CN106222251B - method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy - Google Patents
method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy Download PDFInfo
- Publication number
- CN106222251B CN106222251B CN201610584563.9A CN201610584563A CN106222251B CN 106222251 B CN106222251 B CN 106222251B CN 201610584563 A CN201610584563 A CN 201610584563A CN 106222251 B CN106222251 B CN 106222251B
- Authority
- CN
- China
- Prior art keywords
- transcription factor
- recognition
- detecting
- reaction
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification probe, a reagent and a detection method for detecting a transcription factor based on a co-localization identification activated cascade signal amplification strategy. According to the invention, a novel recognition mode of the transcription factor, namely colocalization recognition, is constructed, so that subsequent cascade strand displacement amplification is activated, high-sensitivity detection on NF-kappa B p50 is realized, and the detection sensitivity is 0.2 pM. The detection method of the invention also realizes the detection of NF-kappa B p50 in actual samples. In the detection process, excessive split recognition components cannot be hybridized into a double-strand structure by self, the subsequent cascade signal amplification process cannot be triggered, and the false positive influence caused by incomplete removal of excessive recognition probes is eliminated.
Description
Technical Field
The invention relates to a method for detecting a transcription factor based on a co-localization recognition activated cascade signal amplification strategy.
background
transcription Factors (TFs) are a class of sequence-specific DNA binding proteins that play a key role in gene regulation. They regulate gene information (expression of DNA into RNA) by recognizing a short double-stranded DNA sequence located in the gene regulatory region. Normal regulation of TFs is critical to life processes such as cell development, cell differentiation and repair, and abnormal regulation of TFs leads to a range of diseases such as developmental disorders, abnormal hormonal responses, inflammation and cancer. Nuclear factor κ B (NF- κ B) is a transcription factor that is widely present in various cells, usually in the cytoplasm in the form of a dimer, and when stimulated by external stimuli, it binds to κ B site in the genome to regulate important biological processes such as inflammation and immunity. However, abnormal regulation of NF- κ B will lead to diseases such as cancer and inflammation. The expression level of transcription factors, which can sensitively reflect the cell development process and disease state, has become an important marker for medical diagnosis and drug development. Therefore, the sensitive detection of the expression level of the transcription factor is of great significance for understanding deep gene regulation mechanism, disease diagnosis and drug development.
TFs are expressed at lower levels when the disease is in the early stages, and therefore, highly sensitive detection of TFs by appropriate signal amplification techniques is critical for early diagnosis of the disease. The exonuclease cutting assisted fluorescence amplification detection method has high sensitivity, but one or two kinds of exonuclease are needed to be used for cutting excessive identification probes, and incomplete cutting can cause the identification probes to enter a subsequent signal output process to cause false positive signals. Therefore, it is highly desirable to develop a highly sensitive fluorescence detection method that does not require the participation of exonuclease.
disclosure of Invention
in view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to provide a method for detecting transcription factors based on a co-localized recognition-activated cascade signal amplification strategy. By constructing a new identification mode of colocalization identification, subsequent cascade strand displacement amplification is activated, high-sensitivity detection of a target object is realized, and the method has great application potential in the aspects of clinical diagnosis and disease treatment.
in order to achieve the purpose, the invention adopts the following technical scheme:
In a first aspect of the present invention, there is provided a recognition probe for detecting a transcription factor, comprising: single-stranded DNAs 1, S2 and S3;
the single-stranded DNA S1 includes: a cleavage recognition sequence I, a strand displacement auxiliary sequence and an endonuclease recognition site of TF;
The single-stranded DNA S2 includes: a cleavage recognition sequence II of TF and a sequence complementary to the strand displacement helper sequence;
the single-stranded DNA S3 is one strand of recognition double strands of the target TF (the "recognition double strand" refers to the recognition double-stranded DNA of TF, and includes recognition sequence I in DNA S3, DNA S1 and recognition sequence II in DNA S2, and DNA S3 is complementary to recognition sequence I in DNA S1 and recognition sequence II in DNA S2).
