CN105002099B - The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application - Google Patents
The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application Download PDFInfo
- Publication number
- CN105002099B CN105002099B CN201510481258.2A CN201510481258A CN105002099B CN 105002099 B CN105002099 B CN 105002099B CN 201510481258 A CN201510481258 A CN 201510481258A CN 105002099 B CN105002099 B CN 105002099B
- Authority
- CN
- China
- Prior art keywords
- heavy metal
- bacterial strain
- plant
- cyclothyrioides
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Abstract
The invention belongs to microbial technology field, and in particular to the endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application.The technical problem to be solved in the present invention is to provide a kind of new selection into plant to reduce heavy metal.The invention provides the one plant of endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1, preserving number：CGMCC No.10522.Present invention also offers purposes of the described bacterial strain in plant resistance to environment stress is strengthened.Present invention also offers purposes of the described bacterial strain in heavy metal on plants pollution is reduced.Bacterial strain heavy metal of the present invention has tolerance, and its zymotic fluid can also effectively prevent aerial part migration of the heavy metal under ground portion to plant.
Description
Technical field
The invention belongs to microbial technology field, and in particular to the endogenetic fungus of resistance to heavy metal Paraconiothyrium
Cyclothyrioides MR2-1 and its application.
Background technology
With industrial fast development, various chemical products, agricultural chemicals and chemical fertilizer widely use, and mineral resources
Continually develop utilization, heavy metal pollution of soil turns into one of most important environmental problem in China or even the world.It is heavy metal-polluted
Dye have the characteristics that form it is changeable, easily in vivo accumulation, can not by biological degradation, disguise it is strong, not only result in
Soil degradation, Crop yield and quality reduce, and can by directly contacting, food chain endanger the healthy of the mankind and raw
Life.Therefore, heavy metal pollution problem has caused the highest attention of countries in the world, and it is extremely urgent to solve this problem.
Endogenetic fungus is inside a kind of various tissues and organ for generally moving in health plant and does not cause host obvious
The fungi of illness, with host plant coevolution, the two carries out mutually material, energy and gene exchange, forms mutualism and closes
System.The metabolin of endogenetic fungus can promote growing for host plant, and enhancing host plant is the biology side of body to environment stress
Compel the resistance of (herbivore, insect, pathogen) and abiotic stress (high temperature, arid, high salt, heavy metal etc.).In recent years,
There are many reports to prove the heavy metal that endogenetic fungus can not only be in absorption effluent, and plant under the conditions of heavy metal can be promoted
Growth, help plant resistant heavy metallic poison, enhancing plant, particularly super enriching plant repairing heavy metal in soil ability.
Zhang etc. has found the Fusariumsp separated from Sedum alfredii Hance (the Sedum alfredii Hance) plant for being grown in Pb-Zn ore district
(Fusarium.oxysporum) root long, branch and the biomass of host can not only be increased, strengthen host's absorption of nutrient ingredients
And the synthesis of chlorophyll, and the resistant function of host's heavy metal and the ability of plant extract heavy metal can be strengthened.However,
Some domestic and international researchers have also discovered that some dark colors have can every endogenetic fungus (dark septate endophyte, DSE)
Promote the host plant in heavy-metal contaminated soil to grow, reduce heavy metal accumulation and the transfer of plant.Li etc. is had found one plant
Heavy metal tolerance DSE (Exophiala pisciphila) is inoculated into corn, and under the conditions of heavy-metal contaminated soil, the bacterium promotees
Enter the growth of corn, limit transfer of the heavy metal from corn root to aerial part.Therefore, using heavy metal be resistant in it is raw
Fungi reduces heavy metal and enters plant and then endanger the mankind by food chain and is good for strengthen the resistant function of plant heavy metal
Health, will be a kind of low, environment-friendly, efficiency high the approach of cost.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of new selection into plant to reduce heavy metal.
The invention provides the one plant of endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2-
1, the bacterial strain is preserved in China General Microbiological culture presevation administrative center CGMCC, address：BeiChen West Road, Chaoyang District, BeiJing City 1
Number No. 3 Institute of Microorganism, Academia Sinica of institute, 100101；Preservation date：On 2 4th, 2015；Preserving number：CGMCC
No.10522。
Specifically, the mycology feature of the bacterial strain is as follows：Bacterium colony initial stage is celadon in PDA culture medium, is gradually deepened, always
Ripe bacterium colony is blackish green, the gradual gray in edge, substratess sepia；Bacterium colony is dry, loose and soft, center slightly projection；Gas is given birth to
Mycelia is flourishing, dense, velvet-like, and mycelia has every, sepia, about 1.8~3.6 μm of diameter.Still without mitogenetic after being cultivated 30 days on PDA
Spore or ascospore produce.
