CN104988165B - Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application - Google Patents
Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application Download PDFInfo
- Publication number
- CN104988165B CN104988165B CN201510342723.4A CN201510342723A CN104988165B CN 104988165 B CN104988165 B CN 104988165B CN 201510342723 A CN201510342723 A CN 201510342723A CN 104988165 B CN104988165 B CN 104988165B
- Authority
- CN
- China
- Prior art keywords
- est4
- esterase
- engineering strain
- deep
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a kind of esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application, esterase EST4 origin comes from the esterase gene est4 codings of deep-sea sludge, its catalyzing hydrolysis temperature range is 20 55 DEG C, it is 5.0 10.0 to hydrolyze pH value, the remnant enzyme activity that 12h remains to keep more than 80% is incubated under the conditions of 45 DEG C, the remnant enzyme activity that 12h remains in that more than 90% is preserved in pure polar organic solvent；Esterase EST4 can be applied to the Kinetic Resolution reaction and the catalysis reaction of formation of short chain terpenoid for being catalyzed a variety of fragrant secondary alcohol；The present invention also constructs the engineering strain that can express above-mentioned esterase EST4, realizes heterogenous expression of the enzyme in Escherichia coli, is laid a good foundation for its industrialized production.
Description
Technical field
The invention belongs to technical field of bioengineering, be related to esterase gene, esterase, recombinant plasmid, engineering strain and
It is applied.
Background technology
The research of molecular microbial ecology is proved the microorganism for largely failing culture in environment be present.Some environment
It is middle using the microorganism that existing culture technique can cultivate less than 1%, this prompts us the microorganism more than 99% can not yet be trained
Support, it is seen that be greatly limited based on the technological approaches utilization microbial resources that microorganism is separately cultured.In recent years
As metagenomics technology develops rapidly, the shortcomings that not only eliminating traditional microbiological training method, and can directly from
DNA is extracted in environmental sample, new functional gene is obtained by the structure of functional screening and genomic library, obtained so as to improve
Obtain the chance of new biological activity material, it is possible to obtain there is the new gene of application value.
Esterase and lipase is all carboxylic acid hydrolase, is divided into 8 races.Esterase (Esterases) can be hydrolyzed less than 10
The ester bond of the short chain fatty acids of individual carbon atom, and lipase (Lipases) can then hydrolyze the long-chain fat more than 10 carbon atoms
The ester bond of fat acid.Lipase and esterase are important industrialization enzyme preparation kinds, can be reacted with catalyzing hydrolysis, transesterification, ester conjunction etc.,
It is widely used in the industry such as fats and oils processing, food, medicine, daily use chemicals.The esterase and lipase of separate sources has different catalysis
Feature and catalysis activity.Wherein, for organic synthesis have esterification or transesterification function esterase and lipase scale
Production is significant for the fine product chemicals of Enzyme catalyzed synthesis and chipal compounds.
Racemic Kinetic Resolution is the reaction that lipase is most commonly seen so far.The Its Enzymatic Resolution of secondary alcohol is so far
Untill lipase-catalyzed split the most frequently used substrate.Importance of the secondary alcohol in chiral synthesize is not only because, at the same it is heavier
Want, generally lipase has extraordinary chiral Recognition to the particularly fragrant secondary alcohol of secondary alcohol, has and preferably tears open
Divide effect.Chiral fragrant secondary alcohol is the indispensable intermediate in the fields such as medicine, cosmetics, agricultural chemicals.
Fatty acid ester in food, cosmetics, wine brewing and the most widely used fragrance material of pharmaceuticals industry for terpenol, such as
Citronellol, geraniol, the fatty acid ester etc. of linalool.Flavorant ester, raw material terpene are produced on a large scale using natural material terpenol
Enol cost is relatively low, therefore by the use of lipase or esterase as catalyst, and catalysis terpenol and acid or ester react preparation
Flavor component terpenoid has important application value.Simultaneously according to the legal provisions of the states such as the U.S., Europe：Closed by bioanalysis
Into spices be considered as natural perfume material, its added value of product is much larger than chemical method synthetic perfume, therefore biological method synthetic perfume
With potential application value.
At present, esterase DNA report is extracted also not from the sludge of deep-sea in the prior art.
The content of the invention
It is an object of the present invention to provide it is a kind of from the esterase gene est4 of deep-sea sludge, by the esterase gene
The esterase EST4 and esterase EST4 of est4 codings application.
It is another object of the present invention to provide a kind of restructuring of the esterase gene est4 containing from deep-sea sludge
Plasmid and the application containing the engineering strain of the recombinant plasmid and the engineering strain.