In the single-stranded DNA S1, the sequence of the nicking enzyme recognition site is as follows: 5 '-GCTGAGG-3'.
in the single-stranded DNA S1, the strand displacement auxiliary sequence is: TTTT.
In the single-stranded DNA S1, the sequence complementary to the strand displacement auxiliary sequence is: AAAA.
in one embodiment of the present invention, there is provided a recognition probe for detecting the transcription factor NF- κ B p 50;
The recognition probe includes single-stranded DNAs S1, S2 and S3; wherein the content of the first and second substances,
The nucleotide sequence of the single-stranded DNA S1 is shown in SEQ ID NO. 1; the method comprises the following specific steps:
S1：5’-GGG AGT TGA GT TTTT -3' (SEQ ID No. 1); (GGG AGT TGA GTG CTG A in the sequence is the complementary sequence of the SDA product, i.e., the complementary sequence of the rolling circle amplification primer; the shaded area is the recognition site of endonuclease Nt. BbvCI; the underlined area is the strand displacement auxiliary part; and the bold area is the recognition sequence of the target TF).
The nucleotide sequence of the single-stranded DNA S2 is shown in SEQ ID NO. 2; the method comprises the following specific steps:
S2：5’- AAAA-3' (SEQ ID No. 2); (in the sequence, the bold region is the recognition sequence of the target TF, and the underlined region is the sequence complementary to the chain-substituted helper sequence in S1)
The nucleotide sequence of the single-stranded DNA S3 is shown in SEQ ID NO. 3; the method comprises the following specific steps:
S3：5’--3’(SEQ ID NO.3)。
In a second aspect of the present invention, there is provided a reagent for detecting a transcription factor, comprising:
the recognition probe, the rolling circle amplification primer and the rolling circle template;
The nucleotide sequence of the rolling circle amplification primer is shown as SEQ ID NO.4, and specifically comprises the following steps:
5’-TCAGCACTCAACTCCC-3’(SEQ ID NO.4)；
The rolling ring template comprises: complementary sequences of the rolling circle amplification primer, nicking enzyme recognition sites and G tetraploid complementary sequences.
in a specific embodiment of the invention, the nucleotide sequence of the rolling circle template is shown as SEQ ID No.5, and specifically as follows:
5’-CCCTAACCCTAACCCTAACCCTCCCTAACCCTAACCCT AACCCT-3' (SEQ ID NO. 5). (in the sequence, the shaded part is the recognition site of endonuclease Nt. BbvCI, the bold-faced part is the complementary sequence of rolling circle amplification primer; the normal font part CCCTAACCCTAACCCTAACCCT is the complementary sequence of G tetraploid).
further, the reagent also comprises: KF polymerase, nt. bbvcci endonuclease, T4DNA ligase, and Phi29DNA polymerase.
in a third aspect of the present invention, there is provided a method for detecting a transcription factor, comprising the steps of:
(1) adding single-stranded DNA S1, S2 and S3 into a sample to be detected, and carrying out a co-localization recognition reaction;
(2) Adding dNTPs, KF polymerase and Nt.BbvCI endonuclease into the reaction system in the step (1) in sequence to carry out a strand displacement reaction;
(3) adding a rolling circle template and T4DNA ligase into the reaction system in the step (2), reacting at constant temperature, and then adding dNTPs, Phi29DNA polymerase and Nt.BbvCI endonuclease to perform exponential rolling circle amplification reaction;
(4) adding KCl and ThT into the solution reacted in the step (3), incubating, detecting fluorescence intensity, constructing a linear equation between net fluorescence intensity and transcription factor concentration, and quantitatively detecting the transcription factor content in the sample.
in the step (1), the colocalization recognition reaction is carried out in a Cutsmart buffer system; the Cutsmart buffer system comprises the following components: 20mM Tris-HAC, 50mM KAC, 10mM MgAC2，100ug/mL BSA，pH 7.9。
In the step (1), the conditions of the colocalization recognition reaction are as follows: the reaction is carried out in a 37 ℃ incubator for 3-5h, preferably 4 h.
