CN104962653A - Kit and detection method for polymorphism detection of methylenetetrahydrofolate reductase gene - Google Patents

Abstract

The invention relates to a kit and a detection method for polymorphism detection of a methylenetetrahydrofolate reductase gene. The kit comprises a nucleic acid extraction reagent and a nucleic acid detection reagent, wherein the nucleic acid detection reagent comprises fluorescent probe-containing PCR reaction liquid, a negative control and a positive control; the nucleic acid extraction reagent is a DNA extract; the PCR reaction liquid comprises DNA polymerase, UNG enzyme, a primer, a probe and Mg<2+>; the probe is a molecular beacon probe; and the gene polymorphic site of MTHFR is a C677T polymorphic site. The detection method using the kit is easy and fast to operate, the use of consumables is reduced so as to reduce the detection cost, the detection result is accurate, and the occurrence of false positive result is reduced; by adding the negative control and positive control in the amplification step, the judgment of false positive and false negative can be effectively improved, and the detection precision is higher; since the hairpin structure of the molecular beacon probe is opened with certain force, the specificity to the mutant C677T polymorphic site at the measuring point is higher.

Description

The test kit of Methylene tetrahydrofolate reductase gene polymorphic detection and detection method

Technical field

The present invention relates to pharmaceutical reagent field, particularly relate to gene diagnosis kit, specifically refer to a kind of test kit and detection method of Methylene tetrahydrofolate reductase gene polymorphic detection.

Background technology

Methylene tetrahydrofolate reductase gene (MTHFR) is one carbon unit metabolic enzyme, is present in animal livers.It is the key enzyme in folic acid methylation procedure, its Main Function is can by 5,10-tetrahydrochysene methopterin is reduced to 5-methyltetrahydrofolate, methyl is provided for homocysteine is converted into methionine(Met), and be DNA, the synthesis participating in purine and pyrimidine with the form of one carbon unit, and provide methyl for DNA, RNA and protein methylation, affect DNA metabolism.

The methyl donor of the multiple bio-matrixes such as protein and the neurotransmission factor.Methionine(Met) is the indispensable amino acid in human body, and methionine(Met) biosynthesis block makes protein synthesis abnormal.Participate in methionine metabolism as methyl donor, thus maintain homocysteine in plasma (Hcy) normal level, Hcy pathways metabolism is as Fig. 1.After MTHFR 677C-T sudden change, its biological activity only has 50% of normal enzyme activity, and it raises relevant with homocysteine in plasma.MTHFR C677T mutational site is the modal thermo-labile missense mutation of mthfr gene found at present, and research shows that this sudden change causes MTHFR enzymic activity to decline making Hcy to methylate obstacle, causes Hcy level to raise.

1, MTHFR and relative disease

1.1 MTHFR and cardiovascular disorder

Hyperhomocysteinemiainjury is the cardiovascular disease risk factor.MTHFR is the key enzyme of Hcy metabolism, and this gene C 677T is mutation type the most common in Hcy pathways metabolism.The sudden change of C → T makes its active and thermotolerance reduce and cause level in Hcy blood to raise, and plasma Hcy level raises vascular endothelial cell injury that can be direct or indirect, and ET-1 is synthesized to be increased, NO and PGI2 secretes minimizing, and destruction blood vessel relaxes, the balance of the contracting factor.Do Hcy also can stimulated vascular smooth muscle cell to breed, reduce the conformability of vessel wall, hyperamization tube wall elasticity reduces.Therefore the rising of Hcy level take part in cardiovascular pathophysiological process.

It is as follows that MTHFR 677C → T sudden change causes the mechanism of cardiovascular diseases: 1. the effect of endothelium toxicity: MTHFR 677C → T sudden change cause Hcy in vivo level be raised to, can endothelial cell damage be caused, destroy vessel wall elastic layer and collegen filament hyperamization tubular elastic declines.Mechanism may be: a.Hcy, in cell, autoxidation occurs, and produces oxyradical, causes the change of cellularstructure destruction and function; B.Hcy reduces the level of glutathion inside cell peroxidase, has slackened the effect that it stops NO Oxidative inactivation, enhances lipid peroxide and hydrogen peroxide to cell injury effect; C. change endothelial cell gene to express, cell death inducing.2. stimulated vascular smooth muscle cell hyperplasia: Hcy promotes vascular smooth muscle cell proliferation, and vascular compliance declines, and promotes arteriosclerotic formation.3. thrombin content and active promotion thrombosis are changed on the impact of coagulation function: Hcy.Hcy promotes that apoB free amino and LDL sulfhydrylation make LDL density increase, and Hcy also participates in inflammatory reaction and immune response, affects cell development and differentiation.