To reach above-mentioned purpose, solution of the invention is：
A kind of esterase gene est4 from deep-sea sludge, its base sequence such as SEQ ID NO：Shown in 1.
Wherein, the amino acid sequence of the esterase EST4 coded by above-mentioned esterase gene est4 such as SEQ ID NO：Shown in 2.
A kind of esterase EST4 from deep-sea sludge, it is encoded by above-mentioned esterase gene est4, its amino acid sequence
Such as SEQ ID NO：Shown in 2.
Wherein, above-mentioned esterase EST4 can be used in being catalyzed the hydrolysis of short chain acyl substrate, the short chain acyl substrate
Carbon atom number be less than 10.
A kind of recombinant plasmid, it includes expression vector and above-mentioned esterase gene est4.Expression vector can be preferably
pLLp-OmpA。
A kind of engineering strain, it is obtained by above-mentioned recombinant plasmid transformed Escherichia coli Top10F ', can be used in table
It is SEQ ID NO up to amino acid sequence：2 esterase, the deposit number of the engineering strain is CGMCC No.10812.
Wherein, above-mentioned engineering strain can be used in being catalyzed the hydrolysis of short chain acyl substrate, the short chain acyl
The number of the carbon atom of substrate is less than 10.
In addition, above-mentioned engineering strain can be used for being catalyzed the Kinetic Resolution reaction of a variety of fragrant secondary alcohol.
In addition, above-mentioned engineering strain can be used for the catalysis reaction of formation of short chain terpenoid.
Due to using such scheme, the beneficial effects of the invention are as follows：
The present invention is extracted esterase gene est4 from the sludge of deep-sea, and constructs the gene containing esterase gene est4
Engineered strain, it is achieved thereby that esterase gene est4 heterogenous expression, caused esterase EST4 has excellent zymetology special
Property, catalyzing hydrolysis temperature range is 20-55 DEG C, and hydrolysis pH value is 5.0-10.0, and 12h is incubated under the conditions of 45 DEG C and remains to keep
More than 80% remnant enzyme activity, the remnant enzyme activity that 12h remains in that more than 90% is preserved in pure polar organic solvent.The present invention
Esterase EST4 can be applied in catalyzing hydrolysis ester and enzymatic clarification ester process of producing product, wherein, based on transesterification,
Under the conditions of high concentration of substrate, esterase EST4 is successfully used for catalyzing and synthesizing a variety of short chain terpenoids and a variety of virtues of Kinetic Resolution
In the reaction such as fragrant secondary alcohol.
Brief description of the drawings
The SDS-PAGE figures that Fig. 1 is the esterase EST4 of the purifying of the present invention.
Fig. 2 is the esterase EST4 of the present invention most suitable hydrolysis temperature schematic diagram.
Fig. 3 is the esterase EST4 of present invention optimal reaction pH schematic diagrames.
Fig. 4 is the esterase EST4 of present invention heat endurance schematic diagram.
Fig. 5 is the esterase EST4 of present invention polar organic solvent tolerance schematic diagram.
Fig. 6 is the esterase EST4 of present invention substrate specificity schematic diagram.
Fig. 7 is that the esterase EST4 of the present invention catalyzes and synthesizes the conversion ratio schematic diagram of short chain terpenoid.
Preservation explanation
A kind of Escherichia coli (Escherichia coli) bacterial strain for expressing esterase EST4 preserves on May 18th, 2015
In China Committee for Culture Collection of Microorganisms's common micro-organisms positioned at Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
The heart (CGMCC), deposit number are CGMCC No.10812.
Embodiment
The invention provides a kind of esterase gene est4 from deep-sea sludge, the ester by esterase gene est4 codings
Enzyme EST4, esterase EST4 application, the recombinant plasmid containing the esterase gene est4 from deep-sea sludge, contain the restructuring
The application of the engineering strain of plasmid and the engineering strain.
<From the esterase gene est4 of deep-sea sludge>
The esterase gene est4 of the present invention extracts from the sludge of deep-sea, its base sequence such as SEQ ID NO：Shown in 1.
Esterase gene est4 size is 951bp.
<From the esterase gene est4 of deep-sea sludge extracting method>
The esterase gene est4 of present invention extracting method comprises the following steps：
(1) the grand genomic library of deep-sea sludge, is built
A. the deep-sea mud sample that 10g is collected is taken, uses the Meta-G-Nome of Epicentre companiesTMDNA
Isolation Kit, in strict accordance with the operation on specification, extract simultaneously purification of samples DNA；
B. grand genomic library, tool are built using sample DNA after purification, Fosmid carriers pCC1FOS and Escherichia coli
Body is as follows：With CopyControlTMFosmid Library Production Kit with pCC1FOSTMVector
(Epicentre, the U.S.) is used as carrier, using EPI300TM-T1R E.coli as host, will connect liquid phage packaging,
It is transferred in Host Strains, then the Host Strains for having infected bacteriophage is coated on the LB flat boards containing 12.5 μ g/ml chloramphenicol, 37
DEG C overnight incubation obtains transformant；Transformant on flat board is washed down with sterile LB, adds sterile glycerol to make to 20% (v/v)
To clone bacterium solution, then in -80 DEG C of preservations.
(2) positive colony of esterase, is screened
Clone's bacterium solution of preservation is diluted into suitable multiple, is coated on containing 0.5% (w/v) through emulsifying tributyrin
Screening flat board after LB- chloramphenicol (12.5 μ g/ml) processing, after 37 DEG C are cultivated 48h, transparent circle and hydrolysing activity can be formed by selecting
Higher bacterial strain lipo4.
(3) Subclone Library and the positive subclone of screening, are built
According to alkali cracking method, Fosmid plasmids are extracted from bacterial strain lipo4, with restriction endonuclease Sau3A I fragmentations, using agar
Sugared detected through gel electrophoresis, and the DNA fragmentation in the range of gel extraction 2-5kb, then by the DNA fragmentation of recovery with through BamH I at
The plasmid pBluescript II SK (+) of reason are connected and are converted DH5 α structure Subclone Libraries, by Subclone Library even spread
In containing 0.5% (w/v) through emulsify tributyrin LB- ampicillins (100 μ g/ml) handle screening flat board, 37 DEG C
After cultivating 48h, the bacterial strain that can form transparent circle is selected, scribed line duplicate acknowledgment, obtains positive subclone bacterial strain lipo4-2.
(4) esterase gene, is cloned
Plasmid is extracted from positive subclone bacterial strain lipo4-2, and is sequenced.It can be seen from sequencing result, the plasmid
Insert Fragment total length be 2864bp.For the sequence of Insert Fragment, based on NCBI/ORF Finder (http://
Www.ncbi.nlm.nih.gov/gorf.html) on-line analysis obtains a length of 951bp entire open reading frame
(ORF) est4, is named as, its base sequence such as SEQ ID NO：Shown in 1.Protein size coded by the gene order is
316 amino acid residues, its amino acid sequence such as SEQ ID NO：Shown in 2.By the gene order in GenBank BLASTx
(http://blast.ncbi.nlm.nih.gov/Blast.cgi) homologous comparison is carried out, find a similar property highest
For 48% albumen source in one plant of resistance to metal covet copper bacterium (Cupriavidus metallidurans) α/β protein hydrolysate.
Structure prediction result shows that esterase EST4 has glycine (G), histidine (H), serine (S), leucine (L)
The catalyst structure domain GXSXG (amino acid position 128 to 132) formed with glycine (G), form the catalytic center of esterase.System
Developmental analysis result shows, the V families that esterase EST4 belongs in esterase/fatty enzyme family.It follows that esterase EST4 is esterase
A newcomer in family.
According to the sequencing results, the primer of design amplification esterase EST4 full genomes：
EST4F：5'AACGCGGATCCATGCTAGTTTTATGGCTTCTAT 3' BamH I
EST4R：5'AACTAGCTAGCAGGCGCTAAGCCTGTTGCTT 3' Nhe I
Using the plasmid extracted in positive subclone bacterial strain lipo4-2 as template, expanded with the primer of above-mentioned design by PCR
Increase, obtain encoding esterase EST4 esterase gene est4.
<Esterase EST4 coded by esterase gene est4 from deep-sea sludge>
As the amino acid sequence such as SEQ ID NO of the esterase EST4 coded by above-mentioned esterase gene est4：Shown in 2, altogether
316 amino acid, its theoretical molecular are 33.8kDa.
Esterase EST4 has excellent enzymatic property, and catalyzing hydrolysis temperature range is 20-55 DEG C, and hydrolysis pH value is 5.0-
10.0, the remnant enzyme activity that 12h remains to keep more than 80% is incubated under the conditions of 45 DEG C, 12h is preserved in pure polar organic solvent
Remain in that more than 90% remnant enzyme activity.
Effect experiment 1：Recombinant esterase EST4 optimal reactive temperature analysis experiment
The Recombinant esterase EST4 of present invention optimal reactive temperature determines in the range of 20-55 DEG C.The reaction system of detection
(1.5mL) is：100mM Tris-HCl buffer solutions (pH 8.0), 1mM p-nitrophenols butyrate and 0.5 μ g pure proteins are (i.e. heavy
Group esterase EST4), add after 5min is reacted at a temperature of 20 DEG C, 25 DEG C, 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C and 55 DEG C respectively
1.0ml 0.1%SDS terminating reactions, determine light absorption value at 405nm wavelength, and testing result is as shown in Figure 2.The above results show,
Recombinant esterase EST4 optimal reactive temperature is 45 DEG C.
Effect experiment 2：Recombinant esterase EST4 optimal reaction pH value analysis experiment
Recombinant esterase EST4 optimal reaction pH is determined in the range of 5.2-10.28, and detection method is：Buffered in different pH
1mM p-nitrophenol butyrate and 0.5 μ g pure proteins (i.e. Recombinant esterase EST4) is added in liquid, is reacted under the conditions of 30 DEG C
5min, determines light absorption value at 405nm wavelength, and measurement result is as shown in Figure 3.Determining the buffer solution used is：100mM sodium citrates
Buffer solution (pH 5.2-6.4), 100mM sodium phosphate buffers (pH6.4-8.0), 100mM Tris-HCl buffer solutions (pH8.0-
And 100mM glycine-NaOH buffer solutions (pH 9.0-10.28) 9.0).Measurement result shows：Recombinant esterase EST4 optimal pHs are
8.0, activity is respectively provided with the range of pH5.0-10.0.
Effect experiment 3：Recombinant esterase EST4 zymetology stability analysis experiment
Recombinant esterase EST4 thermostabilization analysis determines in the range of 40-60 DEG C, and detection method is；By the enzyme liquid of purifying point
It is not incubated under the conditions of 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C and 60 DEG C, is then spaced same time and remnant enzyme activity is measured by sampling.Measure
The system of remnant enzyme activity is：100mM Tris-HCl buffer solutions (pH 8.0), 1mM p-nitrophenols butyrate and 0.5 μ g processing
The 1.5ml reaction systems of pure protein (i.e. Recombinant esterase EST4) composition, add 1.0ml 0.1%SDS after 5min is reacted at 30 DEG C
Terminating reaction, determines light absorption value at 405nm wavelength, and measurement result is as shown in Figure 4.Above-mentioned measurement result shows, at 40-45 DEG C
Still there is good stability after processing 60h, but higher than 50 DEG C after enzyme activity loss comparatively fast.Wherein, 12h is incubated at 40 DEG C still to protect
More than 90% enzyme activity is held, it is relatively stable；The remnant enzyme activity that 12h keeps more than 80% is incubated under the conditions of 45 DEG C.
Effect experiment 4：Recombinant esterase EST4 organic tolerance analysis experiment
The purpose of the experiment is the active influence for determining polar organic solvent to Recombinant esterase EST4, and detection method is：
By lyophilized pure enzyme (i.e. Recombinant esterase EST4) in pure organic reagent (benzene, toluene, petroleum ether, hexamethylene, n-hexane, normal heptane
And isooctane) in processing 12h, then organic solvent is removed, determine remnant enzyme activity.Surveying remnant enzyme activity system is：100mM
The 1.5ml reactions of the pure protein composition of Tris-HCl buffer solutions (pH 8.0), 1mM p-nitrophenols butyrate and 0.5 μ g processing
System, add 1.0ml 0.1%SDS terminating reactions after 5min is reacted at 30 DEG C, determine light absorption value at 405nm wavelength, measure knot
Fruit is as shown in Figure 5.Measurement result shows that Recombinant esterase EST4 preserves 12h in pure polar solvent and remains in that more than 90%
Remnant enzyme activity, illustrate that Recombinant esterase EST4 has good organic tolerance.
<Recombinant plasmid containing the esterase gene est4 from deep-sea sludge>
The esterase gene est4 recombinant plasmid (i.e. recombinant expression carrier) contained from deep-sea sludge of the present invention is
By being connected using esterase gene est4 with plasmid pLLp-OmpA (as expression vector) and structure.Esterase gene est4 with
Plasmid pLLp-OmpA binding site is BamH I and Nhe I.
Using the plasmid extracted in positive subclone bacterial strain lipo4-2 as template, with the primer containing restriction enzyme site of design
EST4F/EST4R is expanded by PCR, obtains esterase gene est4 total length.
PCR amplification system is following (50 μ L)：10 × PCR Buffer 5 μ L, dNTP Mixture (2.5mM each) 4 μ L,
EST4F/EST4R (20 μM) each 1 μ L, template 1 μ L, TaKaRa rTaq (5U/ μ L) 0.5 μ L, add ddH2O complements to 50 μ L.
PCR amplification conditions：94℃5min；94 DEG C of 30sec, 55 DEG C of 30sec, 72 DEG C of 1min, 30 circulations；72℃8min.
After agarose gel electrophoresis confirms that stripe size is correct, the band for meeting target gene size is carried out PCR primer
Gel extraction, specific steps are operated by Axygen Ago-Gel DNA QIAquick Gel Extraction Kits specification.
By Fermentas companies restriction endonuclease BamHI and the NheI cutting of PCR primer after purification, while use identical
Inscribe cleavage plasmid pLLp-OmpA is allowed to linearize, and both are connected into cyclization in system existing for ligase after purification.Will
Connection liquid is transferred to competent cell E.coli DH5 α, is uniformly coated on the solid LB media containing ammonia benzyl mycin, 37 DEG C of trainings
Support and 16h is inverted in case, the monoclonal bacterium colony on picking culture dish is sequenced, and the positive transformant through sequencing identification carries out plasmid
Extracting i.e. obtain the recombinant plasmid containing esterase gene est4.
<Engineering strain>
The engineering strain of the present invention is obtained by above-mentioned recombinant plasmid transformed Escherichia coli Top10F ', conversion side
Method is as follows：
The recombinant plasmid of structure is transferred to competent cell E.coli Top10 ', is uniformly coated on containing ammonia benzyl mycin
On solid LB media, be inverted 16h in 37 DEG C of incubators, the monoclonal on picking culture dish be seeded to culture medium containing LB (+
The μ g/ml of glucose 0.2%+Amp 120) test tube in, after 30 DEG C of shaking table culture 12h, superclean bench take 800 μ L cultivate
Liquid and 200 μ L 50% sterile glycerol are added in conservation pipe, in -40 DEG C of preservations, that is, are obtained containing esterase gene est4's
Engineering strain.
The method that esterase EST4 is obtained using the engineering strain is comprised the following steps：
(1) engineering strain (containing recombinant plasmid) of the present invention, is inoculated in the (+glucose of culture medium containing LB
The μ g/ml of 0.2%+Amp 120) test tube in, 30 DEG C of shaking table culture 12h.
(2) fresh liquid LB (the μ g/m of+glucose 0.2%+Amp 120), is inoculated into 1% inoculum concentration (v/v)
It is 0.6 or so that 37 DEG C 180 turns are shaken to OD600 soon, adds IPTG to 100 μ g/ml, while be supplemented once new Amp to 120 μ g/
Ml (being 240 μ g/ml altogether twice), 30 DEG C of induction 20h.
(3) nutrient solution, is centrifuged into 5min in 4 DEG C, 7000rpm, thalline is collected, as containing intracellular expression recombinant protein
EST4 Escherichia coli wet thallus (Escherichia coli wet thallus can also be freeze-dried after 4h and obtain freeze-dried vaccine body).
(4), Escherichia coli wet thallus is resuspended with Buffer NPI-10, should using ultrasonic disruption under low temperature water-bath
Escherichia coli wet thallus, the crude enzyme liquid after crushing draw supernatant and simultaneously use Ni-NTA after 8000rpm centrifuges 15min
Superflow Cartridge are purified, desalination, obtain destination protein (i.e. esterase EST4).
SDS-PAGE is carried out to the destination protein of acquisition, as a result as shown in Figure 1.In Fig. 1, file M represents albumen
Marker, file 1 represent esterase EST4 after purification.Fig. 1 result shows that Recombinant esterase EST4 is obtained really in Escherichia coli
Expression has been arrived, has been single band after purification under NPI-200 elution requirements.
Application Example 1
Substrate specificity analysis is carried out to resulting Recombinant esterase EST4, analysis system is 1.5ml reaction systems, and this is anti-
System is answered to contain 100mM Tris-HCl buffer solutions (pH 8.0) and 1mM short chain acyl substrates.Short chain acyl substrate can be：It is right
Nitrophenol acetic acid esters (C2), p-nitrophenol butyrate (C4), p-nitrophenol caprylate (C8), p-nitrophenol decylate
(C10), p-nitrophenol laurate acid esters (C12), p-nitrophenol myristinate (C14), p-nitrophenol palmitic acid acid
Ester (C16).
Analysis method is：0.5 μ g pure proteins (i.e. Recombinant esterase EST4) are added into analysis system, in 30 DEG C of reactions
5min, add 1.0ml 0.1%SDS terminating reactions, then determine the light absorption value at 405nm wavelength, analysis result is as shown in Figure 6.
In figure 6, C2 represents p-nitrophenol acetic acid esters, and C4 represents p-nitrophenol butyrate, and C8 represents p-nitrophenol caprylate,
C10 represents p-nitrophenol decylate, and C12 represents p-nitrophenol laurate acid esters, and C14 represents p-nitrophenol myristic acid
Ester, C16 represent p-nitrophenol palmitic acid acid esters.Fig. 6 result shows, Recombinant esterase EST4 can specifically hydrolysis of ester bonds with,
The p-nitrophenyl phenolic ester (C2, C4, C8 and C10) shorter to acyl group carbochain has higher catalytic activity, and wherein substrate is to nitre
Hydrolysing activity highest during base phenol butyrate (C4), it is more difficult to hydrolyze the longer p-nitrophenyl phenolic ester of acyl group carbochain (C12, C14 and
C16).It follows that Ester shorter to acyl chain esterase EST4 has higher hydrolysing activity, while ester is also confirmed
Enzyme EST4 prefers to short chain acyl substrate (C<10).
Application Example 2
Freeze-dried vaccine body will be obtained after above-mentioned Escherichia coli wet thallus freeze-drying 4h, thalline is freezed as catalysis using this
Agent.In 50ml conical flask with stopper respectively by 2.0M cinnamyl alcohol, citronellol and geraniol and 6.0M vinyl acetate, just oneself
Alkane forms 5.0ml nonaqueous phase transesterification system.The amount of thalline is freezed by 10mg/ml, it is transesterification anti-to be added to nonaqueous phase
Answer in system, under the conditions of 40 DEG C, with 250rpm speed rotation concussion 24h, interval time sampling, with height on constant-temperature table
Gas chromatographic detection is imitated, testing result result is as shown in fig. 7,2.0M cinnamyl alcohols, citronellol and geraniol pass through bioenzymatic conversion
The conversion ratio for obtaining cinnamyl acetate, citronellyl acetate and geranyl acetate is respectively 100%, 99.14%, 92.25%.Short chain terpene
The carbon atom of the c-terminus of alkenes ester is less than 10, includes acetic acid esters.
Application Example 3
Freeze-dried vaccine body will be obtained after above-mentioned Escherichia coli wet thallus freeze-drying 4h, thalline is freezed as catalysis using this
Agent.Secondary alcohol is respectively：Alpha-phenyl ethyl alcohol, α-phenylpropanol, 4- phenyl -2- butanol, 1- phenyl -2- propyl alcohol, 1- (3- fluorophenyls) ethanol,
1- (3- chlorphenyls) ethanol, 1- (3- bromophenyls) ethanol, 1- (3- aminomethyl phenyls) ethanol, 1- (3- methoxyphenyls) ethanol, 1-
(4- fluorophenyls) ethanol, 1- (4- chlorphenyls) ethanol, 1- (4- bromophenyls) ethanol, 1- (4- aminomethyl phenyls) ethanol, 1- (4- methoxies
Base phenyl) ethanol, (±)-α-(trifluoromethyl) benzylalcohol, (±) -1- (2- furyls) ethanol.In 50ml conical flask with stopper, instead
System is answered by 1:3 mol ratios add secondary alcohol with vinyl butyrate and mended with n-hexane to 5.0ml, then add 50mg freeze-dried vaccines
Body, concussion is rotated in 30 DEG C of constant-temperature table 200rpm speed, with high performance liquid chromatography detection product, the testing result such as institute of table 1
Show.
The esterase EST4 Kinetic Resolution secondary alcohol results of table 1
| Numbering | Substrate | Concentration/mM | ees/ % | C/% | Reaction time/h | E |
| 1 | α-phenylpropanol | 1000 | 99.42 | 54.22 | 8 | 65 |
| 2 | 1- phenyl -2- propyl alcohol | 1000 | 99.99 | 51.49 | 5 | >200 |
| 3 | 4- phenyl -2- butanol | 600 | 99.99 | 53.33 | 12.5 | 145 |
| 4 | Alpha-phenyl ethyl alcohol | 1000 | 99.34 | 51.82 | 9 | 142 |
| 5 | 1- (3- fluorophenyls) ethanol | 100 | 99.99 | 53.44 | 3 | 140 |
| 6 | 1- (3- chlorphenyls) ethanol | 600 | 99.42 | 53.10 | 11 | 88 |
| 7 | 1- (3- bromophenyls) ethanol | 100 | 99.99 | 50.17 | 4 | >200 |
| 8 | 1- (3- aminomethyl phenyls) ethanol | 100 | 99.99 | 51.61 | 4 | >200 |
| 9 | 1- (3- methoxyphenyls) ethanol | 100 | 99.99 | 50.00 | 4 | >200 |
| 10 | 1- (4- fluorophenyls) ethanol | 600 | 99.19 | 55.72 | 9 | 45 |
| 11 | 1- (4- chlorphenyls) ethanol | 600 | 94.34 | 51.55 | 11 | 60 |
| 12 | 1- (4- bromophenyls) ethanol | 600 | 99.38 | 51.87 | 9 | 141 |
| 13 | 1- (4- aminomethyl phenyls) ethanol | 100 | 98.11 | 55.96 | 4 | 35 |
| 14 | 1- (4- methoxyphenyls) ethanol | 600 | 99.99 | 50.84 | 11 | >200 |
| 15 | (±)-α-(trifluoromethyl) benzylalcohol | 100 | 99.99 | 50.00 | 5 | >200 |
| 16 | (±) -1- (2- furyls) ethanol | 100 | 97.57 | 51.79 | 2 | 91 |
Enantiomeric excess value (ee)：Ee=(R-S)/(R+S), wherein R, S are respectively the content (%) of two kinds of enantiomers.
Conversion ratio (C)：C=ees/(ees+eep), wherein eesFor substrate enantiomer excessive value, eepFor product enantiomer mistake
Value.
Enantioselectivity rate E values are for representing effect of the enzyme to split substrate, and E values are bigger, then in conversion ratio 50%
The optical purity of product is bigger.Typically as E ＜ 15, selectivity is poor, without practical value.E=ln [(1-C) (1-ees)]/
ln[(1-C)(1+ees)]。
As shown in Table 1, esterase EST4 shows good enantio-selectivity in terms of secondary alcohol Kinetic Resolution.Ester
Enzyme EST4 can realize that in conversion ratio be 50% or so to alpha-phenyl ethyl alcohol and alpha-phenyl ethyl alcohol meta, the derivative of para-orientating group
When obtain the pure substrate of single mapping；In addition, it equally has well to different size side chain and the secondary alcohol of different hydroxy positions
Fractionation effect, and under higher concentration of substrate realize split.
In addition, the esterase EST4 of the present invention can also be in the preparation of enzymatic synthesis of natural essence and flavoring agent and chiral medicinal intermediate
During applied.
The above-mentioned description to embodiment is that this hair is understood that and used for ease of those skilled in the art
It is bright.Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein
General Principle is applied in other embodiment without by performing creative labour.Therefore, the invention is not restricted to above-described embodiment,
Those skilled in the art do not depart from improvement that scope made and modification all should be in this hairs according to the announcement of the present invention
Within bright protection domain.
Claims (9)
- A kind of 1. esterase gene est4 from deep-sea sludge, it is characterised in that：Its nucleotide sequence such as SEQ ID NO：1 institute Show.
- A kind of 2. esterase EST4 from deep-sea sludge, it is characterised in that：It by deriving from deep-sea as claimed in claim 1 The esterase gene est4 codings of sludge, its amino acid sequence such as SEQ ID NO：Shown in 2.
- 3. the esterase EST4 from deep-sea sludge is in the hydrolysis of catalysis short chain acyl substrate as claimed in claim 2 Application, wherein, the number of the carbon atom of the short chain acyl substrate is less than 10.
- A kind of 4. recombinant plasmid, it is characterised in that：Comprising expression vector and as claimed in claim 1 from deep-sea sludge Esterase gene est4.
- 5. recombinant plasmid according to claim 4, it is characterised in that：Described expression vector is pLLp-OmpA.
- A kind of 6. engineering strain, it is characterised in that：The engineering strain is by using restructuring as claimed in claim 4 Plasmid conversion Escherichia coli Top10F ' is obtained, and it is SEQ ID NO that it, which is used for express amino acid sequence,：2 esterase, the gene work The deposit number of journey bacterial strain is CGMCC No.10812.
- 7. application of the engineering strain as claimed in claim 6 in the hydrolysis of catalysis short chain acyl substrate, described The number of the carbon atom of short chain acyl substrate is less than 10.
- 8. engineering strain as claimed in claim 6 answering in the Kinetic Resolution reaction of a variety of fragrant secondary alcohol is catalyzed With.
- 9. application of the engineering strain as claimed in claim 6 in the catalysis reaction of formation of short chain terpenoid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510342723.4A CN104988165B (en) | 2015-06-19 | 2015-06-19 | Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510342723.4A CN104988165B (en) | 2015-06-19 | 2015-06-19 | Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104988165A CN104988165A (en) | 2015-10-21 |
| CN104988165B true CN104988165B (en) | 2018-03-23 |
Family
ID=54300059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510342723.4A Active CN104988165B (en) | 2015-06-19 | 2015-06-19 | Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104988165B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112430585B (en) | 2021-01-27 | 2021-04-27 | 凯莱英生命科学技术(天津)有限公司 | Esterase mutant and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101880695A (en) * | 2010-02-26 | 2010-11-10 | 华东理工大学 | Method for preparing (S)-naproxen by enzyme resolution of racemic naproxen ester |
| CN102839141A (en) * | 2012-09-13 | 2012-12-26 | 华东理工大学 | Enterobacter capable of producing esterase, esterase and gene as well as application in preparation of taxol chiral precursor |
-
2015
- 2015-06-19 CN CN201510342723.4A patent/CN104988165B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101880695A (en) * | 2010-02-26 | 2010-11-10 | 华东理工大学 | Method for preparing (S)-naproxen by enzyme resolution of racemic naproxen ester |
| CN102839141A (en) * | 2012-09-13 | 2012-12-26 | 华东理工大学 | Enterobacter capable of producing esterase, esterase and gene as well as application in preparation of taxol chiral precursor |
Non-Patent Citations (2)
| Title |
|---|
| production of an esterase from fusarium oxysporum catalysing transesterification reactions in organic solvents;P. Christakopoulos et al.;《Process Biochemistry》;19981231;第33卷(第7期);第729-733页 * |
| 活性污泥宏基因组Fosmid文库的构建;苟敏等;《华南理工大学学报（自然科学版）》;20120131;第40卷(第1期);第120-124页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104988165A (en) | 2015-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mondal et al. | Studies on the extracellular tannase from newly isolated Bacillus licheniformis KBR 6 | |
| Kim et al. | Production of 10-hydroxystearic acid from oleic acid and olive oil hydrolyzate by an oleate hydratase from Lysinibacillus fusiformis | |
| Suda et al. | Evidence for a novel Chlorella virus-encoded alginate lyase | |
| CN101921742B (en) | (+) gamma-lactamase with activity on splitting racemate gamma-lactam as well as coded gene and application thereof | |
| Oliveira et al. | Production of methyl oleate with a lipase from an endophytic yeast isolated from castor leaves | |
| CN108642025B (en) | Lipase mutant with improved enzyme activity and position selectivity and application thereof | |
| CN107142251A (en) | Serratieae carbonyl reductase and its application in optical activity alkyl lactone is prepared | |
| WO2008046328A1 (en) | A levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid | |
| Li et al. | Screening, purification and characterization of lipase from Burkholderia pyrrocinia B1213 | |
| Johri et al. | Purification and characterisation of an ester hydrolase from a strain of Arthrobacter species: its application in asymmetrisation of 2-benzyl-1, 3-propanediol acylates | |
| CN102226165A (en) | Engineering bacterium for producing Phospholipase A2 (PLA2) and applications thereof | |
| Li et al. | Production, characterization, and application of an organic solvent-tolerant lipase present in active inclusion bodies | |
| CN102260657B (en) | Lipase gene and recombinase thereof, and application of lipase gene in preparing optically active mandelic acid | |
| CN104988165B (en) | Esterase est4, esterase EST4, recombinant plasmid and engineering strain and its application | |
| CN103131659B (en) | Organic solvent-resistant lipase, as well as encoding gene, producing strain and application thereof | |
| CN103805617B (en) | 1,3- specific lipases, its coding gene sequence and application thereof | |
| CN102329745B (en) | High-stability organic solvent-resistant lipase producing strain and lipase as well as gene and application thereof | |
| CN104561059B (en) | Cold esterase and its encoding gene E40 are fitted with application in a kind of ocean | |
| CN103215238A (en) | Marine bacterial novel esterase, as well as preparation method and application thereof | |
| CN111057692A (en) | Esterase, encoding gene, vector, recombinant cell and application thereof | |
| CN107142287B (en) | Artemisinic aldehyde double-bond reductase DBR1 and application of recombinant bacterium thereof in preparation of dihydro-beta-ionone | |
| Degani | Production and purification of cutinase from fusarium oxysporum using modified growth media and a specific cutinase substrate | |
| CN102174422B (en) | Lipase producing strain tolerant to organic solvent as well as genes and applications of lipase | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| Bhardwaj et al. | Influence of culture conditions on the production of extracellular esterase from Bacillus licheniformis and its characterization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wei Dongzhi Inventor after: Wang Hualei Inventor after: Gao Wenyuan Inventor before: Wang Hualei Inventor before: Gao Wenyuan Inventor before: Wei Dongzhi |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230907 Address after: 201403, 1st Floor, Building 34, No. 22, Lane 800, Lanfeng Road, Fengxian District, Shanghai Patentee after: Baikaisheng (Shanghai) Biotechnology Co.,Ltd. Address before: 200237 No. 130, Meilong Road, Shanghai, Xuhui District Patentee before: EAST CHINA University OF SCIENCE AND TECHNOLOGY |