In the step (2), the conditions of the strand displacement reaction are as follows: reacting at 37 deg.C for 0.5-1.0h, inactivating at 85 deg.C for 0.5h, and finishing reaction.
in the step (3), the conditions of the exponential rolling circle amplification reaction are as follows: reacting at 37 ℃ for 2-4h, then inactivating at 75 ℃ for 0.5h, and finishing the reaction.
In the step (4), the spectrum conditions for detecting the fluorescence intensity are as follows: an excitation wavelength of 425nm (slit width of 5nm), an emission wavelength of 498nm (slit width of 5nm), a voltage of 700V, and a collected fluorescence spectrum range of 450nm to 650 nm.
In one embodiment of the present invention, step (4), a linear equation between the net fluorescence intensity and the concentration of transcription factor (NF-. kappa. B p50) is constructed as follows: delta F2880 +230log10C(C：M,R2＝0.994)。
The linear range of the above linear equation is 3.8 × 10-13M-1.5×10-8M。
the principle of detecting the transcription factor based on the co-localization recognition activated cascade signal amplification strategy is as follows:
The recognition probe of the transcription factor is divided into three parts, a novel recognition mode, namely, colocalization recognition, is constructed, and then subsequent cascade strand displacement amplification is activated, so that high-sensitivity detection of a target object is realized, as shown in figure 1. The three-part cleavage recognition components of the target TF are all short single-stranded DNAs (S1, S2, S3). S1 includes: a cleavage recognition sequence of TF, a strand displacement auxiliary portion and a recognition site of an endonuclease (nt. bbvci) (5 '-GCTGAGG-3'); s2 includes: the cleavage recognition sequence of TF, and the sequence complementary to the chain replacement helper moiety in S1, the sequence complementary to the chain replacement helper moiety in S1 being used to hybridize to S1 and thereby initiate chain extension; s3 is one strand of the recognition double strand of the target TF. At an operating temperature of 37 ℃, S1, S2, S3 cannot self-hybridize to double strands, and therefore cannot trigger Strand Displacement Amplification (SDA), and thus cannot generate primers (black short single-stranded DNA) that prime the second step of Exponential Rolling Circle Amplification (ERCA), and therefore, cascade amplification cannot proceed. When the target TF exists, the affinity induction action of the target enables the three parts of the split recognition components to approach each other, the three parts of the split recognition components are hybridized to form a double-stranded structure, then polymerization, extension and cutting mediated Strand Displacement Amplification (SDA) is carried out under the action of polymerase (Klenowfragment) and endonuclease (Nt.BbvCI), a large amount of single-stranded DNA is generated, the single-stranded DNA serves as a primer, the single-stranded DNA is hybridized with a rolling circle template under the action of T4 ligase (T4DNA ligase), and then polymerization-extension-cutting-connection-polymerization mediated cycle amplification (ERCA) is carried out under the action of Phi29 polymerase (Phi29DNA polymerase) and endonuclease (Nt.BbvCI).
The design of the rolling ring template is particularly important, and the rolling ring template comprises three parts: complementary sequences of the primers, recognition sites of nt. After two-step cascade amplification, a large number of G tetraploids are generated, thioflavin T (ThT) is inserted to obtain a fluorescence signal, and high-sensitivity detection of the target transcription factor is realized by using the change of fluorescence intensity (in a specific embodiment of the invention, the sensitivity for NF-kappa B p50 detection is 0.25 pM). Excessive split recognition components in the detection process cannot be hybridized by self to trigger the subsequent signal amplification process, so that false positive signals caused by incomplete removal of excessive recognition probes are eliminated. In addition, the detection strategy can also be used for detecting the transcription factors in actual samples, and provides a potential research tool for clinical diagnosis and drug development.