1.2 MTHFR and non-syndromic cleft lip with cleft palate

Non-syndromic cleft lip with cleft palate refers to the harelip without any other developmental malformation, accounts for 70% of all harelips morbidity quantity.Non-syndromic cleft lip with cleft palate is different at the sickness rate of each race, and the highest in Asia yellow and American Indian crowd, white people take second place, and Black people's sickness rate is minimum.In China, non-syndromic cleft lip with cleft palate sickness rate is approximately 1.42/1000.Folic acid is the necessary factor that Maxillary region is grown, and can cause the disappearance of folic acid metabolism process methylene tetrahydrofolate reductase function that folic acid concentration is declined after MTHFR sudden change, thus increases the probability that fetus suffers from non-syndromic cleft lip with cleft palate.

1.3 MTHFR and male sterility

Hcy has cytotoxicity, can make sulfhydryl oxidase, produces a large amount of oxyradical, cause mitochondria of sperms and core DNA damage, finally cause sperm function impaired in cell.Have research to think Hcy can suppress glutathione synthesis simultaneously, destroys the running balance of Active oxygen generation and clearing in seminal fluid, affects sperm function.Separately there are some researches show, high Hcy mass formed by blood stasis can cause the blood vessel in testis too early arteriosclerosis to occur, and affects the blood supply of testis, causes Spermatogenesis disturbance.Folic acid is a kind of antioxidant, when being high Hcy level in body, reducing, resist the oxidative stress of high Hcy generation, can cause sperm DNA impaired, affect reproductive function in body without enough folic acid if take in folic acid.

1.4 MTHFR and recurrent spontaneous, premature labor

Premature labor is common pregnancy complications, accounts for 5% ~ 15% of childbirth sum.About there is the premature infant of 15% dead in neonatal period, account for more than 70% of neonatal death.In the premature infant of survival, 10% ~ 30% leaves intelligent growth obstacle at a specified future date or neural sequela.MTHFR sudden change can make Hcy metabolism be obstructed, and gathers in vivo and causes high homotype semicanal propylhomoserin mass formed by blood stasis.High homotype semicanal propylhomoserin mass formed by blood stasis and multiple miscarriage, preeclampsia, placental abruption, FGR, fetal anomaly, stillborn foetus are relevant, and closely related with premature labor.In the key enzyme affecting Hcy metabolism, MTHFR is subject to research the most and payes attention to.This is because MTHFR exists the activity that transgenation can reduce enzyme, is the important inherited genetic factors causing Hcy concentration to raise.

The mechanism causing recurrent spontaneous to occur has following two aspects: 1. pregnant woman blood is in hypercoagulative state the Gestation period, in placental site blood vessel network, the formation of thrombus can cause the pathological pregnancies such as miscarriage, hypertensive disorder in pregnancy, and thus the mechanism of action of clotting mechanism in recurrent spontaneous receives much concern.MTHFR is common blood coagulation genes involved, and the sudden change in 677 sites makes enzymic activity reduce, and in body, Hcy level raises, thus causes high Hcy mass formed by blood stasis, causes placenta embolism, causes recurrent spontaneous occurs.2.MTHFR plays an important role in folic acid metabolism, methyl donor generation and Nucleotide again building-up process.Folic acid metabolism can the methylated pattern of inducing DNA distort extremely, and then may cause DNA replication dna and the reparation of poor efficiency.Because sudden change makes proper internal lobe, acid heat, the MTHFR activity decrease in placenta tissue, and undermethylation appears in the biotic component DNA causing embryo growth and development necessary, and DNA synthesis and repair process generation obstacle, cause recurrent spontaneous.The danger that recurrent spontaneous occurs MTHFR677CT and TT type pregnant woman is 8.75 times and 9.33 times of CC type pregnant woman respectively.

