain recombinant bacterium and its obtained production neurosporene recombinant bacterium.
The construction method of production neurosporene recombinant bacterium provided by the present invention, including imported into above-mentioned any recombinant bacterium
Neurosporene synthesis related gene obtains production neurosporene recombinant bacterium.
In the construction method of above-mentioned production neurosporene recombinant bacterium, synthesis related reason crtE (the window oxen of neurosporene
Youngster's window ox base pyrophosphate synthetase) gene, crtI (phytoene dehydrogenase) gene, crtB (phytoene close
At enzyme) gene and idi (isopentenylpyrophosphate isomerase) gene composition；The crtE gene codes are shown in SEQ ID No.8
Amino acid sequence composition protein；CrtI gene codes amino acid sequence shown in SEQ ID No.9 forms
Protein；The crtB gene codes protein that amino acid sequence forms shown in SEQ ID No.10；The idi genes
The coding protein that amino acid sequence forms shown in SEQ ID No.11.
In the construction method of above-mentioned production neurosporene recombinant bacterium, the coded sequence of the crtE genes is SEQ ID No.7
1993-2922；The coded sequence of the crtI genes is 2940-4418 of SEQ ID No.7；The crtB bases
The coded sequence of cause is 4436-5368 of SEQ ID No.7；The coded sequence of the idi genes is SEQ ID No.7
5386-5934.
In the construction method of above-mentioned production neurosporene recombinant bacterium, the neurosporene synthesis related gene can pass through SEQ ID
The 1-6190 expression cassettes (being made of promoter, target gene and terminator) of No.7 import.
In the construction method of above-mentioned production neurosporene recombinant bacterium, the neurosporene synthesis related gene can specifically pass through
DNA molecular (pLY036) shown in SEQ ID No.7 imports.
This is also belonged to by the production neurosporene recombinant bacterium of the construction method structure of any of the above-described kind of production neurosporene recombinant bacterium
The protection domain of invention.
It is demonstrated experimentally that carrying out the recombination that described A1, A2 and A3 are transformed as the Escherichia coli BW25113 of recipient bacterium
Bacterium BW25113 Δ ptsG Δ galRglk, and be transformed carrying out the A1 and A2 as the Escherichia coli BW25113 of recipient bacterium
Obtained recombinant bacterium BW25113 Δ ptsG Δ galR are cultivated 12 hours, BW25113 Δs ptsG under identical condition of culture
The biomass of Δ galRglk is 3.26 times of Escherichia coli BW25113, and the biomass of BW25113 Δ ptsG Δs galR is large intestine
2.81 times of bacillus BW25113 illustrate BW25113 Δ ptsG Δ galRglk and BW25113 Δ ptsG Δs galR not only biomass
It is significantly higher than recipient bacterium, the speed of growth of the two is also significantly greater than recipient bacterium.Using BW25113 Δs ptsG Δs galRglk as by
Body bacterium imports the recombinant bacterium BW25113 Δ ptsG Δs that the pLY036 containing neurosporene synthesis related gene expression cassette is obtained
GalRglk/pLY036 is imported using BW25113 Δs ptsG Δs galR as recipient bacterium and is contained neurosporene synthesis related gene table
The neurosporene yield of the recombinant bacterium BW25113 Δ ptsG Δs galR/pLY036 obtained up to the pLY036 of box is with large intestine respectively
Bacillus BW25113 imports the recombinant bacterium that the pLY036 containing neurosporene synthesis related gene expression cassette is obtained as recipient bacterium
1.88 times and 1.73 times of the neurosporene yield of BW25113/pLY036 illustrates BW25113 Δ ptsG Δs galRglk/pLY036
It is significantly higher than BW25113/pLY036 with the neurosporene yield of BW25113 Δ ptsG Δs galR/pLY036.What the present invention was built
High-biomass and/or the fast recombinant bacterium of the speed of growth and production neurosporene recombinant bacterium the fields such as biological study, medicine have compared with
High application prospect and Development volue.
Description of the drawings
Fig. 1 is that BW25113 Δ ptsG PCR identify agarose gel electrophoresis figure.Swimming lane M is DNA marker, and swimming lane 1 is
BW25113 Δ ptsG, swimming lane 2 are wild type BW25113.
Fig. 2 is that BW25113 Δ galR PCR identify agarose gel electrophoresis figure.Swimming lane M is DNA marker.Swimming lane 1 is
BW25113 Δ galR, swimming lane 2 are wild type BW25113.
Fig. 3 is that BW25113 Δ ptsG Δ galRglk PCR identify agarose gel electrophoresis figure.Swimming lane M is DNA
marker.Swimming lane 1 and 2 is BW25113 Δ ptsG Δs galRglk.The primer of swimming lane 1 is GalR-up200-F, GalR-
The primer of down200-R, swimming lane 2 are PtsG-up200-F, PtsG-down200-R.Swimming lane 3 and 4 is Escherichia coli BW25113.