The invention has the beneficial effects that:
The detection reagent and the detection method for detecting the transcription factor are designed based on a co-localization recognition activated cascade signal amplification strategy, and can be used for high-sensitivity detection of the transcription factor. The detection reagent and the detection method eliminate false positive signals caused by incomplete removal of excessive identification probes, and simultaneously realize high-sensitivity detection of the nuclear transcription factor, and the sensitivity can reach 0.25 pM. Can be used for detecting the transcription factor in the actual sample and provides a potential research tool for clinical diagnosis and drug development.
Drawings
FIG. 1: schematic diagram of detection of transcription factors based on a co-localization recognition activated cascade signal amplification strategy.
FIG. 2: colocalization identifies activated cascade signal amplification for feasibility studies of highly sensitive detection of transcription factors.
FIG. 3 is a linear relationship between fluorescence intensity and concentration of target NF- к B p 50.
FIG. 4: the co-localization recognition activated cascade signal amplification is used for the specific investigation of the high-sensitivity detection of the transcription factor; in the figure, 1-human thrombin, 2-human immunoglobulin G, 3-BSA, 4-NF-. kappa. B p50, 5-mixed sample, error bar is the standard deviation of three replicates.
FIG. 5: and (5) investigating the inhibitory effect of the rubescensin.
FIG. 6: co-regionalized recognition of activated cascade signal amplification for detection of actual samples; in the figure, a: hela cell nucleus extract, b: mixture of Hela nucleus extract and rubescensin, c: hela cell lysis buffer.
Detailed Description
the present invention will be further described with reference to examples, but the following description is only for the purpose of explaining the present invention and does not limit the contents thereof.
Experimental reagents and instrumentation:
the experimental reagents and instruments used in the examples of the present invention were as follows:
Fluorescence spectrophotometer (F-7000, Hitachi, japan), electric heating constant temperature air-blast drying cabinet (DHG-9070A, shanghai seiki macro laboratory equipment ltd., shanghai), high speed microcentrifuge (Pico 17, usa), electronic balance (ME model, mettler-toledo instruments ltd.), dry thermostat (K30, hangzhou ohsan instruments ltd., hangzhou), ultrasonic cleaner (Branson-200, zhongmei jiegin super ltd., shanghai), vortex oscillator (H-101, shanghai kanghe photoelectric instruments ltd., shanghai), acidimeter (pHS-3C, shanghai instruments electrosciences instruments ltd., shanghai).
Recombinant NF-. kappa. B p50 was supplied by Cayman Chemical (Ann Arbor, MI, USA), tumor necrosis factor (TNF-. alpha.) activated Hela cell nuclear extract was purchased from Active Motif (Carlsbad, CA, USA), human thrombin, human immunoglobulin G, Bovine Serum Albumin (BSA) were purchased from Sigma-Aldrich Co. (St Louis, MO, USA), KF polymerase (Klenow fragment), endonuclease (Nt. BbvCI), T4 ligase (T4DNA ligase), and Phi29 polymerase (Phi29DNA polymerase) were purchased from New England Biolabs (Iswich, MA), deoxyribo triphosphate (dNTPs) were purchased from Shanghai bioengineering GmbH, Rabdosia rubescens Inc. (southern China). The fluorescent dye thioflavin T (ThT) was purchased from Abcam (cambridge, uk). Other reagents were obtained from Shanghai pharmaceutical group chemical reagents, Inc.
Buffer solution cutmark: 20mM Tris-HAC, 50mM KAC, 10mM MgAC2，100ug/mL BSA，pH 7.9。
T4 ligation reaction buffer, T4 ligation buffer: 50mM Tris-HCl, 10mM MgCl2，10mM DTT，1mM ATP，pH 7.5。
Lysis Buffer solution (Lysis Buffer): 20mM Hepes (pH 7.5), 350mM NaCl, 20% glycerol,1mM MgCl2,0.5mM EDTA and 0.1mM EGTA,5mM DTT.