Specifically, the ITS rDNA of the bacterial strain have the sequence as described in SEQ ID No.1.
Present invention also offers purposes of the described bacterial strain in plant resistance to environment stress is strengthened.
Present invention also offers purposes of the described bacterial strain in heavy metal on plants pollution is reduced.
Specifically, described plant is corn.
The bacterial strain Paraconiothyrium.cyclothyrioides MR2-1 of the present invention are derived from M. laxiflora
The endogenetic fungus of root, belong to mycota Fungi, Ascomycota Ascomycota, seat capsule Gammaproteobacteria Dothideomycetes, lattice
Spore Zoopagales Pleosporales, every sorosphere shell section, Paraconiothyrium category, cyclothyrioides kinds.
Beneficial effects of the present invention：The invention discloses the bacterial strain Paraconiothyrium of one plant of tolerable heavy metal
cyclothyrioides MR2-1.The bacterial strain heavy metal Cd and Hg MIC are respectively 0.45 and 0.20mg/
Ml, moreover it is possible to which effectively conversion L-Trp is heteroauxin.The bacterial strain can effectively improve the resistance to of plant resistance to environment stress, particularly heavy metal
By property, hence it is evident that heavy metal (Cd and Hg) is shifted from underground to aerial part in reduction plant (corn seedling), moreover it is possible to effective
Improve the oxidation resistance and chlorophyll content of plant.
The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2-1 provided by the invention, should
Bacterial strain is preserved in China General Microbiological culture presevation administrative center CGMCC, address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number Institute of Microorganism, Academia Sinica, 100101；Preservation date：On 2 4th, 2015；Preserving number：CGMCC No.10522.
Brief description of the drawings
Fig. 1 is colonial morphologies of the P.cyclothyrioides MR2-1 in PDA culture medium；
Fig. 2 is IAA standard curves；
Fig. 3 is that P.cyclothyrioides MR2-1 infect the morphologic observation of corn root under the microscope：A, b is represented
Bacterial strain infects situation in P.cyclothyrioides MR2-1 in corn root in experimental group；C represents corn in dead bacterium control group
Root is without being infected situation；
Fig. 4 is corn after P.cyclothyrioides MR2-1 co-culture two weeks with corn seedling under heavy metal stress
Aerial part and the heavy metal biological concentration coefficient of root；
Fig. 5 is a huge sum of money after P.cyclothyrioides MR2-1 co-culture two weeks with corn seedling under heavy metal stress
Category is from root to aerial part transfer ratio.
Embodiment
Used medium is in following examples：
PDA culture medium：Potato 200g, glucose 20g, agar powder 15g, distilled water is added to be settled to 1000ml.
PDB nutrient solutions：Potato 200g, glucose 20g, adds distilled water to be settled to 1000ml.
Using preceding culture medium be required to carry out in a conventional manner autoclave sterilization processing (121 DEG C, 0.24MPa,
30min)。
The endogenetic fungal bacterial strain MR2-1 of embodiment 1 separation, identification
With the resistance to plant M. laxiflora (Myricaria laxiflora) that floods in reservoir area of Three Gorges for vegetable material, by collection
Plant root sample is rinsed well under a tap, is cut into the root segment of 1cm length, with 75% alcohol-pickled 5min, is used sterilized water
5min is soaked after washing three times in 0.1% mercuric chloride solution, it is sterile to wash five times.It is flat that the good root segment of surface sterilization is put into separation
In plate (comprehensive PDA culture medium containing 125 μ g/ml streptomycin sulphates and 100 μ g/ml ampicillins).Flat board is in 28 DEG C of constant temperature
Culture, after mycelia grows, the mycelia of the single bacterium colony of picking goes to new flat board, continues to cultivate, continuous three in PDA culture medium
Secondary inoculation, is defined as single bacterium colony, without other fungies or bacterium syntrophism, it is believed that is to obtain pure culture, is named as MR2-
1.Will the last time cleaning root segment μ l spread plates of water 100,28 DEG C of incubated sterile generations, to determine to show that sterilization is
Effectively, it is endogenetic fungus to obtain bacterial strain.After obtaining pure bacterial strain MR2-1, inclined-plane preservation is forwarded to.