1.5 MTHFR and hypertension

Research shows in Mild or moderate hypertension crowd, there is negative correlation in Plasma Hcy and folate level, be converted in the approach of methionine(Met) in Plasma Hcy, take 5-methyltetrahydrofolate as methyl donor, and 5-methyltetrahydrofolate is transformed in vivo by folic acid, thus, the folate level in patient body obviously can affect the level of Hcy.Research shows that daily folic acid 10mg is after 1 year, and plasma Hcy level obviously declines.And it is higher than population plasma Hcy level (10 μm of ol/L) through observing Hypertensive Population its average blood plasma Hcy level (15 μm of ol/L).Hyperpietic is the high risk population of cardiovascular pathological changes, plasma Hcy level is apparently higher than normal people simultaneously, and Plasma Hcy concentration raises, blood vessel endothelium can be destroyed, activate thrombocyte, blood coagulation system, the activity of the anticoagulative substances such as arrestin C, causes thrombosis, increases the incidence of myocardial infarction, atherosclerosis, coronary heart disease, cardio cerebrovascular affection.After MTHFR 677C → T suddenlys change, Hcy level can significantly increase, MTHFR with Hcy level in TT genotype crowd higher than CT genotype, CT genotype is higher than CC genotype, TT genotype folate having the greatest impact to plasma Hcy level is described, if TT genotype patient Folic Acid lacks, its plasma Hcy level will be the highest; Equally, if in TT genotype patient treat hypertensive while Supplement of folic acid, the fall of its Plasma Hcy is also by maximum.In hyperpietic, TT genotype person plasma Hcy level is significantly higher than other genotype patient on the one hand, and on the other hand, in TT genotype patient, Supplement of folic acid reduces the amplitude of plasma Hcy level higher than other genotype patient.

Hypertensive disorder in pregnancy: the sudden change in mthfr gene 677 site makes enzymic activity reduce, in body, Hcy level raises, when Hcy level raises, easily be oxidized to homocysteine compound, produce hydrogen peroxide and Superoxide anion free radical simultaneously, cause vascular endothelial cell damage and vascular cell proliferation, because endotheliocyte long-term exposure is in the Hcy of higher level, cause cell to discharge nitric oxide production to reduce, the restraining effect of endotheliocyte mediation weakens, platelet adhesion reaction is assembled, and Hcy crystal can provide on " surface of curing the disease " for the contact activation process of the intravascular coagulation factor.Finally cause vascular conditions to affect placenta uterina blood flow, finally cause hypertensive disorder in pregnancy.

1.6 MTHFR and neural-tube defect

Spina bifida, anencephalus and meninges bulging are a series of Newborn Birth-defects caused due to neurocele patent.Its pathogenesis is relevant to comprehensive actions such as h and E factors.In women's blood of nourishing neural tube defect infant, have the phenomenon that slight homocysteine (Hcy) level rises, and gestation time parent Hcy concentration slightly raises or methionine concentration slightly reduces and will disturb neural tube closure.5,10-CH2-THFA has very important status in the metabolism of halfcystine, and its catalysis 5,10-CH2-THFA is reduced into 5-methylene tetrahydrofolate, and methyl is given to homocysteine by the latter makes it generate methionine(Met).The defect of MTHFR will cause Hcy to the conversion generation obstacle of methionine(Met), forms Homocysteine, thus disturbs neural tube closure and produce neural tube defect.

1.7 MTHFR and heart defect

In newborn infant's congenital malformation, congenital heart defect is modal.Congenital heart defect can independently occur also may occur with other complication in newborn infant simultaneously, and the coronary heart disease in congenital heart defect has been proved to be and has jointly been determined to cause by h and E factor.There are some researches prove that pregnant woman can take oral liquid containing folic acid to reduce the generation of congenital heart defect, about 58% can be reduced.Because folic acid is to the restraining effect of coronary heart disease, therefore the metabolism of folic acid is just closely bound up with coronary heart disease, plays keying action as the key enzyme MTHFR in folic acid metabolism approach in this approach.After MTHFR undergos mutation, its enzymic activity will reduce, and cause folic acid metabolism abnormal, the process that homocysteine methyl turns to methionine(Met) is obstructed, and causes homotype semicanal propylhomoserin concentration to raise, and methionine concentration reduces.Within 1999, just there are some researches prove the relation of congenital heart defect and homocysteine, recent research further confirms that homocysteine and methionine(Met) are the biomarker of congenital heart defect.

The method measuring Hcy is a lot, and using maximum has high performance liquid chromatography (HPLC), enzyme immunoassay (EIA), ion chromatography, fluorescence polarization immunoassay.Using more is clinically high performance liquid chromatography and meteorological combined gas chromatography mass spectrometry.But the shortcomings such as these methods all exist, and experiment length consuming time, cost are higher, poor repeatability, complicated operation, not easily universal and popularization.Existing patent CN 101096705A, CN 101864479A and CN 101037708A etc. all specify part and detect mthfr gene polymorphism to prediction homocysteine level and/or the generation of homocysteine associated diseases and the purposes of prognosis, blood is all adopted to be sample in the citing of embodiment, by polymerase chain reaction (PCR), mthfr gene is increased after carrying out nucleic acid extraction, and then by restriction enzyme, enzyme is carried out to amplified production and cut, by agarose gel electrophoresis, the nucleic acid amplification product fragment length size of being cut by enzyme is judged, and then judge the polymorphism of mthfr gene.

Because the shortage of folic acid and homocysteine are on the impact of a lot of relative disease, the genetic polymorphism detection of MTHFR is made to seem particularly important, and there are some defects in clinical detection method conventional at present and shortage foresight, in order to earlier predict generation and progress that homocysteine level also prevents and intervenes the disease be associated with homocysteine, predict with regard to needing the carrying out to the level of homocysteine is carried out as far as possible early.

Summary of the invention

The object of the invention is the shortcoming overcoming above-mentioned prior art, provide a kind of can the quick and precisely test kit of noninvasive Methylene tetrahydrofolate reductase gene polymorphic detection and detection method.

To achieve these goals, the present invention has following formation:

This Methylene tetrahydrofolate reductase gene polymorphic detection test kit, its principal feature is, described test kit comprises: nucleic acid extraction reagent and nucleic acid detection reagent, described nucleic acid detection reagent comprises containing the PCR reaction solution of fluorescent probe, negative control and positive control, and described nucleic acid extraction reagent is DNA extraction liquid; Wherein said PCR reaction solution comprises archaeal dna polymerase, UNG enzyme, primer, probe and Mg ²⁺, described probe is molecular beacon probe.

Preferably, described DNA extraction liquid, comprises Chelex-100 and EDTA.

More preferably, described negative control is purified water.

Preferably, described positive control comprises 3 groups, and positive control 1 is the plasmid containing wild-type homozygote MTHFR sequence; Positive control 2 is the plasmid containing mutant homozygote MTHFR sequence; And the positive control 1 that mixes for equal proportion of positive control 3 and positive control 2.

More preferably, the wild-type homozygote MTHFR sequence of described positive control 1 is the nucleotide sequence shown in SEQ ID NO:1; The mutant homozygote MTHFR sequence of described positive control 2 is the nucleotide sequence shown in SEQ ID NO:2.

Further preferably, the detection sample of described detection kit is mouth desquamated cells.

Still more preferably, the primer sequence that described pcr amplification uses is respectively the downstream primer nucleotide sequence shown in the upstream primer nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:4.

Most preferably, described probe is:

The sequence of mutant probe is the nucleotide sequence shown in SEQ ID NO:5, and sense channel is FAM, and wherein 5 ' modification group is FAM, and 3 ' modification group is Dcabl;

The sequence of wild-type probe is the nucleotide sequence shown in SEQ ID NO:6, and sense channel is JOE, and wherein 5 ' modification group is JOE, and 3 ' modification group is Dcabl.

According to the detection method of described Methylene tetrahydrofolate reductase gene polymorphic detection test kit, its principal feature is, described detection method comprises:

(1) application of sample prepares: add in PCR reaction solution 45 μ L to be amplified by the sample 5 μ L handled well;

(2) pcr amplification: the sample mixed is carried out pcr amplification, and detects fluorescent signal;

(3) analytical results: when meeting four control group standards at the same time, analyzing samples;

In wherein said fluorescence-detecting step, Baseline is set to 3 ~ 15, fluorescence threshold setting principle is the vertex of threshold line just above negative controls amplification curve, and Ct value is shown as Undet.

Preferably, described sample processing steps comprises:

(1.1) fully vibrated by the centrifuge tube containing 1ml sample, centrifugal 5 minutes of 12000rpm, abandons supernatant.

(1.2) add 1mL physiological saline in precipitation, vibrating dispersion precipitation on vortex vibrator, centrifugal 5 minutes of 12000rpm, abandons supernatant.

(1.3) in precipitation, add the DNA extraction liquid 50 μ L of mixing of vibrating, on vortex vibrator, precipitation is broken up in vibration, 99 DEG C of dry baths or water-bath 10 minutes.

(1.4) centrifugal 5 minutes of 12000rpm, in the sedimentary situation of not touching tube bottom, Aspirate supernatant reacts for PCR.

More preferably, described pcr amplification step comprises:

(2.1) sample is arranged: arrange in window title, type and the working standard parameter of filling in each sample in the respective sample of instrument software.

(2.2) fluorescence channel is selected: each sample choice FAM and JOE 2 passages.Reference fluorescent is set to none.

(2.3) reaction conditions setting: reaction volume is set as 50 μ L, reaction conditions is as follows: UNG enzyme reaction condition: 37 DEG C are heated 5 minutes, denaturation condition is 95 DEG C of heating 5 minutes, Denaturing is 95 DEG C, 15 seconds, and annealing, extension and detection fluorescence condition are 60 DEG C, 1 minute, totally 40 circulations.

Further preferably, four described control group standards are as follows:

Negative control: FAM passage and JOE passage are without obvious amplification curve, and Ct is shown as Undet.

Positive control 1:JOE passage has amplification curve, and Ct<36; FAM passage is without obvious S type amplification curve, and Ct is shown as Undet.