The primer of swimming lane 3 is GalR-up200-F, GalR-down200-R, and the primer of swimming lane 4 is PtsG-up200-F, PtsG-
down200-R。
Fig. 4 is Escherichia coli BW25113, BW25113 Δ ptsG, BW25113 Δ galR, BW25113 Δ ptsG Δs galR
With the growth curve of BW25113 Δ ptsG Δs galRglk.In Fig. 4, Wt represents BW25113, and Δ ptsG represents BW25113 Δs
PtsG, Δ galR represent BW25113 Δ galR, and Δ ptsG Δs galR represents BW25113 Δ ptsG Δ galR, Δ galR Δs ptsG
119glk represents BW25113 Δ ptsG Δs galRglk.
Specific implementation mode
The present invention is further described in detail With reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified
Conventional method.The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
In following embodiments, Escherichia coli BW25113 (Tomoya Baba, Takeshi Ara, Miki Hasegawa,
Yuki Takai,Yoshiko Okumura,Miki Baba,Kirill A Datsenko,Masaru Tomita,Barry L
Wanner,and Hirotada Mori1.Construction of Escherichia coli K-12in-frame,
single-gene knockout mutants:the Keio collection.Molecular Systems Biology
(2006):It is 1-11.) one plant of nonpathogenic bacteria, genetic background understands, generation time is short, be easy culture and culture medium raw material is cheap.
The Escherichia coli BW25113 public can obtain from Institute of Microorganism, Academia Sinica, which only attaches most importance to what duplicate was invented
Used in related experiment, it not can be used as other purposes and use.
In following embodiments, the coded sequence of phosphotransferase G subunit genes is encoded as shown in SEQ ID No.2 by SEQ
The protein phosphotransferase G subunits that amino acid sequence shown in ID No.1 forms；The coded sequence of galactolipin repressor gene
As shown in SEQ ID No.4, the protein galactolipin repressor that the amino acid sequence shown in SEQ ID No.3 forms is encoded；
237-1205 of the coded sequence of glucokinase gene such as SEQ ID No.6 encode the ammonia shown in SEQ ID No.5
The protein glucokinase of base acid sequence composition；CrtE gene codes amino acid sequence shown in SEQ ID No.8 forms
Protein；The crtI gene codes protein that amino acid sequence forms shown in SEQ ID No.9；CrtB gene codes by
The protein that amino acid sequence shown in SEQ ID No.10 forms；Idi gene codes amino shown in SEQ ID No.11
The protein of acid sequence composition.The coded sequence of crtE genes is 1993-2922 of SEQ ID No.7；CrtI genes
Coded sequence is 2940-4418 of SEQ ID No.7；The coded sequence of crtB genes is the 4436- of SEQ ID No.7
5368；The coded sequence of the idi genes is 5386-5934 of SEQ ID No.7.
(Thomason LC, Costantino are N.2007.E.coli for wild type P1 bacteriophages in following embodiments
genome manipulation by P1 transduction.Current Protocols in Molecular
Biology:1.17.1-8) public can obtain from Institute of Microorganism, Academia Sinica, the biomaterial only attach most importance to duplicate invention
Related experiment used in, not can be used as other purposes and use.
The structure of embodiment 1, recombinant bacterium BW25113 Δ ptsG Δ galR and BW25113 Δ ptsG Δs galRglk
Recombinant bacterium BW25113 Δ ptsG Δs galRglk is to carry out being transformed for A1, A2 and A3 to Escherichia coli BW25113
The recombinant bacterium arrived, recombinant bacterium BW25113 Δ ptsG Δs galR are obtained to the transformation of Escherichia coli BW25113 progress A1 and A2
Recombinant bacterium.
The A1 is by phosphotransferase G subunits (ptsG) gene knockout of Escherichia coli BW25113；
The A2 is by galactolipin repressor (GalR) gene knockout of Escherichia coli BW25113；
The A3 is that glucokinase (Glk) gene is imported into Escherichia coli BW25113.