Bacterial strain MR2-1 is cultivated 30 days in PDA culture medium, is observed its colony growth situation and feature, is taken pictures, such as Fig. 1 institutes
Show, and observe its microscopic features.The mycology feature of the bacterial strain is as follows：Bacterium colony initial stage is celadon in PDA culture medium, gradually plus
Deep, aging bacterium colony is blackish green, the gradual gray in edge, substratess sepia；Bacterium colony is dry, loose and soft, center slightly projection；
Aerial hyphae is flourishing, dense, velvet-like, and mycelia has every, sepia, about 1.8~3.6 μm of diameter；After being cultivated 30 days on PDA still without
Conidium or ascospore produce.
By inoculation into PDB nutrient solutions, 28 DEG C, 150rpm shaken cultivations seven days, take bacterium solution (containing mycelium pellet) in
In 1.5ml centrifuge tubes, 5000rpm centrifugations 5min collects thalline, and fungal DNA, PCR amplification fungies ITS- are extracted by CTAB methods
RDNA, amplimer are ITS1 (5'-TCCGTAG GTGAACCTGCGG-3') and ITS4 (5'-
TCCTCCGCTTATTGATATGC-3').Amplified production is compared after sequencing with known array in GenBank, with
Paraconiothyrium cyclothyrioides ITS rDNA sequence similarities are up to 99%, are accredited as
This kinds of Paraconiothyrium cyclothyrioides.
Paraconiothyrium cyclothyrioides ITS rDNA sequences are as follows：
TATGCGTTGGCGGCTTCGGGGTCTGCTATCACCCTTGACTATGAGTACCAAAATATACGTCCCTCGGCG
GGGTGCACACCGCCCATGGGCCTTTTGAAAACACCTTTTGCAGTATGCTAGTATCTTCTGATTCTGTGGGCATGAAT
TTTTTACAACTTTCAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGA
ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCG
AGCGTCATTGACACCCTCAAGCTCTGCTTGGTGTTGGGCGTCTGTCCCTGCGGGGACTCGCCCCAAAGTCATTGGCA
GCCTCTGCCCGCTTCCCGCGCAGCACTGTCGCGCTTTTGGGAGGACCTACGGGTGGACTGGCGTCCAGCAAGCTCTT
TTTATTTCAACCAGCTTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAATCCCGAAGGGAAC
The endogenetic fungal bacterial strain P.cyclothyrioides MR2-1 of embodiment 2 heavy metal tolerance
P.cyclothyrioides MR2-1 are inoculated into PDA culture medium, 28 DEG C are activated for incubated 7 days.So
The fungus block of 5mm diameters is taken to be inoculated into the 100ml PDB nutrient solutions of addition various concentrations heavy metal with card punch afterwards, 28 DEG C,
150rpm shaken cultivations 14 days, observe it and whether grow and growing state.It the results are shown in Table 1.MR2-1 bacterial strains are resistant to heavy metal Cd
And Hg, MIC (final concentration in culture medium) is respectively 0.45 and 0.20mg/ml.
The growing state of bacterial strain under 1 different heavy metal concentrations of table.
In table 1："+" represents growth, and "-" represents not grow.
The endogenetic fungal bacterial strain P.cyclothyrioides MR2-1 of embodiment 3 conversion L-Trps produce IAA activity
Inoculation that a fritter has activated as described in example 2 above is selected into the nutrient solution test tubes of PDB containing 6ml, culture
Contain L-Trp (concentration 2mg/ml), shaken cultivation 14 days under 28 DEG C, 150rpm dark conditions in liquid.Experiment repeats three
It is secondary.Aseptic culture fluid is as blank control.Take 1ml fermented supernatant fluid Salkowski ' s reagents (49ml 35%HClO4+1ml
0.5M FeCl3) dark condition processing 30min, make reagent and IAA reactions in supernatant abundant, become pink.Pass through colorimetric
Method determines light absorption value, light absorption value 0.398,0.367,0.385.IAA standard curves are drawn, determine bacterial strain conversion L-Trp production
The ability of raw IAA activity, IAA standard solutions concentration is 0,5,10,15,20,25 μ g/ml, and standard curve is as shown in Figure 2.Knot
It is 18.42 ± 0.41 μ g/ that fruit, which finds that endogenetic fungus P.cyclothyrioides MR2-1 conversion L-Trps produce IAA levels,
ml。
The endogenetic fungal bacterial strain P.cyclothyrioides MR2-1 of embodiment 4 extend facilitation to corn main root
The endogenetic fungus P.cyclothyrioides MR2-1 fungus blocks activated for taking 5mm diameters with card punch are inoculated into
In the nutrient solutions of PDB containing 100ml, 28 DEG C, 150rpm shaken cultivations 7 days, 5min is centrifuged in 6000rpm, supernatant zymotic fluid adds not
Same heavy metal, the zymotic fluid (as shown in table 2) of different heavy metal concentrations is formed, then 10ml zymotic fluids are added and contained two layers
In case using in the flat board of filter paper.Corn seed alcohol and 30%H2O2(1 ︰ 1) mixing liquid disinfectant 10min, sterile washing 4
It is secondary, the corn seed disinfected is then put into flat board (10/flat board), each processing repeats four flat boards, is trained in illumination
Support after being cultivated 7 days in case, determine the length of corn main root, as a result as shown in table 2.Sterile PDB nutrient solutions are as a control group.Sterilization
Good corn seed, which is inoculated into PDA culture medium, to be cultivated, and no miscellaneous bacteria is produced to determine that corn seed sterilization is effective.
The corn seed of table 2 cultivates the main root length average value and standard error (n=4) of 7 days in zymotic fluid
| Processing | 0 | 0.02mg/ml | 0.02mg/ml | 0.01mg/ml Cd2++0.01 |
| Cd2+ | Hg2+ | mg/ml Hg2+ | ||
| Control group (CK) | 4.09±0.19 | 3.76±0.09 | 5.76±0.19 | 4.64±0.11 |
| Experimental group (MR2-1) | 6.84±0.29* | 5.96±0.09* | 9.00±0.17* | 7.14±0.23* |
" * " represents that experimental group relative comparison group increases significantly (p<0.05).
The endogenetic fungal bacterial strain P.cyclothyrioides MR2-1 potted plant experiments of embodiment 5
The experiment is carried out in illumination box.Load 450g river sands and 50g vermiculites in each flowerpot, then carry out high temperature
Autoclaving.Corn seed is sterilized by the sterilization method of embodiment 4, then takes 5 seeds to be seeded into sterile soil, in light
Cultivated 10 days according in incubator, three plants of corn seedlings are retained per basin.100ml has been cultivated to the endogenetic fungal bacterial strain of 7 days
P.cyclothyrioides MR2-1 mycelium and zymotic fluid uniformly pour into upper soll layer.The mycelium and zymotic fluid of inactivation are made
For control.Corn seedling continues culture 10 days, to form fungi-plant symbiosis body, then carries out a heavy metal stress induction (huge sum of money
Category concentration is (100mg Cd2++100mg Hg2+)/kg soil).Heavy metal free processing is as a control group.Experiment is in triplicate.
After corn seedling is vaccinated 10 days, the corn root of viable bacteria experimental group and dead bacterium control group is collected and contaminated
Color, observation endogenetic fungal bacterial strain P.cyclothyrioides MR2-1 colonize situation in corn root, as a result as shown in Figure 3.
The situation (as shown in Figure 3 c) infected by bacterium is not observed in the corn root of dead bacterium control group, and is observed in viable bacteria experimental group
Dark-coloured septate hypha crosses corn root cell, and forms helical structure (such as Fig. 3 a, shown in 3b) in the cell.
After heavy metal stress processing culture 14 days, the chlorophyll for 3 plants of corns, 6 maize leafs that each processing each repeats
(a and b) content and TAC (T-AOC) are measured (table 3).As can be seen from Table 3：Under the conditions of heavy metal free, phase
Than control group, experimental group has obvious increase in terms of TAC and chlorophyll content.In heavy metal stress condition
Under, compared to control group, experimental group has increase in terms of TAC and chlorophyll content, but TAC increases
Add not notable.
The TAC of table 3 and chlorophyll content average value and standard error (n=3)
" * " represents experimental group relative comparison group increase significantly (p<0.05).
After heavy metal stress processing culture 14 days, the aerial part and root separate collection of corn seedling, corn root are used
0.01M EDTA solution rinses after soaking 10 minutes, handles repeatedly three times, to remove the Cd for being attached to root2+And Hg2+.Corn
Dried in aerial part and root samples baking oven, precision balance is weighed, statistical analysis (table 4).Under heavy metal free stress, milpa
Upper part and root dry weight are all without significant difference.Under heavy metal stress, compared to control group, experimental group aerial part and root dry weight
All it increased, but not significantly (p>0.05).
Dry weight average value and standard error (n=3) of the corn seedling of table 4 after being cultivated 14 days under the conditions of having heavy metal free
Note：Mg/plant is mg/ strain seedling in table 4.
The effect of the endogenetic fungal bacterial strain of embodiment 6 heavy metal cadmium content in corn is reduced
The corn aerial part and root samples dried in embodiment 5 are crushed, 100mg is weighed respectively, is mixed with 10ml
The ︰ 1 of sour (Xiao Suan ︰ perchloric acid=4) cleared up in microwave dissolver (Milestone, Italy).Then, NITRATE BY FLAME ATOMIC is used
Absorption spectrometry (TAS-990 atomic absorption spectrophotometers, the general analysis in Beijing) carries out heavy metal Cd and Hg assays and statistics
Analysis.Note：During measure, with 0.5% salpeter solution dilute sample solution, heavy metal concentration is set to be on standard curve.
Transfer ratio (Translocation factor, TF) is calculated as follows, to evaluate the weight of plant roots absorption
The ability that metal shifts to aerial part：
The average content of beary metal (mg/kg) in average content of beary metal (the mg/kg)/root of transfer ratio (TF)=aerial part
Aerial part and root heavy metal biological concentration coefficient (Bio-accumulation factor, BAF) press following public affairs
Formula calculates：Bio-concentration factor (BAF)=aerial part or root content of beary metal (mg/kg)/heavy metal in soil content (mg/
kg)
By determining corn seedling aerial part and root content of beary metal, endogenetic fungus P.cyclothyrioides
MR2-1 heavy metals Hg is enriched with plant, shifts and does not make significant difference.However, reducing corn aerial part and root
There is remarkable effect in terms of portion's cadmium enrichment, as shown in Figure 4.Compared to control group, aerial part and root cadmium in the experimental group of processing
Concentration coefficient reduces 69.0% and 57.8% respectively.Therefore, endogenetic fungus P.cyclothyrioides MR2-1 are reducing jade
Meter You Miao heavy metal cadmiums have obvious effect in terms of soil is transferred to plant, and compared to control group, the plant in experimental group is to cadmium
Adsorbance reduce 64.6%, as shown in table 5.Endogenetic fungus P.cyclothyrioides MR2-1 are reducing heavy metal cadmium
Also there is remarkable effect in terms of aerial part transfer from corn root, compared to control group, the cadmium transfer in the experimental group of processing is
Number reduces 26.3%, as shown in Figure 5.
Heavy metal Cd content average value and standard error (n=3) in the corn seedling of table 5
" * " represents that experimental group relative comparison group reduces significantly (p<0.05).
Claims (4)
1. the endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2-1, the bacterial strain preserving number are
CGMCC No. 10522；
The mycology feature of the bacterial strain is as follows：Bacterium colony initial stage is celadon in PDA culture medium, is gradually deepened, and aging bacterium colony is blackish green
Color, the gradual gray in edge, substratess sepia；Bacterium colony is dry, loose and soft, center slightly projection；Aerial hyphae is flourishing, thick
Close, velvet-like, mycelia has every, sepia, about 1.8~3.6 μm of diameter；Still without conidium or ascus after being cultivated 30 days on PDA
Spore produces；
The ITS rDNA of the bacterial strain have the sequence as described in SEQ ID No.1.
2. purposes of the bacterial strain in plant resistance to environment stress is strengthened described in claim 1.
3. purposes of the bacterial strain in heavy metal on plants pollution is reduced described in claim 1.
4. the purposes described in Claims 2 or 3, it is characterised in that：Described plant is corn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510481258.2A CN105002099B (en) | 2015-03-20 | 2015-08-03 | The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510124220X | 2015-03-20 | ||
| CN201510124220 | 2015-03-20 | ||
| CN201510481258.2A CN105002099B (en) | 2015-03-20 | 2015-08-03 | The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105002099A CN105002099A (en) | 2015-10-28 |
| CN105002099B true CN105002099B (en) | 2017-12-01 |
Family
ID=54374968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510481258.2A Expired - Fee Related CN105002099B (en) | 2015-03-20 | 2015-08-03 | The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105002099B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103255068A (en) * | 2013-06-13 | 2013-08-21 | 云南大学 | Paraconiothyrium sp. |
| KR20140064174A (en) * | 2012-11-19 | 2014-05-28 | 대한민국(농촌진흥청장) | New microorganism paraconiothyrium minitans s134, and microbial agent and biopesticide containing the same |
| WO2014121366A1 (en) * | 2013-02-05 | 2014-08-14 | University Of Saskatchewan | Endophytic microbial symbionts in plant prenatal care |
-
2015
- 2015-08-03 CN CN201510481258.2A patent/CN105002099B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140064174A (en) * | 2012-11-19 | 2014-05-28 | 대한민국(농촌진흥청장) | New microorganism paraconiothyrium minitans s134, and microbial agent and biopesticide containing the same |
| WO2014121366A1 (en) * | 2013-02-05 | 2014-08-14 | University Of Saskatchewan | Endophytic microbial symbionts in plant prenatal care |
| CN103255068A (en) * | 2013-06-13 | 2013-08-21 | 云南大学 | Paraconiothyrium sp. |
Non-Patent Citations (1)
| Title |
|---|
| Structural factors of biogenic birnessite produced by fungus Paraconiothyrium sp. WL-2 strain affecting sorption of Co2+;Yu Q.等;《Chemical Geology》;20120405;第310-311卷;第103-116页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105002099A (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928212B (en) | Bacillus megaterium X3 and preparation method thereof, application | |
| CN104450552B (en) | A kind of sulfate reducing bacteria phosphate solubilizing bacteria and its application in combined repair of cadmium polluted soil | |
| CN111117910B (en) | Enterobacter ludwigii PN6 and application thereof | |
| CN103642734B (en) | Microbacterium maritypicum and application thereof in preventing sugar beet disease-causing organisms | |
| CN107058160B (en) | One plant of peanut rhizosphere bacillus amyloliquefaciens and its application | |
| CN102676398A (en) | Separation and purification method of endophytic fungi from ginkgo biloba | |
| CN113278542B (en) | Burkholderia gladioli PJB25 and application thereof | |
| CN103981102A (en) | DSE (Dark septate endophyte) bacterial strain 24L-4 and application thereof in dendrobium officinale production | |
| CN104805021A (en) | Cadmium-tolerant penicillium and separation method thereof | |
| CN113943660B (en) | Talaromyces fungus NJAU-L8 for preventing and controlling continuous cropping soil-borne blight and application thereof | |
| CN106119154B (en) | It is a kind of prevent and treat Peanut continuous cropping silborne fungal diseases bacterial strain and application | |
| CN102703333A (en) | Mycorrhizal fungi strain efficiently growing with rhododendron seedling | |
| CN103981101B (en) | A kind of DSE bacterial strain and the application in sugarcane production thereof | |
| CN117363498B (en) | Wick ham yeast CYW-7 and application thereof | |
| CN110438017A (en) | Branch spore Saksenaea vasiformis bacterial strain LJ1 and its application | |
| CN112280694B (en) | Plant endophytic fungus phomopsis D2G7 and application thereof | |
| CN103436452A (en) | Acremonium persicinum JX524288 and application thereof | |
| CN107217011B (en) | Phosphate solubilizing mycorrhizal fungi and application thereof in promoting growth of blueberries | |
| CN110205249B (en) | Method for promoting plant growth and alternaria alternate fungus used by same | |
| CN102154155B (en) | Brevibacillus brevis for preventing and treating plant fungus diseases and method for preparing biopesticide | |
| CN114836329B (en) | Trichoderma harzianum HB40609 and application thereof | |
| CN105462882A (en) | Pseudomonas aeruginosa for preventing and treating vertieillium wilt in crops and application of pseudomonas aeruginosa | |
| CN105002099B (en) | The endogenetic fungus of resistance to heavy metal Paraconiothyrium cyclothyrioides MR2 1 and its application | |
| CN113234601B (en) | Novel marine fungus strain and application thereof in drought stress resistance of plants | |
| CN111004727B (en) | Endophytic fungus Z1 for increasing biomass of casuarina equisetifolia in high-salt environment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171201 Termination date: 20180803 |