Positive control 2:FAM passage has amplification curve, and Ct<36; JOE passage is without obvious S type amplification curve, and Ct is shown as Undet.

Positive control 3:FAM, JOE passage has typical amplification curve, and Ct<36;

Above-mentioned four conditions must meet simultaneously, otherwise, this invalidate the test.

Still more preferably, generation and prognosis for detecting homocysteine level and/or homocysteine associated diseases detect.

Further preferably, the gene polymorphism sites of described MTHFR is C677T pleomorphism site.

Still more preferably, the gene polymorphism sites of described MTHFR has following characteristics:

(1) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that its homocysteine level is higher and possibility that is homocysteine level rising is larger;

(2) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that its homocysteine level is lower and possibility that is homocysteine level rising is less;

(3) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that the sickness rate of its homocysteine level associated diseases is higher;

(4) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that the sickness rate of its homocysteine level associated diseases is lower.

Have employed the detection kit in this invention and detection method, its advantage is:

1. simple to operate, quick, nucleic acid extraction part of the present invention adopts boiling method, simple to operate, the whizzer only needing common laboratory to use and water-bath or metal bath, in 35 minutes, just can complete the extracting process whole process of sample nucleic acid, and amplification part once can carry out the test (containing 3 positive controls and 1 negative control sample) of maximum 96 samples.

2. reduce the use of consumptive material to reduce testing cost, the 1.5ml centrifuge tube that the consumptive material adopting method of the present invention to need in the whole process of operation only has nucleic acid extraction to use, eight connecting legs increasing use or 96 orifice plates and suction pipette head.

3. detected result is accurate, reduces the appearance of false positive results, adds negative control and positive control in amplification step, effectively can improve with this judgement occurred false positive and false negative.

4. effective minimizing of pair experimental pollution, a. this patent adopts fluorescent probe PCR method, and both adding disposable for the pcr amplification agents useful for same component of nucleic acid in reaction tubes and to adopt fluorescent PCR instrument to carry out amplified reaction, is totally-enclosed reaction detection environment; B. add uracil dna glycosylase (UNG) and substitute the pollution that the PCR pollution control measures such as dNTP effectively can prevent PCR with dUTP; C. adopt molecular beacon probe to improve detection specificity; For detecting the allele specific nucleic acid primer of mthfr gene polymorphism and the oligonucleotide probe for detecting mthfr gene polymorphism, probe is molecular beacon probe, molecular beacon probe is compared with linear TaqMan probe, because opening of its hairpin structure needs certain power, the specificity thus measured is better than linear probe.Therefore, molecular beacon probe is more suitable for for the identification of point mutation, and improve detection perform, the primer related to and probe all can be hybridized with the pleomorphism site of MTHFR specifically.

5. higher detection precision, and PCR method can carry out the amplification of exponential growth formula to goal gene fragment, therefore this patent has higher detection precision.When test precision, same sample is carried out ten times and repeat extracting and increase simultaneously, heterozygote, wild-type homozygote, mutant homozygote precision amplification are respectively as shown in Figure 1, 2, 3.Precision is less than 5% for achievement level with CV value.In figure, Amplification plot is AFLP system, △ Rn by under given one group of PCR condition the value of generation signal; Cycle is circulation.Specifically in table 1:

Table 1: detect precision table

Accompanying drawing explanation

Fig. 1 is the accurate amplification figure of heterozygote of the present invention;

Fig. 2 is the accurate amplification figure of wild-type homozygote of the present invention;

Fig. 3 is the accurate amplification figure of mutant homozygote of the present invention;

Fig. 4 is heterozygote pattern detection result figure of the present invention;

Fig. 5 is wild-type homozygote pattern detection result figure of the present invention;

Fig. 6 is mutant homozygote pattern detection result figure.

Embodiment

In order to more clearly describe technology contents of the present invention, conduct further description below in conjunction with specific embodiment.

The detection kit of Methylene tetrahydrofolate reductase gene polymorphic detection of the present invention is as follows:

1. to comprise reagent as follows for test kit:

2., in order to solve the pollution or error detection result problem that PCR experiment often occurs, the present invention takes following measures:

(1) add uracil dna glycosylase (UNG) and substitute the pollution that the PCR pollution control measures such as dNTP effectively can prevent PCR with dUTP;

(2) adopt molecular beacon probe to improve detection specificity;

(3) in testing process, add negative control and positive control, effectively can reduce the impact that false positive and false negative judge experimental result.

(4) detection sample used in the present invention adopts mouth desquamated cells and non-blood, reaches the level of Non-invasive detection.

In purposes of the present invention, method and test kit, the gene polymorphism sites of MTHFR is C677T pleomorphism site.

In invention, the disease relevant to homocysteine comprises cardiovascular disorder, non-syndromic cleft lip with cleft palate, male sterility, recurrent spontaneous, premature labor, hypertension, neural-tube defect, heart defect.

(1) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that its homocysteine level is higher and possibility that is homocysteine level rising is larger;

(2) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that its homocysteine level is lower and possibility that is homocysteine level rising is less;

(3) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that the sickness rate of its homocysteine level associated diseases is higher;

(4) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that the sickness rate of its homocysteine level associated diseases is lower.

The detection method of Methylene tetrahydrofolate reductase gene polymorphic detection of the present invention is as follows:

1 reagent prepares:

1.1 take out MTHFR PCR reaction solution, thaw at RT from test kit, after melting completely, and mixing of vibrating gently, and do of short duration centrifugal for subsequent use.

1.2 according to sample number (n) to be checked, calculates the stoichiometric number needing preparation.

(1) cumulative volume (50 μ L)=MTHFR PCR reaction solution (45 μ L)+template (5 μ L) is often reacted.

(2) preparation of n sample PCR reaction solution

MTHFR PCR reaction solution (45 μ L) × (n+4) wherein (n+4) ' 4 ' refer to 3 positive controls and 1 negative control.

1.3 each reaction tubes packing 45 μ L PCR reaction solutions.

2. sample process (mouth desquamated cells DNA extraction):

Centrifuge tube containing 1ml sample fully vibrates by 2.1, and centrifugal 5 minutes of 12000rpm, abandons supernatant.

Add 1mL physiological saline (user provides for oneself) in 2.2 precipitations, vibrating dispersion precipitation on vortex vibrator, centrifugal 5 minutes of 12000rpm, abandons supernatant.

The 2.3 DNA extraction liquid 50 μ L adding mixing of vibrating in precipitation, on vortex vibrator, precipitation is broken up in vibration, 99 DEG C of dry baths or water-bath 10 minutes.

Centrifugal 5 minutes of 2.4 12000rpm, supernatant liquor is used for PCR reaction.(during absorption, not touching the throw out of tube bottom).

The DNA extracted in time for detecting, otherwise should answer-20 DEG C of preservations, when reusing, the DNA extracted is melted completely rear 12000rpm centrifugal 5 minutes, gets supernatant liquor and react for PCR.

3. application of sample:

Negative control, sample to be tested DNA, each 5 μ L of positive control are added respectively in the PCR reaction tubes getting out reagent, after covering tightly pipe lid, instantaneous low-speed centrifugal.

4. pcr amplification:

4.1 samples are arranged: arrange in window title, type and the working standard parameter of filling in each sample in the respective sample of instrument software.

4.2 fluorescence channels are selected: each sample choice FAM and JOE 2 passages.Reference fluorescent (Passive Reference) is set to none.

4.3 reaction conditions settings

Reaction volume is set as 50 μ L.

4.4 preserve file, working procedure.

5. interpretation of result

ABI 7500 fluorescent PCR instrument: Baseline is set to 3-15 (according to practical situation, Baseline Cycler can change within the specific limits), fluorescence threshold (Threshold) setting principle is with the vertex of threshold line just above negative controls amplification curve (random noise line), and Ct value is shown as Undet.Use instrument software kit automatic analysis result.

6. quality control standard

6.1 negative controls: FAM passage and JOE passage are without obvious amplification curve, and Ct is shown as Undet.

6.2 positive control 1:JOE passages have amplification curve, and Ct<36; FAM passage is without obvious S type amplification curve, and Ct is shown as Undet.

6.3 positive control 2:FAM passages have amplification curve, and Ct<36; JOE passage is without obvious S type amplification curve, and Ct is shown as Undet.

6.4 positive control 3:FAM, JOE passages have typical amplification curve, and Ct<36.

6.5 above-mentioned four conditions must meet simultaneously, otherwise, this invalidate the test.

7. assay is explained

Under the effective prerequisite of experiment, interpretation of result is as follows:

8.PCR increases the primer sequence used:

Upstream primer	5'-CATCCCTATTGGCAGGTTACC-3'
		Downstream primer	5'-GGACGATGGGGCAAGTGAT-3'

9. probe sequence

10. positive control sequence

Homozygote wild-type positive control sequence:

GAAGGTGCAAGATCAGAGCCCCCAAAGCAGAGGACTCTCTCTGCCCAGTCCCTGTGGTCTCTTCATCCCTCGCCTTGAACAGGTGGAGGCCAGCCTCTCCTGACTGTCATCCCTATTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGCCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGTG

Homozygous mutation body positive control sequence:

GAAGGTGCAAGATCAGAGCCCCCAAAGCAGAGGACTCTCTCTGCCCAGTCCCTGTGGTCTCTTCATCCCTCGCCTTGAACAGGTGGAGGCCAGCCTCTCCTGACTGTCATCCCTATTGGCAGGTTACCCCAAAGGCCACCCCGAAGCAGGGAGCTTTGAGGCTGACCTGAAGCACTTGAAGGAGAAGGTGTCTGCGGGAGTCGATTTCATCATCACGCAGCTTTTCTTTGAGGCTGACACATTCTTCCGCTTTGTGAAGGCATGCACCGACATGGGCATCACTTGCCCCATCGTCCCCGGGATCTTTCCCATCCAGGTG

11. PCR reaction solution formulas:

12. nucleic acid extraction reagent:

The detection of 13. samples:

In the present invention to the detected result of sample as shown in Fig. 4 (heterozygote), Fig. 5 (wild-type homozygote), Fig. 6 (mutant homozygote), interpretation of result is according to embodiment 7.In figure, circle circled portion is FAM Air conduct measurement curve; Square frame circled portion is JOE Air conduct measurement curve.

Have employed the detection kit in this invention and detection method, its advantage is:

1. simple to operate, quick, nucleic acid extraction part of the present invention adopts boiling method, simple to operate, the whizzer only needing common laboratory to use and water-bath or metal bath, in 35 minutes, just can complete the extracting process whole process of sample nucleic acid, and amplification part once can carry out the test (containing 3 positive controls and 1 negative control sample) of maximum 96 samples.

2. reduce the use of consumptive material to reduce testing cost, the 1.5ml centrifuge tube that the consumptive material adopting method of the present invention to need in the whole process of operation only has nucleic acid extraction to use, eight connecting legs increasing use or 96 orifice plates and suction pipette head.

3. detected result is accurate, reduces the appearance of false positive results, adds negative control and positive control in amplification step, effectively can improve with this judgement occurred false positive and false negative.

4. effective minimizing of pair experimental pollution, a. this patent adopts fluorescent probe PCR method, and both adding disposable for the pcr amplification agents useful for same component of nucleic acid in reaction tubes and to adopt fluorescent PCR instrument to carry out amplified reaction, is totally-enclosed reaction detection environment; B. add uracil dna glycosylase (UNG) and substitute the pollution that the PCR pollution control measures such as dNTP effectively can prevent PCR with dUTP; C. adopt molecular beacon probe to improve detection specificity; For detecting the allele specific nucleic acid primer of mthfr gene polymorphism and the oligonucleotide probe for detecting mthfr gene polymorphism, probe is molecular beacon probe, molecular beacon probe is compared with linear TaqMan probe, because opening of its hairpin structure needs certain power, the specificity thus measured is better than linear probe.Therefore, molecular beacon probe is more suitable for for the identification of point mutation, and improve detection perform, the primer related to and probe all can be hybridized with the pleomorphism site of MTHFR specifically.

5. higher detection precision, and PCR method can carry out the amplification of exponential growth formula to goal gene fragment, therefore this patent has higher detection precision.

In this description, the present invention is described with reference to its specific embodiment.But, still can make various amendment and conversion obviously and not deviate from the spirit and scope of the present invention.Therefore, specification sheets and accompanying drawing are regarded in an illustrative, rather than a restrictive.

Claims (15)

1. a Methylene tetrahydrofolate reductase gene polymorphic detection test kit, it is characterized in that, described test kit comprises: nucleic acid extraction reagent and nucleic acid detection reagent, described nucleic acid detection reagent comprises containing the PCR reaction solution of fluorescent probe, negative control and positive control, and described nucleic acid extraction reagent is DNA extraction liquid; Wherein said PCR reaction solution comprises archaeal dna polymerase, UNG enzyme, primer, probe and Mg ²⁺, described probe is molecular beacon probe.

2. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, is characterized in that, described DNA extraction liquid, comprises Chelex-100 and EDTA.

3. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, is characterized in that, described negative control is purified water.

4. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, it is characterized in that, described positive control comprises 3 groups, and positive control 1 is the plasmid containing wild-type homozygote MTHFR sequence; Positive control 2 is the plasmid containing mutant homozygote MTHFR sequence; And the positive control 1 that mixes for equal proportion of positive control 3 and positive control 2.

5. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 4, is characterized in that, the wild-type homozygote MTHFR sequence of described positive control 1 is the nucleotide sequence shown in SEQ ID NO:1; The mutant homozygote MTHFR sequence of described positive control 2 is the nucleotide sequence shown in SEQ ID NO:2.

6. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, is characterized in that, the detection sample of described detection kit is mouth desquamated cells.

7. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, it is characterized in that, the primer sequence that described pcr amplification uses be respectively shown in SEQ ID NO:3 upstream primer nucleotide sequence and the downstream primer nucleotide sequence shown in SEQID NO:4.

8. Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 1, it is characterized in that, described probe is:

The sequence of mutant probe is the nucleotide sequence shown in SEQ ID NO:5, and sense channel is FAM, and wherein 5 ' modification group is FAM, and 3 ' modification group is Dcabl;

The sequence of wild-type probe is the nucleotide sequence shown in SEQ ID NO:6, and sense channel is JOE, and wherein 5 ' modification group is JOE, and 3 ' modification group is Dcabl.

9. the detection method of the Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to any one of claim 1 ~ 8, it is characterized in that, described detection method comprises:

(1) application of sample prepares: add in PCR reaction solution 45 μ L to be amplified by the sample 5 μ L handled well;

(2) pcr amplification: the sample mixed is carried out pcr amplification, and detects fluorescent signal;

(3) analytical results: when meeting four control group standards at the same time, analyzing samples;

In wherein said fluorescence-detecting step, Baseline is set to 3 ~ 15, fluorescence threshold setting principle is the vertex of threshold line just above negative controls amplification curve, and Ct value is shown as Undet.

10. the detection method of Methylene tetrahydrofolate reductase gene polymorphic detection test kit according to claim 9, it is characterized in that, described sample processing steps comprises:

(1.1) fully vibrated by the centrifuge tube containing 1ml sample, centrifugal 5 minutes of 12000rpm, abandons supernatant.

(1.2) add 1mL physiological saline in precipitation, vibrating dispersion precipitation on vortex vibrator, centrifugal 5 minutes of 12000rpm, abandons supernatant.

(1.3) in precipitation, add the DNA extraction liquid 50 μ L of mixing of vibrating, on vortex vibrator, precipitation is broken up in vibration, 99 DEG C of dry baths or water-bath 10 minutes.

(1.4) centrifugal 5 minutes of 12000rpm, in the sedimentary situation of not touching tube bottom, Aspirate supernatant reacts for PCR.

The detection method of 11. Methylene tetrahydrofolate reductase gene polymorphic detection test kits according to claim 9, it is characterized in that, described pcr amplification step comprises:

(2.1) sample is arranged: arrange in window title, type and the working standard parameter of filling in each sample in the respective sample of instrument software.

(2.2) fluorescence channel is selected: each sample choice FAM and JOE 2 passages.Reference fluorescent is set to none.

(2.3) reaction conditions setting: reaction volume is set as 50 μ L, reaction conditions is as follows: UNG enzyme reaction condition: 37 DEG C are heated 5 minutes, denaturation condition is 95 DEG C of heating 5 minutes, Denaturing is 95 DEG C, 15 seconds, and annealing, extension and detection fluorescence condition are 60 DEG C, 1 minute, totally 40 circulations.

The detection method of 12. Methylene tetrahydrofolate reductase gene polymorphic detection test kits according to claim 9, is characterized in that, four described control group standards are as follows:

Negative control: FAM passage and JOE passage are without obvious amplification curve, and Ct is shown as Undet.

Positive control 1:JOE passage has amplification curve, and Ct<36; FAM passage is without obvious S type amplification curve, and Ct is shown as Undet.

Positive control 2:FAM passage has amplification curve, and Ct<36; JOE passage is without obvious S type amplification curve, and Ct is shown as Undet.

Positive control 3:FAM, JOE passage has typical amplification curve, and Ct<36;

Above-mentioned four conditions must meet simultaneously, otherwise, this invalidate the test.

The detection method of 13. Methylene tetrahydrofolate reductase gene polymorphic detection test kits according to claim 9, is characterized in that, detects for the generation and prognosis detecting homocysteine level and/or homocysteine associated diseases.

14. detection methods according to claim 13, is characterized in that, the gene polymorphism sites of described MTHFR is C677T pleomorphism site.

15. detection methods according to claim 14, is characterized in that, the gene polymorphism sites of described MTHFR has following characteristics:

(1) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that its homocysteine level is higher and possibility that is homocysteine level rising is larger;

(2) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that its homocysteine level is lower and possibility that is homocysteine level rising is less;

(3) when mthfr gene polymorphic detection result is 677TT mutant homozygote, predict that the sickness rate of its homocysteine level associated diseases is higher;

(4) when mthfr gene polymorphic detection result is 677CT heterozygosis subtype and/or the 677CC wild-type homozygous period of the day from 11 p.m. to 1 a.m, predict that the sickness rate of its homocysteine level associated diseases is lower.