The construction method of the BW25113 Δs ptsG Δs galRglk includes following 1) -3), the BW25113 Δs ptsG Δs
The construction method of galR include it is following 1) and 2)：
1) it by phosphotransferase G subunits (ptsG) gene knockout (missing) of the Escherichia coli BW25113, keeps
Other genes of the Escherichia coli BW25113 are constant, obtain the mutant of the Escherichia coli BW25113, are named as
BW25113ΔptsG；
2) by galactolipin repressor (GalR) gene knockout (missing) of the BW25113 Δs ptsG, described in holding
Other genes of Escherichia coli BW25113 Δs ptsG are constant, obtain the mutant of the BW25113 Δs ptsG, are named as
BW25113ΔptsGΔgalR；
3) glucokinase (Glk) gene is imported into the BW25113 Δs ptsG Δs galR, obtained described
The mutant of BW25113 Δ ptsG Δs galR is named as BW25113 Δ ptsG Δs galRglk.The specific method is as follows：
1) the BW25113 Δs ptsG in is the bacterial strain that number is JW1087 in the libraries keio, and BW25113 Δs ptsG is by large intestine
The phosphotransferase G subunits (ptsG) of bacillus BW25113 replace with kalamycin resistance gene of the both ends with the sites FRT (about
1248bp) to by the ptsG gene knockouts of Escherichia coli BW25113, keep other genes of the Escherichia coli BW25113
It is constant, the mutant of obtained Escherichia coli BW25113.Protein shown in ptsG gene code SEQ ID No.1, ptsG bases
The coded sequence of cause is as shown in SEQ ID No.2.The genotype of BW25113 Δs ptsG is Δ ptsG::Kan.Primer pair PtsG-
up200-F：CATATGTTTTGTCAAAATGTGCAAC and PtsG-down200-R：CCGCTACCAGGTGACGAAAAACTTC from
Amplification obtains the segment (Fig. 1) of an about 1648bp in the genomic DNA of BW25113 Δs ptsG, from Escherichia coli BW25113's
Amplification obtains the segment of an about 1834bp in genomic DNA.Wherein, PtsG-up200-F and PtsG-down200-R primers knot
Close the upstream 200bp and downstream 200bp near zones that position is the ptsG genes of Escherichia coli BW25113 respectively.Sequencing analysis
The result shows that not having ptsG genes on the genome of BW25113 Δs ptsG, BW25113 Δs ptsG is by Escherichia coli BW25113
Phosphotransferase G subunits (ptsG) gene knockout, keep other genes of the Escherichia coli BW25113 constant, obtain
The mutant of the Escherichia coli BW25113 arrived.
2) the specific construction methods of BW25113 Δ ptsG Δs galR are as follows：The structure of BW25113 Δ ptsG Δs galR：With
1) BW25113 Δs galR is donor bacterium, is pressed down the galactolipin of BW25113 Δ ptsG △ kan using P1 phage transductions technology
Replicon gene (galR) replaces with kalamycin resistance gene and obtains BW25113 Δ ptsG Δs galR.It is specific as follows：
(a) plasmid pCP20 (Zhuo Taifeng Science and Technology Ltd.s of Shenzhen, the article No. of expression Flp recombinases are utilized：
PCP20921A the kalamycin resistance for) eliminating BW25113 Δs ptsG, is as follows：Using chemical transformation by plasmid
PCP20 is transferred to BW25113 Δs ptsG, and 30 DEG C of overnight incubations make the kalamycin resistance in phage gene group eliminate；Select Dan Ke
Grand bacterial strain is cultivated 6 hours for 42 DEG C in non-resistant LB.PCP20 is temperature sensitive type plasmid, is cultivated 6 hours for 42 DEG C in non-resistant LB
Plasmid elimination can be obtained the bacterial strain of kalamycin resistance elimination, be named as BW25113 Δ ptsG Δs kan.
(b) preparation of donor P1：BW25113 Δs galR is inoculated in MgCl containing 10mmol/L2、5mmol/L CaCl2With
In the LB culture mediums of 0.1% glucose, 1h is cultivated, wild type P1 bacteriophages are added, cultivates 1-3h.A few drop chloroforms are added to shake again rather
Clock, centrifuging and taking supernatant obtain bacteriophage P1vir Δs galR.
(c) P1 phage transduction technologies structure Escherichia coli is utilized to knock out strain BW25113 Δ ptsG Δ galR, specific steps
It is as follows：BW25113 Δ ptsG Δs kan (recipient bacterium) are incubated overnight, after 1.5ml bacterium solutions 10000g is centrifuged 2 minutes, with 0.75ml's
(solvent is water to P1 salting liquids, and solute is 10mM CaCl2With 5mM MgSO4) BW25113 Δ ptsG Δ kan cells are resuspended, by 100
μ l bacteriophages P1vir Δs galR and 100 μ l BW25113 Δ ptsG Δ kan cell suspending liquids mix, and are incubated 30min, use 1ml
LB and 200 μ l sodium citrates, 37 DEG C are continued to cultivate 1h, are collected by centrifugation, and after being resuspended with 100 μ l LB, are coated with the LB containing kanamycins
On tablet (a concentration of 50 μ g/ml of kanamycins), the positive colony screened (can give birth on the tablet containing kanamycins
Long clone) it is BW25113 Δ ptsG Δ galR, genotype is Δ ptsG Δs galR::Kan.
Wherein, BW25113 Δs galR is the bacterial strain that number is JW2805 in the libraries Keio, and BW25113 Δs galR is by large intestine
Galactolipin repressor (GalR) gene of bacillus BW25113 replaces with kalamycin resistance gene of the both ends with the sites FRT (about
1300bp) to by galactolipin repressor (GalR) gene knockout of Escherichia coli BW25113, keep the Escherichia coli
Other genes of BW25113 are constant, the mutant of obtained Escherichia coli BW25113.GalR gene code SEQ ID No.3 institutes
The protein shown, the coded sequence of GalR genes is as shown in SEQ ID No.4.
The genotype of BW25113 Δs galR is Δ galR::Kan.Primer pair GalR-up200-F：
CAACCTGAAGCCAAACGCCACCAGC and GalR-down200-F：ACCCGCGCCTTGCCGGAAGTGAAGG,
Amplification obtains the segment (Fig. 2) of an about 1648bp from the genomic DNA of BW25113 Δs galR, from Escherichia coli BW25113
Genomic DNA in amplification obtain the segment of an about 1432bp.Wherein, GalR-up200-F and GalR-down200-F primers
Binding site is the upstream 200bp and downstream 200bp near zones of the GalR genes of Escherichia coli BW25113 respectively.Sequencing point
The result shows that not having GalR genes on the genome of BW25113 Δs galR, BW25113 Δs galR is by Escherichia coli for analysis
Galactolipin repressor (GalR) gene knockout of BW25113, keeps other genes of the Escherichia coli BW25113 constant, obtains
The mutant of the Escherichia coli BW25113 arrived.
Glucokinase (Glk) gene is imported into BW25113 Δ ptsG Δs galR 2), obtains BW25113 Δs ptsG
The mutant BW25113 Δ ptsG Δ galRglk of Δ galR, the specific method is as follows：
(1) preparation of host strain：
PKD46 plasmids (being purchased from Clontech companies) are converted by calcium chloride transformation to BW25113 Δ ptsG Δs
GalR obtains the recombination bacillus coli BW25113 Δ ptsG Δs galR/pKD46 containing plasmid pKD46.Recombination bacillus coli
BW25113 Δs ptsG Δs galR/pKD46 expresses 3 recombinant proteins of bacteriophage lambda, host strain just has after arabinose induction
There is the ability of homologous recombination.
(2) preparation of ptsGup-119-glk-kan-ptsGdown segments：
The nucleotide sequence of ptsGup-119-glk-kan-ptsGdown segments such as SEQ ID No.6, by 3075 nucleosides
Acid composition, wherein containing (a) glucokinase gene expression cassette, nucleotide sequence is the 61-1554 of SEQ ID No.6
Position, the glucokinase gene expression cassette by 119 promoter of (a1) Escherichia coli (61-218 of SEQ ID No.6),
(a2) Escherichia coli glucokinase (Glk) gene (237-1205 of SEQ ID No.6) and (a3) TrrnB terminators
(1396-1554 of SEQ ID No.6) are formed by connecting；(b) kalamycin resistance gene (LOXP- with LOXP flanks
Kan-LOXP), nucleotide sequence is 1564-2976 of SEQ ID No.6；(c) ptsG upstream region of gene homology arm
PtsGup, nucleotide sequence are 1-60 of SEQ ID No.6；(d) ptsG downstream of gene homology arm ptsGdown, core
Nucleotide sequence is 3016-3075 of SEQ ID No.6.
(3) homologous recombination：
PtsGup-119-glk-kan-ptsGdown segment electricity shown in SEQ ID No.6 is transferred to recombination bacillus coli
The competent cell of BW25113 Δ ptsG Δs galR/pKD46 utilizes kanamycins tablet (a concentration of 50 μ g/ of kanamycins
Ml it) screens positive transformant-and ptsGup-119-glk-kan-ptsGdown segments is transferred to recombination bacillus coli BW25113
The recombination bacillus coli that Δ ptsG Δs galR/pKD46 is obtained is named as BW25113 Δ ptsG Δs galRglk.BW25113Δ
The genotype of ptsG Δs galRglk is Δ ptsG Δs galRglk::Kan.With primer GalR-up200-F：
CAACCTGAAGCCAAACGCCACCAGC, GalR-down200-R：ACCCGCGCCTTGCCGGAAGTGAAGG is to BW25113 Δs
PtsG Δs galRglk and Escherichia coli BW25113 carry out PCR verifications, from the genomic DNA of BW25113 Δ ptsG Δs galRglk
Middle amplification obtains the segment of an about 1648bp and 1432bp.With primer PtsG-up200-F：
CATATGTTTTGTCAAAATGTGCAAC and PtsG-down200-R：CCGCTACCAGGTGACGAAAAACTTC is to BW25113
Δ ptsG Δs galRglk and Escherichia coli BW25113 carry out PCR verifications, from BW25113 Δs ptsG Δs galRglk and wild type
Genomic DNA in respectively amplification obtain the segment (Fig. 3) of about 1892bp and 1834bp.Wherein, primer binding sites are respectively
The upstream and downstream region of the ptsG genes of Escherichia coli BW25113.Sequencing analysis is the result shows that BW25113 Δ ptsG Δs
Contain ptsGup-119-glk-kan-ptsGdown segments shown in SEQ ID No.6 on the genome of galRglk.