The solutions used in the experiments were all prepared with high purity water (>18.25 M.OMEGA.).
All the nucleic acid chains used in the experiment are synthesized and purified by Shanghai bioengineering Co. The nucleic acid chains used in the examples of the present invention are specifically shown in Table 1.
Table 1:
In the table, GGG AGT TGA GTG CTG A in S1 represents a complementary sequence of a rolling circle amplification primer, a shaded portion represents a recognition site of endonuclease nt. bbvci, an underlined region represents a strand displacement assistance portion, a bold region represents a recognition sequence of target TF, an oblique bold portion represents a complementary sequence of a rolling circle amplification primer, and CCCTAACCCTAACCCTAACCCT in the circular template represents a complementary sequence of a G tetraploid.
example 1: detection of transcription factor (NF- κ B p50) based on a colocalized recognition activated cascade signaling amplification strategy
The specific method comprises the following steps:
(1) colocalization identification
mu.L of Cutsmart, 40nM S1, S2, S3, different concentrations of NF-. kappa. B p50 or the actual sample were contained in a 10. mu.L reaction system, and after gentle shaking, the reaction was carried out in a 37 ℃ incubator for 4 hours.
(2) Strand Displacement Amplification (SDA)
mu.L of the colocalized recognition product, 2. mu.L of Cutsmart, 1.5mM dNTPs, 1U of Klenow fragment, 2U of Nt. BbvCI, was contained in a 20. mu.L reaction system, and after gentle shaking, the reaction was placed in a 37 ℃ incubator for 0.5h, followed by inactivation at 85 ℃ for 0.5 h.
(3) Exponential Rolling Circle Amplification (ERCA)
ERCA includes ligation and amplification reactions. The ligation reaction was carried out in a 30. mu.L reaction system containing 20. mu.L of the SDA product, 3. mu. L T4 ligation buffer, 1. mu.M rolling circle template, 120U T4 ligase, and was placed in a 37 ℃ incubator with gentle shaking for 1 hour, and then, the amplification reaction was carried out in a 40. mu.L reaction system containing 30. mu.L of the ligation reaction product, 2. mu.L of the LCutsmart, 1.5mM dNTPs, 3U Phi29DNA polymerase, 3U Nt. BbvCI, and was placed in a 37 ℃ incubator with gentle shaking for 3 hours, followed by inactivation at 75 ℃ for 0.5 hour.
(4) Measurement of fluorescence spectra
KCl and ThT are added into the reaction system, the total volume of the reaction system is 50 mu L, the mixture is placed in a constant temperature box at 37 ℃ after slight oscillation, and the fluorescence intensity is measured after reaction for 0.5 h. The fluorescence intensity measurement was carried out by an F-7000 fluorescence spectrophotometer (Hitachi, Japan). The parameters are set as follows: an excitation wavelength of 425nm (slit width of 5nm), an emission wavelength of 498nm (slit width of 5nm), a voltage of 700V, and a collected fluorescence spectrum range of 450nm to 650 nm.
A linear equation between net fluorescence intensity and transcription factor concentration was constructed as: delta F2880 +230log10C(C：M,R20.994). For the sample to be detected, the net fluorescence intensity of the sample can be measured and substituted into a linear equation to calculate the concentration of the transcription factor of the sample to be detected.
Example 2: feasibility study of the detection method of the present invention
To verify the feasibility of the detection method of the present invention, the present invention examined the feasibility of the detection method of the present invention by comparing the fluorescence intensities under different conditions, as shown in FIG. 2. It can be seen that both the dye ThT (a) and the dye negative (b, approximately coincident with a) show weak fluorescence, indicating that the three split recognition modules cannot self-hybridize to form a double-stranded structure in the absence of the target NF- κ B p50, triggering subsequent cascade signal amplification; when the target NF-kappa B p50 exists, the fluorescence intensity is increased sharply (c), which shows that the affinity induction of the target makes the split recognition components approach each other, and then the split recognition components are hybridized into a double-chain structure to initiate the subsequent cascade signal amplification process. The detection method avoids the participation of exonuclease, and the excessive splitting recognition component in the reaction can not self-hybridize to trigger the subsequent signal amplification process, thereby eliminating the false positive signal caused by incomplete removal of the excessive recognition probe.
Example 3: sensitivity examination of the detection method of the present invention
by measuring the fluorescence intensity corresponding to different concentrations of the target, the linear range and sensitivity of the method can be determined. As shown in fig. 3. It can be seen that the target concentration is 3.8X 10-13M-1.5×10-8In the M range, Δ F is linear with the logarithm of the target concentration (R)20.994), the LOD of the present detection method was estimated to be 2.5 × 10-13M, superior to the sensitivity reported in most literature.
Example 4: examination of specificity of the detection method of the present invention
Specificity is an important index for evaluating the detection method, and in order to verify the specificity of the detection strategy to the transcription factor, we examined the non-specific binding of the interfering protein, as shown in FIG. 4. When only human thrombin or human immunoglobulin G or BSA is present in the detection system, the fluorescence intensity is much lower than that when the target NF-kappa B p50 is present in the system. However, when mixed samples were present in the system, a comparable fluorescence response to that of NF- κ B p50 alone could be obtained, indicating that the novel detection strategy proposed by the present invention has good specificity.
Example 5: precision and reproducibility examination of the detection method of the present invention
Precision and reproducibility are important parameters for measuring practical application of the analysis method, and the precision in the day are examined. The Relative Standard Deviation (RSD) was calculated by selecting three concentrations (n-3). The results showed that RSD at three different concentrations of 15nM, 0.1nM and 1pM in one experiment was 4.6%, 4.1% and 3.9%, respectively. RSD between three consecutive experiments at the same three concentrations were 4.9%, 4.5% and 4.2%, respectively, indicating that the detection strategy has good precision and reproducibility.
Example 6: investigation of inhibitory Effect
Oridonin (oridonin) is a known small molecule inhibitor of TF and can inhibit the double-stranded DNA binding activity of NF- κ B. To evaluate the potential of this assay strategy for use in screening NF-. kappa.B inhibitors, we selected rubescensin for analysis, as shown in FIG. 5. It can be seen that the fluorescence intensity of the system of the reaction system is significantly reduced in the presence of rubescensin (compared to that in the absence), indicating that the present strategy can be used for screening transcription factor inhibitors.
Example 7: determination of actual samples
NF-. kappa. B p50 was originally present in the cytoplasm and bound to the profilin Iκ B, and was inactive. Upon stimulation (e.g., cytokines, bacteria and viruses), NF-. kappa. B p50 will be activated and released from I.kappa.B into the nucleus. Therefore, to further confirm the practical application value of the detection method provided by the invention, the activity of NF-kappa B p50 in HeLa cell nuclear extracts stimulated by tumor necrosis factor alpha (TNF-alpha) is determined. As shown in fig. 6. It can be seen that the lysis buffer only gave very low fluorescence signals (curve a), whereas the system containing HeLa cell nuclear extract (curve c) showed a clear fluorescence enhancement. To confirm that the fluorescence enhancement was due to NF-. kappa. B p50 and not to the other components, the inhibitor rubescensin was added to the assay system and showed no significant fluorescence enhancement (curve b). The above results fully demonstrate that the highly sensitive detection strategy for TF presented herein can be used for the detection of actual biological samples.
Claims (8)
1. A recognition probe for detecting a transcription factor, comprising: single-stranded DNAs 1, S2 and S3;
The nucleotide sequence of the single-stranded DNA S1 is shown in SEQ ID NO. 1;
the nucleotide sequence of the single-stranded DNA S2 is shown in SEQ ID NO. 2;
The nucleotide sequence of the single-stranded DNA S3 is shown in SEQ ID NO. 3.
2. A reagent for detecting a transcription factor, comprising:
The recognition probe of claim 1 and a rolling circle template having a nucleotide sequence shown in SEQ ID No. 5.
3. The reagent for detecting a transcription factor according to claim 2, further comprising: KF polymerase, nt. bbvcci endonuclease, T4DNA ligase, and Phi29DNA polymerase.
4. A method for detecting transcription factors for non-disease diagnostic and therapeutic purposes using the reagent of claim 3, characterized by the following steps:
(1) Adding single-stranded DNA S1, S2 and S3 into a sample to be detected, and carrying out a co-localization recognition reaction;
(2) Adding dNTPs, KF polymerase and Nt.BbvCI endonuclease into the reaction system in the step (1) in sequence to carry out a strand displacement reaction;
(3) Adding a rolling circle template and T4DNA ligase into the reaction system in the step (2), reacting at constant temperature, and then adding dNTPs, Phi29DNA polymerase and Nt.BbvCI endonuclease to perform exponential rolling circle amplification reaction;
(4) Adding KCl and Thioflavin T (ThT) into the solution reacted in the step (3), incubating, detecting fluorescence intensity, constructing a linear equation between net fluorescence intensity and transcription factor concentration, and quantitatively detecting the transcription factor content in the sample.
5. The method of claim 4, wherein in step (1), the co-localization recognition reaction is performed under the following conditions: and reacting for 3-5h in a thermostat at 37 ℃.
6. the method of claim 4, wherein in step (2), the conditions of the strand displacement reaction are: reacting at 37 deg.C for 0.5-1.0h, inactivating at 85 deg.C for 0.5h, and finishing reaction.
7. Use of the recognition probe for detecting NF- κ B p50 transcription factor according to claim 1 in screening for NF- κ B p50 transcription factor inhibitors.
8. The use of the agent for detecting NF- κ B p50 transcription factor according to claim 2 for screening for NF- κ B p50 transcription factor inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610584563.9A CN106222251B (en) | 2016-07-21 | 2016-07-21 | method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610584563.9A CN106222251B (en) | 2016-07-21 | 2016-07-21 | method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106222251A CN106222251A (en) | 2016-12-14 |
| CN106222251B true CN106222251B (en) | 2019-12-13 |
Family
ID=57532502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610584563.9A Active CN106222251B (en) | 2016-07-21 | 2016-07-21 | method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106222251B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107389646B (en) * | 2017-08-21 | 2019-11-05 | 山东师范大学 | A kind of fluorescence chemical sensor and its detection method detecting transcription factor NF-KB p50 |
| CN109239044B (en) * | 2018-11-12 | 2020-03-27 | 山东农业大学 | Fluorescence sensor based on silver ion stable scissors-shaped triple-helix molecular switch and application thereof |
| CN111206074B (en) * | 2020-01-07 | 2022-10-04 | 南京医科大学 | Transcription factor multi-path detection method combining DNA nanotechnology and liquid chromatography |
| CN111979302A (en) * | 2020-07-17 | 2020-11-24 | 山东师范大学 | Fluorescent biosensor for detecting transcription factor and detection method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789435A (en) * | 2014-01-29 | 2014-05-14 | 西安交通大学 | Cascading isothermal amplification based miRNA fluorescence detection kit and miRNA fluorescence detection method |
| CN105624165A (en) * | 2016-01-05 | 2016-06-01 | 山东大学 | Cascade amplifying-strategy biomolecule detecting method based on self-locking aptamer probe |
-
2016
- 2016-07-21 CN CN201610584563.9A patent/CN106222251B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789435A (en) * | 2014-01-29 | 2014-05-14 | 西安交通大学 | Cascading isothermal amplification based miRNA fluorescence detection kit and miRNA fluorescence detection method |
| CN105624165A (en) * | 2016-01-05 | 2016-06-01 | 山东大学 | Cascade amplifying-strategy biomolecule detecting method based on self-locking aptamer probe |
Non-Patent Citations (5)
| Title |
|---|
| Assembly of Multiple DNA Components through Target Binding toward Homogeneous, Isothermally Amplified, and Specific Detection of Proteins;Anal Chem等;《Anal Chem》;20140715;第86卷(第14期);第7009-7016页 * |
| DNA-Directed Assembly of;Seow N等;《Sci Rep》;20151218(第5期);第1-8页 * |
| Electrogenerated chemiluminescence detection of adenosine based on triplex DNA biosensor;Ye S等;《Biosens Bioelectron》;20110115;第26卷(第5期);第2215-2220页 * |
| 基于发卡结构自组装的适体传感器用于检测药物小分子—腺苷;冯景春;《中国优秀说书学位论文全文数据库医药卫生科技辑》;20141115(第11期);E059-49 * |
| 基于限制性内切酶构建的荧光生物传感器用于转录因子检测;高婷;《中国优秀硕士学位论文全文数据库信息科技Ⅰ辑》;20160215(第02期);B014-906 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106222251A (en) | 2016-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mensà et al. | The telomere world and aging: Analytical challenges and future perspectives | |
| CN1322143C (en) | Testing endosymbiont cellular organelles and compounds identifiable therewith | |
| CN106222251B (en) | method for detecting transcription factor based on co-localization recognition activated cascade signal amplification strategy | |
| ES2705573T3 (en) | Methods and compositions for detecting mutations in the human EZH2 gene | |
| Tang et al. | Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence | |
| Du et al. | Terminal deoxynucleotidyl transferase-activated nicking enzyme amplification reaction for specific and sensitive detection of DNA methyltransferase and polynucleotide kinase | |
| Liu et al. | c9orf72 disease-related foci are each composed of one mutant expanded repeat RNA | |
| CN106191266B (en) | The method for the cascade signal amplification strategy detection transcription factor that masking effect and join protection effect based on collaboration mediate | |
| KR20130099092A (en) | Method for inhibiting nucleic acid amplification using light and highly sensitive method for selective nucleic acid amplification | |
| Jamroskovic et al. | Identification of putative G-quadruplex DNA structures in S. pombe genome by quantitative PCR stop assay | |
| He et al. | Rapid detection of DNA methylation with a novel real-time fluorescence recombinase-aided amplification assay | |
| Song et al. | A novel assay strategy based on isothermal amplification and cascade signal amplified electrochemical DNA sensor for sensitive detection of Helicobacter pylori | |
| JP2024026825A (en) | Brain infarction risk evaluation method | |
| ES2644949T3 (en) | Oligonucleotides to control nucleic acid amplification | |
| CN109251964B (en) | Circulating microRNAs detection kit, method for specifically detecting circulating microRNAs and application | |
| Cao et al. | A light-up fluorescence platform based DNA: RNA hybrid G-quadruplet for detecting single nucleotide variant of ctDNA and miRNA-21 | |
| CN109234367A (en) | A kind of kit for hepatitis B virus YMDD motif area medicament-resistant mutation | |
| Kim et al. | Fluorometric detection of single-nucleotide mutations using tandem gene amplification | |
| Zhou et al. | An ultrasensitive fluorescence sensing strategy for detection and in situ imaging of chronic myeloid leukemia-related BCR-ABL1 mRNA | |
| Kim et al. | Development of hydrogel microparticle based RT-qPCR for advanced detection of BCR-ABL1 transcripts | |
| Garafutdinov et al. | New method for microRNA detection based on multimerization | |
| CN106755525A (en) | A kind of probe and its application and kit for detecting mthfr gene mutation | |
| CN112522375A (en) | Detection kit and detection method for gene mutation of folate metabolism related molecular marker | |
| CN111979295A (en) | Tyrosine phosphatase biosensor and detection method and application thereof | |
| CN114196752B (en) | miR-21 detection kit based on Cas14 and strand displacement amplification and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |