CN104975026B - Peanut Diacrylglycerol acyl transferase AhDGAT3 promoters and its preparation method and application - Google Patents

Abstract

Cultivate peanut Diacrylglycerol acyl transferase the invention discloses oneAhDGAT3Promoter（P _AhDGAT3 ）Preparation method and applications.Nucleotide sequence of the promoter as shown in SEQ ID No.1.Cloned using genome walking methodP _AhDGAT3 Sequence, extracts genomic DNA using SDS cracking process, uses endonuclease digestion DNA respectively in different systems, after tab connection breaking, first round PCR amplification is carried out by primer of GSP1 and AP1, carrying out the second wheel as primer using GSP2 and AP2 expands, and is containedP _AhDGAT3 DNA sequence dna.The promoter has the function of to drive exogenous gene expression, its expressive site is in the embryo of the tender seed of plant children, it is a kind of tissue specificity expression promoter, being applied in transgenic engineering can drive target gene to express accumulation in the tender seed embryo of children, avoid causing unnecessary waste in vegetable metabolic process, therefore the promoter has a good application prospect in transgenic plant genetic engineering.

Description

Peanut Diacrylglycerol acyl transferaseAhDGAT3Promoter and preparation method thereof and Using

Technical field

The present invention relates to field of plant genetic, and in particular to one cultivates peanut Diacrylglycerol acyl transferase geneAhDGAT3Promoter（It is named asP _AhDGAT3 ）, preparation method and its application in plant genetic engineering.

Background technology

The selection and breeding of crop varieties are carried out by transgenic approach, it is advantageous that transgenosis is from organism affiliation Limitation, theoretically, the gene for conversion can derive from any species or artificial synthesized gene.The whole world turns within 2014 Gene plant cultivated area reaches 1.8 hundred million hectares, and annual growth is between 3%-4%, and transgenic technology has become plant at present The important means of breed improvement.

There are two required elements in plant transgene, be promoter and gene respectively.Promoter is one in organism Segment DNA fragment, is the cis-regulatory sequence positioned at gene transcription start site upstream, is combined with the recognition factor of trans-acting, Interacted by RNA polymerase with trans-acting factor, the transcription of promotor gene.It is the weight during controlling gene expression The factor is wanted, which determines the specificity in animals and plants space of gene expression, time and expression intensity in growth course.According to work With mode and function, promoter can be divided into composing type, specificity and inducible promoter, in some cases, a kind of promoter Also the characteristic of other type promoters can be had concurrently.

Promoter can play a key effect in structure during high level expression heterologous expression vector, it determines outer The transcriptional efficiency of source gene and the expression of gene.The foreign gene of constitutive promoter driving is in all of transfer-gen plant Stablize expression in developmental stage and tissue.Conversion to many dicotyledons, is generally used containing cauliflower mosaic virus (CaMV) 35S promoter or the plasmid vector of nopaline synthase no promoters, and in monocot transformation most Common is the plasmid vector containing rice actin Act promoters, maize ubiquitin Ubi promoters and 35S promoters.But It is the waste that many times lasting high efficient expression of the foreign gene in recipient plant not only causes the energy in organism, Er Qie In a organized way in expression be possible to that there is toxic action in itself to plant, or even cause Transgene-safty problem.Therefore, organize The research and application of specificity promoter and inducible promoter are increasingly subject to the attention of breeder.

Tissue-specific promoter refers to that the gene of driving is only expressed in a certain particular organization or organ, or simply exists Some moment expression in plant growth and development process.As root-specific promoter, Arabidopsis leaf specificity start Son, tomato fruit-specific promoter, Rice Anther specificity promoter, endosperm specificity promoter, cotton fiber specific Promoter etc..Specificity promoter can not only cause foreign gene to play a role in acceptor, but also can effectively reduce to planting The adverse effect of thing.

Peanut is the economy and oil crops planted extensively in worldwide, contains abundant aliphatic acid in peanut kernels And albumen, it is important grease and albumen source.Aliphatic acid is mainly by unsaturated fat pinolenic acid and linoleic acid in peanut oil Form, both account for 80% or so of peanut oil total fatty acid content, are a kind of more healthy edible oils, in the world, edible oil disappears Critical role is occupied in expense and snack food supply.With the improvement of people's living standards, the alimentary health-care function of peanut is increasingly It is taken seriously, the ratio that food processing accounts for total output further increases.And as the propulsion of urbanization, cultivated area constantly subtract Few, this requires us to need to further improve the yield and quality of peanut.The increasingly mature of transgenic technology produces to improve peanut Amount and quality provide new approach, but are faced with the security risk of transgenosis.Specific table is used in transgenic research The promoter reached is to solve the possible ways of this risk.

Therefore, the present invention develops a peanut endogenesis promoter.The reporter gene driven by detecting the promoterGUS Expression characteristic, it was demonstrated that the gene of promoter driving is expressed in the embryo of the tender seed of children, and discovery table does not reach at other positions. Our result imply that the promoter has suitable application prospect in transgenic plants.

The content of the invention

The purpose of the present invention：It is to provide one to cultivate peanut Diacrylglycerol acyl transferase geneAhDGAT3Promoter.This is opened The spatial and temporal expression profile of mover can be used for the expression-form of research gene, and advantage is, from plant endogenous organizing specific Property promoter can be accurately positioned regulated and controled gene, particular organization or period table of the driving target gene in genetically modified plants Reach, avoid causing the waste of plant self energy and material, improve the expression efficiency of foreign gene in transgenic plants, limitation Its expressive site, can be applied to the transgenic research of plant genetic engineering research and peanut.

Another object of the present invention：One is provided to cultivate peanut Diacrylglycerol acyl transferase geneAhDGAT3Promoter Preparation method, by carrying out genomic walking to Peanut genome, obtains peanut Diacrylglycerol acyl transferase geneAhDGAT3 Promoter.

Another object of the present invention：There is provided a kind of containing plant efficient expression promoterAhDGAT3Recombinant vector, contain There is the promoter nucleotide sequence.By this carrier arabidopsis thaliana transformation, can obtainGUSGene efficient table in plant The arabidopsis transfer-gen plant reached.

A further object of the invention is：One is provided to cultivate peanutP _AhDGAT3 Application of the promoter in the tender seed embryo of children.

In order to complete above-mentioned purpose, the present invention adopts the following technical scheme that：

A kind of separated peanut Diacrylglycerol acyl transferase promoterP _AhDGAT3 Nucleotide sequence such as SEQ ID No.1 It is shown.

Peanut Diacrylglycerol acyl transferase promoterP _AhDGAT3 Preparation method, comprise the following steps：

（1）PeanutP _AhDGAT3 The primer sequence of promoter is：

AP1：5'–GTAATACGACTCACTATAGGGC–3'；

GSP1：5'–GGGCACGTGACATTCCTTAGAACGGC–3'；

AP2：5'–ACTATAGGGCACGCGTGGT–3'；

GSP2：5'–GCCTGAAACCTCCATCGTTGATGGTGAG–3'；

（2）Peanut promoterP _AhDGAT3 Preparation process：

According to genomic walking kit（Genome Walker^TM Universal kit, CLONTECH companies produce, goods Number：638904）Illustrate, take the DNA of 5 μ l peanuts, useDraI digestion, reaction system are as follows：5 μ l of DNA,DraI 1.6 μ l, 10 2 μ l of × buffer, with sterile water polishing to 20 μ l, 37 DEG C overnight, with the agarose gel electrophoresis that mass volume ratio is 1% Detect digestion effect；

Respectively with the restriction enzyme for producing flat endDraI、EcoRV、PvuII、StuI andSmaI is in 100 μ l systems About 2.5 μ g of interior digestion（2.0-3.0 μg）Genomic DNA, reaction system is as follows：2.5 μ g of DNA, restriction enzyme 8 10 μ l of μ l, 10 × buffer, sterile water polishing is to 100 μ l, and 37 DEG C overnight；

Purified after the completion of digestion, purification step is as follows：The 3M sodium acetates and 50 μ of 10 μ l is added into digested liquid L volume ratios are 95% ethanol solution, and 3h is precipitated at -20 DEG C, then 12000 revs/min（rpm）15 min are centrifuged, use volume Ethanol than 70% washs twice, and 12000 rpm centrifuge 5 min, dry at room temperature, is dissolved with 20 μ l sterile waters；

Specific linkers are added after the completion of purifying（Genome Walker Adaptor）（There is provided in kit）, reactant System is as follows：10 × T4 ligase buffer, 2.0 μ l, 8.0 μ l, T4 ligase of DNA 1 the μ l, Genome of digestion processing 14.0 μ l of Walker Adaptor, sterile water are mended to 20 μ l, and 16 DEG C overnight, and connection liquid distilled water is diluted 10 times, is protected It is stored in -20 DEG C；Thus five kinds are established through restriction enzyme enzymatic treatment and is connected with the DNA library of specific linkers；

Using foundation through five kinds of restriction enzyme enzymatic treatments and be connected with specific linkers DNA library as template, carry out two-wheeled PCR reacts, and first round PCR is reacted using GSP1 and AP1 as primer, and system is as follows：10 × buffer, 5 μ l, dNTPs mixture 1.0 2.5 2.5 μ l, Taq enzyme of μ l, AP1 of μ l, GSP1 0.2 μ l, diluted 0.1 μ l of DNA library, sterile water are mended to 50 μ l；Response procedures are as follows：94 DEG C of 1 min of pre-degeneration；98 DEG C of 10 s of denaturation, 72 DEG C of 2 min of extension, totally 7 circulate；98 DEG C of denaturation 10 s, 68 DEG C of 2 min of extension, totally 33 circulations；72℃ 10 min；

Second wheel PCR reactions, using 50 times of dilutions of first round PCR reaction product as template, using GSP2 and AP2 to draw Thing is expanded, and reaction system is as follows：The 1.0 μ l of dNTPs mixture of 10 × buffer 5 μ l, 10mM, 10 μM GSP2 2.5 μ l, the 0.2 μ l of Taq enzymes of 10 μM of AP2 2.5 μ l, 5 units/μ l, dilute 1.0 μ l of template solution, nothing Bacterium water is mended to 50 μ l, response procedures with first round PCR, after the completion of recovery purifying second take turns PCR product, and be connected with carrier T, Contained through sequencingP _AhDGAT3 The DNA of full length sequence.

A kind of expression vector, contains the peanut Diacrylglycerol acyl transferase promoterP _AhDGAT3 。

One cultivates peanutP _AhDGAT3 The construction method of recombinant expression carrier, is usedKpnⅠ/ BamHI double digestion is connected withP _AhDGAT3 's pMD18-P _AhDGAT3 The promoter fragment and the large fragment of pBI121 to get off with pBI121 plasmids, gel recycling digestion, connection turn Change Escherichia coli, be built into plant expression vector pBI- P _AhDGAT3 。

A kind of host strain, contains the expression vector pBI- P _AhDGAT3 。

The host strain is Agrobacterium EHA105.

The separated promoterP _AhDGAT3 Start application of the target gene in downstream in vegetable seeds rataria.

The positive beneficial effect of the present invention（Advantage）：

1st, the present invention develops a peanut endogenesis promoter, the reporter gene driven by detecting the promoterGUS's Expression characteristic, it was demonstrated that the gene of promoter driving is expressed in the embryo of the tender seed of children, and discovery table does not reach at other positions.From Improve nutritional quality and transgenosis safe prevention and control of seed etc. to consider, this promoter has application potential, imply that The promoter has preferable application prospect in transgenic plants.

2nd, the promoter that promoter cloning process provided by the present invention is cloned into, can be by rightGUSThe regulation and control of gene And tissue chemical analysis, obtain the peanut promoter with tissue specific expression.

3rd, the present invention is cloned into peanut sourceP _AhDGAT3 , useP _AhDGAT3 Replace the CaMV35S promoters on pBI121 plasmids Sequence, forms pBI-P _AhDGAT3 Recombinant plant expression vector, it is thereinGUSGene byP _AhDGAT3 Regulation and control.Pass through transgenic experiments Prove, promoter high intensity in the tender embryo of seed children drivesGUSThe expression of gene and do not driven completely in other tissuesGUSThe characteristic of gene expression, enlightenment applicant can replace CaMV35S strong promoters with this promoter and be sent out to drive with seed Educate, improve seed quality or lethal relevant gene so that gene overexpression in seed rataria, artificial creation's quality change Non-defective unit kind, enriches germ plasm resource, or improves the biological safety of genetically modified plants, suppresses the diffusion of foreign gene, prevents gene Drift about.

4th, it is of the inventionAhDGAT3The preparation method of promoter, by carrying out genomic walking to Peanut genome, obtains Peanut Diacrylglycerol acyl transferase geneAhDGAT3Promoter, this method is easy to operate, as a result reliable and stable.

5th, the plant efficient that contains of the invention expresses promoterP _AhDGAT3 Recombinant vector, be sized for, in plant easily In conversion, the marker gene carriedGUSExpression intensity is high, easily detection.By this carrier arabidopsis thaliana transformation, can obtainGUSThe arabidopsis transfer-gen plant of gene high efficient expression in plant.

6th, peanut of the inventionP _AhDGAT3 Promoter can be applied in the tender seed embryo of children.P _AhDGAT3 Function can reflect PeanutAhDGAT3The function of gene, i.e., have critical function in Seed development；Under the driving of the promoter, purpose Gene is mainly expressed in the young tender seed embryo of plant, and is not expressed completely in other tissues.This is with tissue specificity The promoter of expression is in plant genetic engineering and Transgene-safty（It is edible, prevent foreign gene from spreading）In there is important application valency Value.

Brief description of the drawings

Fig. 1 expands for a kind of genomic walkingP _AhDGAT3 Fragment electrophoretic figure.

Swimming lane 1,2,3,4,5 is respectivelyDra I、EcoRⅤ、Pvu II、Stu I andSma 5 bases formed after I digestions Because of the PCR amplification result in a group DNA " storehouse "；Swimming lane M represents the nucleic acid Marker of 500 bp ladder.

Fig. 2 is one kindAhDGAT35 ' RACE electrophoretograms of gene.

Swimming lane 1 representsAhDGAT35´RACE；Swimming lane M represents the nucleic acid Marker of DL2000.

Fig. 3 isP _AhDGAT3 Promoter sequence cis-acting elements is analyzed.

Square frame represents TATA box（Sequence is：TATAT）, black matrix represents CAAT box（Sequence is：CAAAT）,

Underscore represents the transcript regions of ATG upstreams（Sequence is：AAACCACAGAAGAGAGAAAAGGAGAATTT

GGTTCCTAATTAATTCTCACCATCAACG）；Oblique black matrix ATG represents translation initiation site.

Fig. 4 is a kind of pBI- of structureP _AhDGAT3 Carrier strategies schematic diagram.

Fig. 5 is a kind of conversion carrier pBI-P _AhDGAT3 Partial transgenic Arabidopsis plant PCR qualification figures.

Swimming lane M represents the nucleic acid Marker of 500 bp ladder；Swimming lane P represents pBI-P _AhDGAT3 The PCR amplification knot of plasmid Fruit；Swimming lane CK represents the PCR amplification result of wildtype Arabidopsis thaliana；Swimming lane 1-13 represents the PCR amplification result of some positive strain.

Fig. 6 is one kindP _AhDGAT3 DrivingGUSThe histochemical stain result of gene.

The implication of each small figure, A in figure：Seedling on the 1st（It is colourless）；B：Seedling on the 5th（It is colourless）；C：Seedling on the 10th（It is colourless）；D：Stem and stem Leave（It is colourless）；E：Inflorescence（It is colourless）；F：The Post flowering rataria of 2 days（It is colourless）；G：The Post flowering rataria of 4 days（Shown in arrow）； H：The Post flowering rataria of 6 days（Shown in arrow）；I：The Post flowering rataria of 8 days（It is colourless）；J：The Post flowering rataria of 10 days（It is colourless）； K：The Post flowering rataria of 12 days（It is colourless）；L：The Post flowering rataria of 14 days（It is colourless）；DPA：Represent Post flowering；Bar =0.5 mm.

Embodiment

According to following embodiments, the present invention can be better understood from, but following embodiments are not offered as appointing the present invention What is limited.

Embodiment 1：One cultivates peanutP _AhDGAT3 The preparation method of promoter, this method comprise the following steps：

1. peanutP _AhDGAT3 The preparation of promoter：

Utilize lauryl sodium sulfate（SDS）Cracking process extracts the DNA of peanut（J. Pehanorm Brooker D.W. Russells Write, Huang Peitang etc. translates molecular cloning texts guide（The third edition）Science Press）, according to genomic walking kit（Genome Walker^TM Universal kit, Clontech companies produce, article No.：638904）Operation sequence, carries out genomic walking, step Row two-wheeled PCR amplification is moved into, clone obtains peanutP _AhDGAT3 Promoter（2181 bp）.

Step moves the primer such as table 1.

1 genomic walking of table is clonedP _AhDGAT3 The primer

PeanutP _AhDGAT3 What is prepared comprises the following steps that：

According to genomic walking kit（Genome Walker^TM Universal kit, CLONTECH companies produce, goods Number：638904）Illustrate, slightly change, respectively with the restriction enzyme for producing flat endDra I、EcoRⅤ、Pvu II、Stu I andSma The genomic DNA of I about 2.5 μ g of digestion in 100 μ l systems, establish four it is through restriction enzyme enzymatic treatment, It is connected with specific linkers（Genome Walker Adaptor）（There is provided in kit）DNA " storehouse ", using its as template into Row two-wheeled PCR reacts.Take 1 μ l DNA（1 μg/μL）WithDraI digestion, detects its purity.

System is as follows：5 μ l of DNA,DraⅠ（10 units/μ l）1.6 2 μ l of μ l, 10 × buffer, sterile water polishing is extremely 20 μl.37 DEG C, overnight, with 1%（Mass volume ratio, it is same as below）Agarose gel electrophoresis detects digestion effect.Distinguish afterwards WithDra I、EcoRⅤ、Pvu II、Stu I andSma Five kinds of restriction endonuclease difference digestion DNA of I, reaction system are as follows：DNA（0.1 μg /μl）25 μ l, restriction endonuclease（10 units/μ l）8 10 μ l of μ l, 10 × buffer, sterile water polishing to 100 μ l, 37 DEG C of mistakes Night.

The 3M sodium acetates and 50 μ l 95% of 10 μ l is added into digested liquid（Volume ratio, it is same as below）Ethanol, -20 DEG C place 3 it is small when more than, then 12000 rpm centrifuge 5 minutes, remove supernatant, with 70% ethanol wash precipitate twice, 12000 Rpm centrifugations 5 minutes, at room temperature（20-25℃）Dry, the DNA dried with the dissolving of 20 μ l sterile waters.

The reaction system of specific linkers connection is as follows：10 × T4 ligases buffer, 2.0 μ l, digestion processing 8.0 μ l, T4 ligases of DNA（1 unit/μ l）1 μ l, AD1（Adapter-primer, kit carry）（25 μM）4.0 μ l, it is sterile Water is mended to 20 μ l, and 16 DEG C overnight.Connection liquid is diluted 10 times with distilled water, is stored in -20 DEG C.

With genomic walking specific primer GSP1（Table 1）The reaction of first round PCR is carried out, system is as follows：10×buffer （Without MgCl₂）5 μ l, dNTPs mixture (10 mM) 1.0 μ l, GSP1 (10 μM) 2.5 μ l, AP1 (10 μM) 2.5 μ l, Taq enzyme (5 units/μ l), 0.2 μ l, the 0.1 μ l of connection liquid after dilution, sterile water are mended to 50 μ l.Response procedures It is as follows：94 DEG C of 1 min of denaturation；98 DEG C of 10 s of denaturation, 72 DEG C of 2 min of extension, 7 circulate；98 DEG C of 10 s of denaturation, 68 DEG C of extensions 2 min, 33 circulations；72℃ 10 min.

The template reacted by the use of the PCR reaction products of 50 times of dilution first round of distilled water as the second wheel PCR, is walked with genome Move specific primer GSP2（Table 1）The second wheel PCR reactions are carried out, reaction system is as follows：10×buffer（Without MgCl₂）5 μ 1.0 2.5 μ l of μ l, GSP2 (10 μM) of l, dNTPs mixture (10 mM), specific linkers（Genome Walker Adaptor, kit is interior to be provided）0.2 μ l of (10 μM) 2.5 μ l, Taq polymerase (5 units/μ l), template solution 1.0 μ l, sterile water are mended to 50 μ l.Response procedures are reacted with first round PCR, PCR amplification result such as Fig. 1.Recovery purifying second takes turns PCR Product, and it is connected to sequencing T-vector carriers（It is same as below purchased from TaKaRa companies）On, convert E. coli competent （It is same as below purchased from Dalian treasured bioengineering Co., Ltd）, and be sequenced.

According to RACE kits（SMART^TMRACE cDNA Amplification Kit, purchased from Clontech companies, goods Number：634941）Operating instruction, synthesizes the first chain cDNA, step is as follows by masterplate of peanut children okra fruit benevolence RNA：1.0-2.75 μl 5 ˊ CDS Primer A of RNA, 1.0 μ l, add dd H₂O polishings add 1 to 3.75 μ l, 72 DEG C of 3 min, 42 DEG C of 2 min II A oligo of μ l SMARTer, add 5.25 μ l mixed liquors（Containing 5 × first-strand buffer, 2.0 μ l, 1.0 μ l DTT, 1.0 μ l dNTPs mixture, 0.25 μ l RNase Inhibitor and 1.0 μ l SMARTScribe Reverse Transcriptase）, 42 DEG C of 90 min, 72 DEG C of 10 min, add 100 μ l EDTA dilutions.Using it as template Two-wheeled PCR reactions are carried out, first round PCR is reacted using GSP1 and UPM as primer, and system is as follows：10 × buffer 5 μ l, dNTPs 1.0 2.5 5.0 μ l, Taq enzymes of μ l, UPM of μ l, GSP1 of mixture 0.2 μ l, diluted first chain cDNA, 2.5 μ l, Sterile water is mended to 50 μ l.Response procedures are as follows：94 DEG C of 1 min of pre-degeneration；98 DEG C of denaturation 10 s, 72 DEG C of extension 2 min, totally 7 A circulation；98 DEG C of 10 s of denaturation, 68 DEG C of 2 min of extension, totally 33 circulate；72℃ 10 min.

Second wheel PCR is carried out using 50 times of dilutions of first round PCR reaction product as template by primer of GSP2 and NUP Amplification, reaction system are as follows：10 × buffer, 5 μ l, dNTPs mixture, 1.0 2.5 2.5 μ l of μ l, NUP of μ l, GSP2, 0.2 μ l of Taq enzymes, dilute 1.0 μ l of template solution, and sterile water is mended to 50 μ l, and response procedures are the same as first round PCR.PCR product With 1.0%（Mass volume ratio, it is same as below）Agarose gel electrophoresis detects, PCR amplification result such as Fig. 2.Gel reclaims kit （It is same as below purchased from Tiangeng biochemical technology Beijing Co., Ltd）After purifying recycling, pMD18-T carriers are connected to（It is purchased from TaKaRa companies, it is same as below）, the competent cell of conversion DH5 ɑ bacterial strains（Purchased from Dalian treasured bioengineering Co., Ltd, below It is identical）, the competence after conversion is evenly coated in ampicillin LB solid mediums（50 mg/L）On, culture 16 it is small when after choose Positive bacterial plaque is taken, and in ampicillin LB fluid nutrient mediums（50 mg/L）Middle expansion is numerous, extracts plasmid and is simultaneously surveyed after digestion verification Sequence, obtains peanutAhDGAT3Gene start codon ATG upstream transcriptions region.The sequence obtained after sequencing with genomic walking Row compare, both are completely homologous, it was demonstrated that step, which moves the sequence obtained, isP _AhDGAT3 Sequence.

ObtainP _AhDGAT3 Full length sequence, is named asP _AhDGAT3 , a kind of separated promoter, its series is SEQ ID No.1 Shown nucleotide sequence or the nucleotide sequence with SEQ ID No.1 substantial homologous.

2、P _AhDGAT3 The conversion of the structure and Agrobacterium tumefaciens strain EHA105 of recombinant expression carrier：

The recombinant vector of structure is to clone to obtain by the 35S promoter on plasmid pBI121 (being purchased from TaKaRa companies)P _AhDGAT3 Fragment is replaced and obtained.To complete this purpose, use firstKpnⅠ/ BamHI double digestion cloning vector pMD18-P _AhDGAT3 , Use at the same timeKpnⅠ/ BamHI digestion pBI121 plasmids.

Endonuclease reaction carries out in 37 DEG C of incubators, after about 4-6 hour, with 1%（Mass volume ratio）Agarose gel Electrophoresis detection.By cloning vector pMD18-P _AhDGAT3 Small fragment and pBI121 under digestion（It is above already described）Large fragment under digestion Recycled with DNA gel QIAquick Gel Extraction Kit.

By pMD18-P _AhDGAT3 Large fragment ratio (150 ng small fragments under small fragment and pBI121 digestions under digestion： 50 ng large fragments)=3:1 ratio（Molar concentration rate）Biased sample, adds 5 unit of T4 DNA ligases, and 10 × reaction is slow 2 μ L of fliud flushing, sterile water supplement volume to 20 μ L, 16 DEG C of connections overnight.Freeze-thaw method converts the competent cell of DH5 ɑ bacterial strains, Contain kanamycins（50 μg/mL）Solid LB media tablet on screen, the bacterial plaque of picking normal growth is bacterium colony PCR, chooses Positive bacterium colony upgrading grain is taken, pBI- is named as through the correct recombinant plasmid of digestion verificationP _AhDGAT3 .Referring to Fig. 4.

Using freeze-thaw method by pBI-P _AhDGAT3 It is transferred to Agrobacterium tumefaciems EHA105（It is limited purchased from Dalian treasured biologic Company, it is same as below）, use kanamycins（50 μg/mL）And rifampin（50 μg/mL）Double plate screening, chooses spot, bacterium colony PCR detection verifications, picking positive bacterial plaque, preserves bacterial strain, is named as pBI-P _AhDGAT3 EHA105。

Wherein freeze-thaw method step is as follows：（1）0.2 ml Agrobacterium EHA105 competence is taken, is slowly melted in frozen water；（2） About 2 μ g recombinant plasmid dnas are added, are gently mixed, after 30 min of ice bath, put into 5 min of liquid nitrogen flash freezer, then 37 DEG C of water-baths 5 Min, melts cell；（3）Add 800 μ l and be free of antibiotic YEP fluid nutrient mediums, 28 DEG C of jog culture 4-5 h；（4）12000 Rpm, 30s, remove supernatant, and cell is resuspended in 0.2 ml YEP culture mediums；（5）Culture is uniformly coated on containing rifampin（50 mg/L）, gentamicin（50 mg/L）And kanamycins（50 mg/L）Agar plate on, 28 DEG C cultivate 2 days, treat occur on tablet Bacterium is chosen after transformant and carries out PCR detections.

Embodiment 2：P _AhDGAT3 Plant expression vector pBI-P _AhDGAT3 Genetic transformation and transfer-gen plant sieve in arabidopsis The method in reference literature is selected to carry out transformation of Arabidopsis thaliana（ZhangX.R, et al. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nature, 2006, 1: 1-6）, operating procedure is as follows：After wildtype Arabidopsis thaliana bolting, conversion the previous day is cut off with clean scissors Silique through development, and expand 200 mL of Agrobacterium that breeding needs to convert.Second day, prepared by 5000 revs/min of centrifugations of room temperature Good Agrobacterium, collects bacterium solution, and is suspended again Agrobacterium with 5% sucrose, the Silwet L-77 of addition final concentration 0.02%. Then inflorescence is immersed into Agrobacterium bacterium solution 15 seconds, is wrapped up after taking-up with black plastic bag, moisturizing, polybag is removed after second day, Arabidopsis plant after conversion is reentered into incubator, after a week, second is carried out and converts, after seed maturity, collect, screening Positive seedling.Preparation contains plant expression vector pBI-P _AhDGAT3 Agrobacterium tumefaciems EHA105 bacterium solutions, it is previous in arabidopsis thaliana transformation My god, by pBI-P _AhDGAT3 EHA105 is transferred to the LB fluid nutrient mediums containing 50 μ g/ml of kanamycins, 50 μ g/ml of rifampin In 200 mL, 28 DEG C are incubated overnight.Second day, use ultraviolet specrophotometer（SPEKOL 1300）Detected under 276 nano wave lengths The light absorption value of bacterium solution, takes out when the light absorption value of bacterium solution reaches between 1.6-2.0.Room temperature（It is 20-25 DEG C, same as below）With 4000 G centrifuges 10 min, abandons supernatant, and precipitation is suspended in 5% isometric sucrose solution（Mass volume ratio）.Muddy sucrose is molten Liquid is poured into culture dish, and final concentration of 0.02% is added before converting（Volume ratio）Silwet L-77（Purchased from Beijing Five continents member industry Science and trade center, it is same as below）, mix.The whole inflorescence of arabidopsis to be transformed being immersed in sucrose gently, taken out after 15 seconds Plant inflorescence, the plant after conversion are wrapped with black plastic bag, are placed in growth chamber and cultivate, and are taken off polybag within second day Open, tried again conversion every one week.One month or so harvest seed of culture, seed are 3-5 days dry under incubator or daylight. The T0 of harvest will be converted for seed with 70%（Volume ratio）Alcohol and 0.01%（Mass ratio）Mercuric chloride sterilize 3 minutes and 10 points respectively Clock, is then washed with distilled water for several times（5~7 times）, equably piping and druming, which is arrived, contains kanamycins（50 mg/L）MS solid screening and culturings Base（100 ml of MS a great number of elements mother liquor；10 ml of MS trace elements mother liquor；Organic 10 ml of mother liquor of MS；10 ml of MS molysite；Inositol 10 ml；30 g of sucrose；With 1M sodium hydroxide tune pH to 5.8,8 g agar powders, are settled to 1 L, 121 DEG C of sterilizing standby of high pressure With.Various mother liquor formulas are shown in Table 2）Surface.4 DEG C are placed 3-5 days, are put into plant growth incubator（Photoperiod 16（Daytime）/8（It is black Secretly）Hour, temperature：22 DEG C of daytime, dark 20 DEG C of cycle）Culture.According to specific kalamycin resistance screening on expression vector Positive seedling.When blade grows to 3-4 leaves, a little green seedling leaf is taken, DNA is extracted with SDS methods, carries out PCR positive detections.PCR reflects Periodically, the primer：

AhDGAT3-P-S：5 ˊ-CGGGGTACCATCAATTTGTCTCGATAAATTTTG-3 ＇；

AhDGAT3-P-A：5 ＇-CGCGGATCCCGTTGATGGTGAGAATTAATTAG-3 ＇.

PCR reaction systems are as follows：1 μ L of genomic DNA template (about 50 ng), 10 × Taq enzyme reaction buffer 2 ul、25 mM MgCL₂1.2 ul, 2 mM dNTP, 1.5 ul, each 0.2 ul of 10 uM primers, 0.3 unit Taq enzyme, add sterile Water is to 20 μ l.

Response procedures are：94 DEG C of pre-degeneration 5 min, 94 DEG C of 45 s of denaturation, 55 DEG C of 45 s of annealing, 72 DEG C of 2 min of extension, 32 circulations, 72 DEG C of 5 min of extension.PCR reaction products are detected with 1% agarose gel electrophoresis, the results showed thatP _AhDGAT3 Plant Expression vector pBI-P _AhDGAT3 T-DNA sections be successfully transferred to arabidopsis（Fig. 5）.30 plants of positive seedlings are obtained altogether.

2 MS culture medium mother liquor formulas of table

Embodiment 3：PeanutP _AhDGAT3 The functional analysis and its application of promoter

Clone obtains the present invention firstP _AhDGAT3 Sequence, and functional analysis has been carried out to it.From embodiment 2, intend south The positive seedling T1 generations screened in mustard conversion and PCR detecting steps, selfing harvest seed（That is T2 generations）.Take T2 10 strains of generation Different times tissue carry out GUS dyeing.

PCR is verified：Positive T1 is for transfer-gen plant seed in MS（It is above already described）Sowed on culture medium, 4 DEG C of placement 3-5 Sprouted after it in growth chamber, taken respectively after emergence 1 day, 5 days, 10 days seedling age seedling and root, stem, leaf, flower, silique, Post flowering 2 days, 4 days, 6 days, 8 days, 10 days, 12 days, the rataria of 14 days carry out histochemical stain.

T2 is as follows for dyeing course：Sample is immersed in vacuum suction 5 minutes in GUS dye liquors, 37 DEG C overnight；Wherein GUS The composition of dye liquor is：0.5 mg/mL of X-gluc, 50 mmol/L of phosphate buffer, the potassium ferricyanide and potassium ferrocyanide each 0.5 Mmol/L, EDTA 10 mmol/L, Triton-x-100 0.001%, methanol 20%（Volume ratio）.Second day molten with alcohol-acetic acid Liquid（Volume ratio is 1:1）Decolourize, until blade bleaches, rinsed 3-5 times with 50% alcohol afterwards, Stereo microscope （OLYMPUS SZX16）Take pictures.Seedling stage takes whole plant in different time periods；Reproductive stage, blade take tender leaf and climax leaves Piece；The flower and the titbit for the bud do not opened that flower took away；Silique takes the silique of different times, and takes out seed with dissecting needle. The position that plant is dyed to blueness is exactlyGUSThe position of gene expression.

Coloration result is found（Table 3, Fig. 6）：In the whole growth course of arabidopsis, the embryo of only young tender seed（Hua Hou 2-4 days ratarias）Blueness is dyed to, does not occur blueness in other tissues.It can be seen from the above that promoter drivingGUSGene master To express in the embryo of the tender seed of children, not expressed in other tissues.

Test result indicates that peanutP _AhDGAT3 Promoter has following biological function：

Promoter drivingGUSGene is expressed in the embryo of the young tender seed of arabidopsis, is not expressed in other tissues.P _AhDGAT3 Under regulation and controlGUSGene has certain spatial and temporal expression characteristic, this explanationP _AhDGAT3 With driving downstream reporter geneGUS The function of being expressed in recipient plant.Under the regulation and control of the promoter,GUS Gene can be mainly in the young tender of transfer-gen plant Fine meter reaches in the embryo of seed, and is not expressed completely in other tissues（Table 3, Fig. 6）.

This promoter with tissue specific expression is in plant genetic engineering and Transgene-safty（Edible, security Prevention and control）In there is application value.

PeanutP _AhDGAT3 Application of the promoter in the tender seed embryo of children.

Clone to obtain peanut using genome walking methodAhDGAT35 ' upstream sequences of gene start codon ATG.Structure By the reporter gene of the promoter regulationGUSPlant expression vector pBI-P _AhDGAT3 （It is above already described）.Using agriculture bacillus mediated Florescence infestation method arabidopsis thaliana transformation, T1 generation in the MS added with kanamycins（It is above already described）Preliminary screening transgenosis on culture medium Plant, after arabidopsis grows two panels true leaf, is transplanted on vermiculite and continues to plant, and after inflorescence occurs in plant, carries out PCR inspections Survey, positive strain is identified using Molecular tools.In T2 generations, select 10 transgenic arabidopsis strains to carry out GUS dyeing.GUS histochemistries Method, which dyes, to be shown, promoter drivingGUSGene is expressed in the embryo of the young tender seed of arabidopsis.It can be seen from the above that the startup Son drivingGUSGene has certain spatial and temporal expression specificity, and there is driving downstream gene to be expressed in the embryo of the tender seed of children, Do not expressed completely in other tissues（Fig. 6）Function.

This promoter with tissue specific expression is in plant genetic engineering and Transgene-safty（It is edible）In have Application value, is such as driven with improving seed nutritional or lethal relevant target gene using the promoter, built firstP _AhDGAT3 Drive target gene over-express vector, transformation receptor plant, then target gene existP _AhDGAT3 It is tender in children under the driving of promoter Expressed in the embryo of seed, expression quantity of the target gene in above-mentioned tissue can be improved, do not express, lead completely in other tissues Cause seed according to the scheme of designer have additional nutrients composition or produce seed lethal phenotype, save the energy of plant, improve Efficiency.

Table 3P _AhDGAT3 Transgenic arabidopsis T2 dyes statistical form for the GUS of strain

Note：Y represents blueness, and N represents colourless.

SEQUENCE LISTING

<110>Henan Academy of Agricultural Sciences

<120>Peanut Diacrylglycerol acyl transferase AhDGAT3 promoters and its preparation method and application

<130>Plant gene engineering technology

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 2181

<212> DNA

<213>Artificial sequence

<400> 1

atcaatttgt ctcgataaat tttgaagatt aacaaaattt gtggagtatt aaaatgtcca 60

attcaaaaat tttgactagg gagtacaaag aatatttttg ctttcacata tatcactatt 120

cgtacaaaac gctaataaag agttaaaaac agaaagaaga aacaatgaat acaactaaat 180

taccttacct acttaaaatt ctttggctag ttattattcc tatctttata gagaaaacgt 240

tccactactt ttaactcctc aaaagaatat atttagggcc tttttaaaca ttttttttat 300

taatatgatg atacgaccat acaactaaat aaccatataa aatatcttcg catcaatgca 360

accataatac attaatacta cattgtaaaa taaattcatt aacttaatta accaacgtaa 420

gattggttat tattataaat aatttgttcc ctcaacctca actaaaagtt tctaaatttt 480

tttttcataa aatctttgtt gatggattag acttggtata gtcaaagttt tagtaatatg 540

atctgaagtc tgaacacctg gacaagcata aaaataatta ctaataatcc aaaccgaatg 600

gaatttgaac ataattggag agtgcaaaaa cacggaggcc caaagtgcat agtaacactg 660

tgttccgatg cttagggctt tgctcacagc atatatagcc gagcataaag agactaggaa 720

gtaggacccc ttccaattat aaatctgaaa accctctttg gtgggttggg ttctgaatca 780

aaagcttcat taaccacgtg gtgttggctt agaggaccat acattacatg aaaagctgac 840

actgttggga gaagctagca gctagggtga tgcaggaata tttaatgggt ggttttgact 900

gtaccatgca ttgcattcaa ttcgaatcac agatttttgc taatgcagca cgtctatctg 960

tctttgctta gagacattgg gttaatgatg catgccactg ctgattatta gtgtcatata 1020

tatggtttat attttcgtta tgatggttag ttgcttgaca tatacagttg catttgttcg 1080

ataagtgtta gcttccacac gtggcattag attaatactg caaaattgta aaattagcat 1140

tagtcgtatg cacataagaa gcagactcat actcctttaa catatatcac attacataaa 1200

atatttaata taaactctta tatacatgcg acactctgat tctgaccatt taaaagttct 1260

ctagtctgga acttaggtta aaaaagactt attcataaaa aaattactaa taagaagaga 1320

gagaacactc tagactccgt aatattgtat agtgttacac tataagaaac agtataatta 1380

ttgacgctaa aaatcgacgg ctaagttttc cgtcaatatt tttcgacggt ttgtcgtcga 1440

taaaataaaa aaaaaaagat gattaaaaaa atattaaaat cgacgacaat gacgtctatt 1500

attttgacaa ttttttagca tattatcact atcgtcacat taccgacgaa ataggggtcg 1560

aaattttttt tctttaaaat cgacagacta gttgtctatt ttaataatta aaatatcgac 1620

actttctgtc gtcgatacat ttagacgata gaaatctctt ttctaaattg aatgaacggt 1680

ataaatttat tatataaaat agacgaatag agtgttgatt tttattttaa ataaaatcga 1740

caaaatagcc gttgattttt atcaactaaa aactgctccc gcgtttgctt cccgcatccg 1800

tactcgtttc actcattttc ccaaaattta atcccaaatc ttcagagaat cagagtcttg 1860

agtgatgctt atttttctcc tccaacgccc gagagtagag actagaacag agtcacggtc 1920

acggagagag gcagagagca gagcttcttc ttctccaact cctaaaaaag cccgtcgcca 1980

tagcacatcg ctgtcgcagc ttcttgtaag ttcctctctg tctctctctg attatattta 2040

ttttttcaat ttttgtatct actattttca tcatgaaatt ctgaatttgc tgtttgttaa 2100

acctaattag cataatcaaa taggaaacca cagaagagag aaaaggagaa tttggttcct 2160

aattaattct caccatcaac g 2181

<210> 2

<211> 22

<212> DNA

<213>Artificial sequence

<400> 2

gtaatacgac tcactatagg gc 22

<210> 3

<211> 26

<212> DNA

<213>Artificial sequence

<400> 3

gggcacgtga cattccttag aacggc 26

<210> 4

<211> 19

<212> DNA

<213>Artificial sequence

<400> 4

actatagggc acgcgtggt 19

<210> 5

<211> 28

<212> DNA

<213>Artificial sequence

<400> 5

gcctgaaacc tccatcgttg atggtgag 28

<210> 6

<211> 33

<212> DNA

<213>Artificial sequence

<400> 6

cggggtacca tcaatttgtc tcgataaatt ttg 33

<210> 7

<211> 32

<212> DNA

<213>Artificial sequence

<400> 7

cgcggatccc gttgatggtg agaattaatt ag 32

Claims (7)

1. a kind of promoter for only driving target gene to be expressed in the embryo of the tender seed of children, it is characterized in that：The promoter is flower Raw Diacrylglycerol acyl transferase promoterP _AhDGAT3 , nucleotide sequence is as shown in SEQ ID No.1.

2. the preparation method of the promoter described in claim 1, it is characterized in that：This method comprises the following steps：

（1）PeanutP _AhDGAT3 The primer sequence of promoter is：

AP1：5'–GTAATACGACTCACTATAGGGC–3'；

GSP1：5'–GGGCACGTGACATTCCTTAGAACGGC–3'；

AP2：5'–ACTATAGGGCACGCGTGGT–3'；

GSP2：5'–GCCTGAAACCTCCATCGTTGATGGTGAG–3'；

（2）Peanut promoterP _AhDGAT3 Preparation process：

Illustrated according to genomic walking kit, take the DNA of 5 μ l peanuts, usedDraI digestion, reaction system are as follows：DNA 5 μ L,DraI 1.6 2 μ l of μ l, 10 × buffer, with sterile water polishing to 20 μ l, 37 DEG C overnight, is 1% with mass volume ratio Agarose gel electrophoresis detects digestion effect；

Respectively with the restriction enzyme for producing flat endDraI、EcoRV、PvuII、StuI andSmaI enzymes in 100 μ l systems The genomic DNA of 2.0-3.0 μ g is cut, reaction system is as follows：2.5 μ g of DNA, restriction enzyme 8 μ l, 10 × buffer 10 μ l, sterile water polishing is to 100 μ l, and 37 DEG C overnight；

Purified after the completion of digestion, purification step is as follows：The 3M sodium acetates and 50 μ l bodies of 10 μ l is added into digested liquid The ethanol solution than being 95% is accumulated, 3h is precipitated at -20 DEG C, then 12000 revs/min（rpm）15 min are centrifuged, use volume ratio 70% ethanol washs twice, and 12000 rpm centrifuge 5 min, dry at room temperature, is dissolved with 20 μ l sterile waters；

The specific linkers Genome Walker Adaptor provided in kit are added after the completion of purifying, reaction system is as follows： 10 × T4 ligase buffer, 2.0 μ l, 8.0 μ l, T4 ligase of DNA, 1 μ l, the Genome Walker of digestion processing 14.0 μ l of Adaptor, sterile water are mended to 20 μ l, and 16 DEG C overnight, and connection liquid distilled water is diluted 10 times, is stored in -20 ℃；Thus five kinds are established through restriction enzyme enzymatic treatment and is connected with the DNA library of specific linkers；

Using foundation through five kinds of restriction enzyme enzymatic treatments and be connected with specific linkers DNA library as template, it is anti-to carry out two-wheeled PCR Should, first round PCR is reacted using GSP1 and AP1 as primer, and system is as follows：10 × buffer, 5 μ l, dNTPs mixture 1.0 2.5 2.5 μ l, Taq enzyme of μ l, AP1 of μ l, GSP1 0.2 μ l, diluted 0.1 μ l of DNA library, sterile water are mended to 50 μ l；Instead Answer program as follows：94 DEG C of 1 min of pre-degeneration；98 DEG C of 10 s of denaturation, 72 DEG C of 2 min of extension, totally 7 circulate；98 DEG C of 10 s of denaturation, 68 DEG C of 2 min of extension, totally 33 circulations；72℃ 10 min；

Second wheel PCR reaction, using 50 times of dilutions of first round PCR reaction product as template, using GSP2 and AP2 as primer into Row amplification, reaction system are as follows：10 × buffer, 5 μ l, dNTPs mixture, 1.0 2.5 μ l, AP2 2.5 of μ l, GSP2 0.2 μ l of μ l, Taq enzyme, dilute 1.0 μ l of template solution, and sterile water is mended to 50 μ l, response procedures and completed with first round PCR Recovery purifying second takes turns PCR product afterwards, and is connected with carrier T, is contained through sequencingP _AhDGAT3 The DNA of full length sequence.

3. a kind of expression vector, it is characterised in that contain the separated promoter described in claim 2.

4. one cultivates peanutP _AhDGAT3 The construction method of recombinant expression carrier, it is characterised in that

WithKpnⅠ/ BamHI double digestion is connected withP _AhDGAT3 PMD18-P _AhDGAT3 With pBI121 plasmids, gel recycling digestion is got off Promoter fragment and pBI121 large fragment, connection conversion Escherichia coli, be built into plant expression vector pBI- P _AhDGAT3 。

5. a kind of host strain, it is characterised in that contain the expression vector described in claim 3.

6. host strain according to claim 5, it is characterised in that the host strain is Agrobacterium EHA105.

7. the separated promoter described in claims 1 starts the target gene in downstream answering in vegetable seeds rataria With.