The biomass estimation of embodiment 2, recombinant bacterium BW25113 Δ ptsG Δ galR and BW25113 Δ ptsG Δs galRglk
Strain growth curve is measured with miniature organism reactor, the biomass (biomass) of cell is in following test media
Middle progress：The self-induction culture medium that Induction Transformation contains kalamycin resistance, self-induction culture medium ZYM- are carried out with ZYM-5052
5052 formulas：100ml A+2ml B+2ml C+200 μ l D+100 μ l E, the wherein solute of A, B, C, D and E and concentration are as follows
(being mass percent concentration below)：
A.ZY：1% tryptone, 0.5% yeast powder；
B.50×M：1.25M Na2HPO4, 1.25M KH2PO4, 2.5M NH4Cl and 0.25M Na2SO4；
C.50×5052：25% glycerine, 2.5% glucose, 10% lactose；
D.1M MgSO4；
E.1000 × trace element：50mM FeCl3, 20mM CaCl2, 10mM MnCl2, 10mM ZnSO4, CoCl2、
NiCl2、Na2Mo4、Na2SeO3And H3BO3Each 2mM.
Test media：4g glucose is taken, 100ml is settled to distilled water, adjusts pH to 7.0, is sterilized 20 points at 121 DEG C
Clock.
Miniature organism reactor (Biolector, m2p-labs company) is one kind can monitor strain growth situation in real time
High frequency oscillation instrument.
Test strain：Escherichia coli BW25113, BW25113 Δ ptsG, BW25113 Δ galR, BW25113 Δ ptsG Δs
galR、BW25113ΔptsGΔgalRglk。
Experiment in triplicate, repeats one piece of 48 hole quincuncial plate of each test strain every time.Various test strains are connect respectively
Enter in test media, cultivated 12 hours at 37 DEG C, centrifuges bacterium solution, take thalline, thalline is cleaned with sterile distilled water.In 48 hole plums
In card, 1ml test medias are added in each sample hole, in each hole, 0.01ml bacteria suspensions is added and (are resuspended with sterile distilled water
The thalline content that thalline obtains is 8 × 108The liquid of cfu/ml).Rotating speed 800rpm is cultivated 12 hours at 37 DEG C.Every 2 hours right
The sample in two holes measures the thalline content in culture solution.
The experimental results showed that the growth biomass highest that is most fast, and being finally reached of BW25113 Δ ptsG Δs galRglk,
It is 1.40 × 108cfu/ml.The growth of BW25113 Δ ptsG Δs galR also has apparent advantage, grows very fast and most Zhongdao
Up to higher biomass 1.21 × 108cfu/ml.The speed of growth of BW25113 Δs galR is slightly below BW25113 Δ ptsG Δs
GalR, biomass have reached 1.09 × 108cfu/ml.The life of wild type (i.e. Escherichia coli BW25113) and BW25113 Δs ptsG
Long speed and biomass are all relatively low, and biomass is respectively 0.43 × 108Cfu/ml and 0.32 × 108cfu/ml.In identical training
Under the conditions of supporting, cultivate 12 hours, BW25113 Δ ptsG Δ galRglk and BW25113 the Δ ptsG Δ galR speeds of growth are bright
Aobvious to be faster than BW25113, the biomass of BW25113 Δ ptsG Δs galRglk is 3.26 times of Escherichia coli BW25113, BW25113
The biomass of Δ ptsG Δs galR is 2.81 times (Fig. 4) of Escherichia coli BW25113.Illustrate BW25113 Δ ptsG Δs galRglk
Not only biomass is significantly higher than recipient bacterium with BW25113 Δ ptsG Δs galR, and the speed of growth of the two is also significantly faster than recipient bacterium.
Embodiment 3, the structure and its performance for producing neurosporene recombinant bacterium
1, the structure of neurosporene recombinant bacterium is produced
BW25113 Δ ptsG, BW25113 Δs galR for being built respectively to Escherichia coli BW25113 and embodiment 1,
PLY036 is imported in this five recipient bacteriums of BW25113 Δ ptsG Δ galR and BW25113 Δ ptsG Δs galRglk, obtains production chain
Spore red pigment recombinant bacterium.The plasmid method for transformation wherein used is to use chemical transformation.It will be imported into Escherichia coli BW25113
The production neurosporene recombinant bacterium that pLY036 is obtained is named as BW25113/pLY036, the BW25113 Δs that will be built to embodiment 1
The production neurosporene recombinant bacterium that pLY036 is obtained is imported in ptsG is named as BW25113 Δ ptsG/pLY036, it will be to embodiment 1
The production neurosporene recombinant bacterium that pLY036 is obtained is imported in the BW25113 Δs galR of structure is named as BW25113 Δs galR/
PLY036, by the production neurosporene recombinant bacterium that importing pLY036 is obtained in the BW25113 Δ ptsG Δs galR built to embodiment 1
BW25113 Δ ptsG Δ galR/pLY036 are named as, will be led in the BW25113 Δ ptsG Δs galRglk built to embodiment 1
Enter the production neurosporene recombinant bacterium that pLY036 is obtained and is named as BW25113 Δ ptsG Δs galRglk/pLY036.BW25113/
PLY036, BW25113 Δ ptsG/pLY036, BW25113 Δ galR/pLY036, BW25113 Δ ptsG Δs galR/pLY036 and
BW25113 Δs ptsG Δs galRglk/pLY036 carries out PCR verifications with primer pair CrtE, and it is SEQ ID that can expand and obtain sequence
The DNA fragmentation of neurosporene synthesis related gene shown in 1993-2922 of No.7.
Wherein, pLY036 is lactose inducible expression vector, and the nucleotide sequence of pLY036 is SEQ ID No.7,
PLY036 contains neurosporene synthesis related gene expression cassette, and the nucleotide sequence of neurosporene synthesis related gene expression cassette is
1993-5934 of SEQ ID No.7, the synthesis related reason window ox window ox base pyrophosphate synthetase of neurosporene
CrtE genes, phytoene dehydrogenase crtI genes, phytoene synthetase crtB genes and isopentenylpyrophosphate
Isomerase idi genes form；The crtE gene codes protein that amino acid sequence forms shown in SEQ ID No.8；
The crtI gene codes protein that amino acid sequence forms shown in SEQ ID No.9；The crtB gene codes by
The protein that amino acid sequence shown in SEQ ID No.10 forms；The idi gene codes are shown in SEQ ID No.11
The protein of amino acid sequence composition.1911-1940 of SEQ ID No.7 are Tac promoters, the of SEQ ID No.7
6025-6190 are TrrnB terminators, and 1993-2922 of SEQ ID No.7 are the coded sequence of crtE genes, SEQ
2940-4418 of ID No.7 are the coded sequences of crtI genes, and 4436-5368 of SEQ ID No.7 are crtB bases
The coded sequence of cause, 5386-5934 of SEQ ID No.7 are the coded sequences of idi genes.
With BW25113/pLY036, BW25113 Δ ptsG/pLY036, BW25113 Δ galR/pLY036, BW25113 Δ
Any bacterial strain in this 5 plants of bacterium of ptsG Δ galR/pLY036 and BW25113 Δ ptsG Δs galRglk/pLY036 is individually for engineering
Bacterium is carried out at the same time following experiment：By engineering bacteria be crossed to containing mass percent concentration be 1.5% agar and contain 50 μ g/
On the chloramphenicol LB tablets of ml, 37 DEG C of culture 12h.The monoclonal of the chief on picking tablet is inoculated into the chloramphenicol containing 50 μ g/ml
LB liquid medium in, 37 DEG C of overnight shaking cultures, 250 revs/min of rotating speed；It is with percent by volume by overnight culture
It is 250ml's that 1% inoculum concentration, which is seeded to the capacity equipped with 50mL self-induction culture mediums ZYM-5052 (containing 50 μ g/ml chloramphenicol),
In triangular flask, at 37 DEG C with 220 revs/min of speed oscillation, carry out Fiber differentiation 12h, 6000g, 4 DEG C, 10min is collected by centrifugation
Thalline, the sterile NaCl aqueous solution for being 0.85% with the mass percentage concentration of ice bath wash 2 times, are received with identical centrifugal condition
Collect thalline, obtains engineering bacteria inducing cell.Various engineering bacteria inducing cells and Escherichia coli BW25113 are used to the matter of ice bath respectively
It is 8 × 10 that the sterile NaCl aqueous solution that amount percentage concentration is 0.85%, which is resuspended to thalline content,8The bacterium solution of cfu/ml is taken out
200 μ l bacterium solutions are added in 250ml triangular flasks, and the ZYM-5052 to contain 4% glucose and 1 × PBS carries out glucose at 37 DEG C
Conversion 6 hours takes bacterium solution, 12000rpm to centrifuge 1min, discards supernatant liquid, collects thalline, be with the mass percentage concentration of ice bath
0.85% sterile NaCl aqueous solution washs and is resuspended thalline, takes 1 × 108Cfu thalline are added 1ml acetone and are extracted.4
DEG C place 3 hours, centrifuging and taking supernatant obtains sample to be tested, carries out the length scanning of 370-500nm.It tests in triplicate, often
Each secondary bacterium carries out above-mentioned glucose conversion in 3 250ml triangular flasks.
Wherein, contain 4% glucose and the ZYM-5052 of 1 × PBS is prepared as follows：It is lured certainly into embodiment 2
It leads and glucose and 10 × PBS is added in culture medium ZYM-5052, until the content of glucose is 4% (mass percentage), by 10
× PBS dilutes 10 times, obtains the ZYM-5052 containing 4% glucose and 1 × PBS.
Wherein, the preparation method of 10 × PBS of 1L (pH7.4) is：Potassium dihydrogen phosphate (KH2PO4)：2.7g, disodium hydrogen phosphate
(Na2HPO4)：14.2g, sodium chloride (NaCl)：80g, potassium chloride (KCl)：2g adds distilled water to be settled to 1L.
2, the measurement of the neurosporene yield of production neurosporene recombinant bacterium
It is that standard items use mark with neurosporene (Shenzhen Zhen Qiang Bioisystech Co., Ltd, catalog number 502-64-7)
Directrix curve method (external standard method) carries out the content of neurosporene in quantitative analysis sample to be tested.Standard items are in 442nm after length scanning
There is top, BW25113/pLY036, BW25113 Δ ptsG/pLY036, BW25113 Δ galR/pLY036, BW25113 in place
The sample to be tested of this 5 plants of bacterium of Δ ptsG Δ galR/pLY036 and BW25113 Δ ptsG Δs galRglk/pLY036 is at 442nm
There is top, Escherichia coli BW25113 is at 442nm without peak.
Quantitative analysis Escherichia coli BW25113, BW25113/pLY036, BW25113 Δ ptsG/pLY036, BW25113 Δ
The chain spore of galR/pLY036, BW25113 Δ ptsG Δ galR/pLY036 and BW25113 Δ ptsG Δs galRglk/pLY036 are red
Plain yield shows BW25113 Δ ptsG Δ galRglk/pLY036 and BW25113 Δ ptsG Δs galR/ as shown in table 1
The neurosporene yield of pLY036 is significantly higher than BW25113/pLY036, bacterial strain BW25113 Δ ptsG Δs galRglk/pLY036
Product amount highest, be 1.88 times of BW25113/pLY036, BW25113 Δ ptsG Δs galR/pLY036 is also higher, is
1.73 times of BW25113/pLY036.
The neurosporene yield of 1 each bacterial strain of table
| Bacterial strain | Neurosporene yield (neurosporene/10 mg8cfu) |
| BW25113 | 0.27±0.01 |
| BW25113/pLY036 | 3.24±0.02 |
| BW25113ΔptsG/pLY036 | 2.84±0.02 |
| BW25113ΔgalR/pLY036 | 4.25±0.03 |
| BW25113ΔptsGΔgalR/pLY036 | 5.59±0.03 |
| BW25113ΔptsGΔgalRglk/pLY036 | 6.08±0.04 |
Claims (10)
1. the construction method of recombinant bacterium includes carrying out the transformation of A1, A2 and A3 to recipient bacterium or to described in recipient bacterium progress
The transformation of A1 and the A2, obtain biomass and/or the speed of growth is higher than the recombinant bacterium of the recipient bacterium；
The A1 is to knock out the phosphotransferase G subunit genes of the recipient bacterium；
The A2 is by the galactolipin repressor gene knockout of the recipient bacterium；
The A3 is to import glucokinase gene into the recipient bacterium；
The recipient bacterium is Escherichia coli.
2. according to the method described in claim 1, it is characterized in that：The recipient bacterium is Escherichia coli BW25113.
3. method according to claim 1 or 2, it is characterised in that：The phosphotransferase G subunit genes coding SEQ ID
The protein that amino acid sequence shown in No.1 forms；
The protein that amino acid sequence shown in the galactolipin repressor gene code SEQ ID No.3 forms；
The protein of amino acid sequence composition shown in the glucokinase gene coding SEQ ID No.5.
4. method according to claim 1 or 2, it is characterised in that：The phosphotransferase G subunit genes are SEQ ID
CDNA molecules or genomic DNA shown in No.2；
The galactolipin repressor gene is cDNA molecules or genomic DNA shown in SEQ ID No.4；
The glucokinase gene is cDNA molecules or genomic DNA shown in 237-1205 of SEQ ID No.6.
5. method according to claim 1 or 2, it is characterised in that：The glucokinase gene passes through glucokinase
Expression casette imports；The nucleotide sequence of the glucokinase gene expression cassette is the 61-1554 of SEQ ID No.6
Position.
6. method according to claim 1 or 2, it is characterised in that：The glucokinase gene passes through SEQ ID No.6
Shown in DNA molecular import.
7. by the recombinant bacterium of any the method structure in claim 1-6.
Include importing neurosporene into the recombinant bacterium described in claim 7 to close 8. producing the construction method of neurosporene recombinant bacterium
At related gene, production neurosporene recombinant bacterium is obtained.
9. according to the method described in claim 8, it is characterized in that：The synthesis related reason window ox window ox of neurosporene
Youngster's base pyrophosphate synthetase gene, Phytoene dehydrogenase gene, phytoene synthase gene and iso-amylene are burnt
Phosphate isomerases gene forms；The window ox window ox base pyrophosphate synthetase gene code is shown in SEQ ID No.8
The protein of amino acid sequence composition；The Phytoene dehydrogenase gene encodes the amino shown in SEQ ID No.9
The protein of acid sequence composition；The phytoene synthase gene encodes the amino acid sequence shown in SEQ ID No.10
Arrange the protein of composition；The isopentenylpyrophosphate isomerase gene encodes the amino acid sequence group shown in SEQ ID No.11
At protein.
10. the production neurosporene recombinant bacterium built by claim 8 or 9 the methods.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410167194.4A CN105002105B (en) | 2014-04-24 | 2014-04-24 | High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410167194.4A CN105002105B (en) | 2014-04-24 | 2014-04-24 | High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105002105A CN105002105A (en) | 2015-10-28 |
| CN105002105B true CN105002105B (en) | 2018-09-21 |
Family
ID=54374973
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410167194.4A Active CN105002105B (en) | 2014-04-24 | 2014-04-24 | High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105002105B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110734887B (en) * | 2018-07-18 | 2021-09-03 | 中国科学院微生物研究所 | Genetically engineered bacterium for producing N-acetylglutamic acid and construction method and application thereof |
| CN111778200B (en) * | 2019-04-04 | 2022-11-01 | 中国科学院微生物研究所 | Platform bacterium for producing L-aspartic acid, recombinant bacterium for producing beta-alanine constructed based on platform bacterium and construction method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101613669A (en) * | 2009-06-04 | 2009-12-30 | 山东大学 | One strain is used for the colibacillus engineering strain of aerobic fermentation |
| CN101861384A (en) * | 2007-05-04 | 2010-10-13 | Sk能源株式会社 | Method of producing lycopene using recombinant esherichia coli |
| CN102643774A (en) * | 2012-05-10 | 2012-08-22 | 南京工业大学 | Succinic acid genetic engineering bacterium and method for fermenting and producing succinic acid |
| CN102686718A (en) * | 2009-11-18 | 2012-09-19 | 麦兰特公司 | Metabolic evolution of escherchia coli strains that produce organic acids |
-
2014
- 2014-04-24 CN CN201410167194.4A patent/CN105002105B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101861384A (en) * | 2007-05-04 | 2010-10-13 | Sk能源株式会社 | Method of producing lycopene using recombinant esherichia coli |
| CN101613669A (en) * | 2009-06-04 | 2009-12-30 | 山东大学 | One strain is used for the colibacillus engineering strain of aerobic fermentation |
| CN102686718A (en) * | 2009-11-18 | 2012-09-19 | 麦兰特公司 | Metabolic evolution of escherchia coli strains that produce organic acids |
| CN102643774A (en) * | 2012-05-10 | 2012-08-22 | 南京工业大学 | Succinic acid genetic engineering bacterium and method for fermenting and producing succinic acid |
Non-Patent Citations (1)
| Title |
|---|
| 基因工程菌产类胡萝卜素的研究进展;杨远帆等;《生物技术》;20021031;第12卷(第5期);第34-36页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105002105A (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7232540B2 (en) | Multiple genome engineering enabled by CRISPR | |
| CN106190937B9 (en) | Method for biosynthesizing 2' -fucosyllactose by constructing recombinant escherichia coli | |
| He et al. | Anti-CRISPR proteins encoded by archaeal lytic viruses inhibit subtype ID immunity | |
| JP5074185B2 (en) | Isoprenoid formation | |
| CN109666684A (en) | A kind of CRISPR/Cas12a gene editing system and its application | |
| JP7261222B2 (en) | Genetically modified bacterium that produces 3-hydroxypropionic acid, its production method, and its application | |
| CN108728470B (en) | Recombinant bacterium for producing beta-alanine and construction method and application thereof | |
| Ishikawa et al. | A new simple method for introducing an unmarked mutation into a large gene of non-competent Gram-negative bacteria by FLP/FRT recombination | |
| WO2019185751A1 (en) | Inhibitors of crispr-cas associated activity | |
| CN105002105B (en) | High-biomass and/or Seedling height speed recombinant bacterium and its construction method and application | |
| Fondi et al. | The primordial metabolism: an ancestral interconnection between leucine, arginine, and lysine biosynthesis | |
| CN116917485A (en) | Recombinant microorganism expressing fucosyltransferase and method for producing 2' -fucosyllactose using the same | |
| Jiang et al. | Highly efficient genome editing in Xanthomonas oryzae pv. oryzae through repurposing the endogenous type I‐C CRISPR‐Cas system | |
| CN102876623A (en) | Re-engineering mediated site-directed mutagenesis method | |
| CN106133144A (en) | Use the preparation method of 4 amino-cinnamic acids of enzyme | |
| Han et al. | A DNA inversion system in eukaryotes established via laboratory evolution | |
| CN107384843A (en) | Sphingomonas paucimobilis gene knockout mutant strain and its construction method | |
| CN114107299B (en) | sgRNA for targeted knockout of duck cGAS gene and application thereof | |
| CN113684163B (en) | Genetically engineered bacterium for improving lactoyl-N-tetraose yield and production method thereof | |
| KR102633804B1 (en) | Recombinant Bacillus genus microorganism and Method for producing human milk oligosaccharides using the same | |
| CN108728469B (en) | Construction of recombinant escherichia coli engineering bacteria and application thereof in production of beta-alanine | |
| CN103215215A (en) | Escherichia coli expression strain with high conversion efficiency | |
| CN108795832B (en) | Host bacterium with endogenous L-asparaginase II gene knocked out, preparation method and application thereof | |
| CN105820990B (en) | A method of utilizing evolution target protein in iteration homologous recombination body | |
| CN116396916B (en) | Low endotoxin escherichia coli and low endotoxin recombinant human collagen escherichia coli engineering bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |