CN104928285A - Vector cloning and expression region gene and protein secretion type mammal cell expression vector - Google Patents
Vector cloning and expression region gene and protein secretion type mammal cell expression vector Download PDFInfo
- Publication number
- CN104928285A CN104928285A CN201410109231.6A CN201410109231A CN104928285A CN 104928285 A CN104928285 A CN 104928285A CN 201410109231 A CN201410109231 A CN 201410109231A CN 104928285 A CN104928285 A CN 104928285A
- Authority
- CN
- China
- Prior art keywords
- vector
- expression
- expression vector
- protein
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the field of gene recombination and protein expression, and concretely relates to a design method and an application of a protein secretion type mammal cell expression vector cloning and expression region gene. The vector cloning and expression region gene designed and synthesized in the invention has a base sequence represented by SEQ ID NO: 1 in a sequence table. A novel expression vector pcDNA3.1-secereting is constructed through cloning and connecting the gene fragment to the Nhe I and Hind III restriction enzyme identification site intervals of the mammal cell expression vector pcDNA3.1. The vector allows the heterologous protein of the encoding gene, connected to a polyclonal site, to be expressed in a mammal host cell in an extracellular secretion manner, and to be secreted in a cell culture solution, so collection and purification are convenient.
Description
Technical field
The present invention relates to gene recombination and field of protein expression, be design and the application thereof of a kind of protein excretion type mammalian cell expression vector clonal expression district gene specifically, be built into a kind of novel protein excretion type mammalian cell expression vector pcDNA3.1-secreting.
Background technology
As everyone knows, the albumen in a large amount of Mammals source is all glycoprotein, and this proteinoid needs posttranslational modification in expression process.Therefore, as prepared this proteinoid in a large number with genetic engineering technique, prokaryotic host cell such as bacterial cell etc. is unaccommodated.For this reason, software engineering researchers invent utilizes the protein expression system of higher eucaryotic cells (as mammalian cell).But, with the albumen of mammalian cell expression, the subject matter that it is produced and recovery technology exists is that these albumen are mainly expressed in tenuigenin, and extracellular space can not be secreted into, therefore the necessary first lysing cell of the follow-up purifying to these albumen, then makes expressed target protein be separated with other intracellular protein through a few step program.One of ways of addressing this issue is that the recombinant protein of expression is secreted in extracellular substratum.Comparatively easily and effectively can carry out purifying like this.In addition, another advantage of recombinant protein that secretion produces can to avoid by protease hydrolysis and the chance that correctly folds of protein is larger.The successful secretion of protein requires that albumen mass-energy effectively passes through endoplasmic reticulum and cytolemma.This just needs to connect one section of additional peptide sequence at the target protein aminoterminal that will express, and this appended sequence can make the target protein molecule merged thereafter enter secretion path.This additional peptide sequences is called as signal peptide sequence.
Carrier pcDNA3.1 carrier is a kind of expression vector can expressing foreign protein in mammalian cell, and its efficient CMV promoter, efficiently can be activated, for the expression of multiple eukaryotic protein in multiple mammalian cell.But pcDNA3.1 carrier lacks useful signal peptide sequence, the protein molecule of expression can not be secreted into extracellular, this Extraction and separation for the follow-up albumen to expressing causes serious inconvenience.The present invention is in the model analysis of large number of biological information science, on the design of multiple combined sequence and the basis of actual biologic activity the selection result, pcDNA3.1 carrier is transformed, design and synthesize a kind of carrier cloning and express district's gene, construct a kind of new expression vector pcDNA3.1-secreting, the form of foreign protein with exocytosis in mammalian host cell that this carrier can make encoding gene be connected to multiple clone site place is expressed, secrete in cell culture fluid, be convenient to collect and purifying.
Summary of the invention
The object of the invention is to design a kind of protein excretion type mammalian cell expression vector clonal expression district's gene and application thereof, obtain a kind of novel mammalian fibrocyte expression vector pcDNA3.1-secreting that can effectively be expressed by heterologous protein secretion in extracellular medium.
For achieving the above object, the technical solution used in the present invention is:
Design and synthesize carrier cloning and express district's gene, it has base sequence in sequence table SEQ ID NO:1;
SEQ ID NO:1
GGCTAGATGAGAGTTCCTCCTCAATTTCTGGGCTTGCTGC 40
TTTTGTGGCTTCCCGGGGTGAGGTGCAAGCTT 72
The enzyme of restriction endonuclease Nhe I and Hind III is utilized to cut interconnection technique, the carrier cloning of synthesis is expressed district's gene (in sequence table SEQ ID NO:1 base sequence) and is integrated into expression vector pcDNA3.1 clonal expression district, be built into new expression vector pcDNA3.1-secreting.The form of foreign protein with exocytosis in mammalian host cell that this carrier can make encoding gene be connected to multiple clone site place is expressed, and secretes in cell culture fluid, is convenient to collect and purifying.
Tool of the present invention has the following advantages:
1. the new expression vector pcDNA3.1-secreting of the present invention's structure, efficient secretion signal peptide sequence is with the addition of in next-door neighbour promotor catchment, the protein molecular that the external source encoding gene being cloned in downstream can be made to express is secreted in extracellular medium, both facilitate follow-up purification, eliminate cytoclastic process; Avoid again express foreign protein in cell by intracellular protein enzymic hydrolysis, therefore can significantly improve protein expression efficiency.
2. the new expression vector pcDNA3.1-secreting of the present invention's structure, with the addition of ATG initiator codon and Kozak sequence in promotor downstream and multiple clone site upstream, Kozak sequence greatly can improve the protein translation efficiency after genetic transcription.Therefore with the carrier constructed by the present invention advance in mammalian cell exogenous protein expression time, add ATG and Kozak sequence without the need to extra in encoding gene again, simplify the process of exogenous genetic fragment subclone to this carrier greatly.
3. the new expression vector pcDNA3.1-secreting of the present invention's structure, remains the restriction endonuclease recognition sequence in the multiple clone site district of the pcDNA3.1 of original vector as much as possible, facilitates connection and the insertion of exogenous genetic fragment.
Accompanying drawing explanation
Fig. 1 is that pcDNA3.1-secreting carrier in original pcDNA3.1 (+) carrier of detecting of enzyme-linked immunosorbent assay (ELISA) and the present invention is at HEK293 cells recombinant human IL-6(rhIL-6) result of protein fragments, white edge part is the rhIL-6 content in cell culture medium, and grey frame part is the rhIL-6 content after cytoclasis in tenuigenin.As seen from the figure, with the rhIL-6 of pcDNA3.1 (+) carrier at HEK293 cells, basic branch is in tenuigenin, and in substratum, content is extremely low; And with the rhIL-6 of the new expression vector pcDNA3.1-secreting built in the present invention at HEK293 cells, can be effectively secreted in cell culture medium, be convenient to follow-up isolation and purification.
Embodiment
Embodiment 1
Carrier cloning expresses the preparation of district's gene, and it has the base sequence shown in sequence table SEQ ID NO:1:
(1) information (see sequence table) of SEQ ID NO.1
(a) sequence signature:
* length: 72 base pairs
* type: nucleic acid
* chain: double-strand
* topological framework: linear
(b) molecule type: oligonucleotide chain
C () is supposed: no
(d) antisense: no
E () is originated at first: design is synthetic also
(2) carrier cloning expresses the preparation of district's gene
1) carrier cloning expresses the design and synthesis of district's gene:
According to the expection object building new expression vector, design and synthesize two oligonucleotide chains: forward chain p-F:
5’-GCTAGATGAGAGTTCCTCCTCAATTTCTGGGCTTGCTGCTTTTGTGGCTTCCCGGGGTGAGGTGCA-3’;
Reverse strand p-R:
5’-AGCTTGCACCTCACCCCGGGAAGCCACAAAAGCAGCAAGCCCAGAAATTGAGGAGGAACTCTCATC-3’
2) annealing of oligonucleotide chain:
10 × anneal damping fluid (SSC) composition: 1.5mol/L NaCl
0.3M trisodium citrate 2H
2o,
PH to 7.0 is adjusted with HCl
Annealing reaction system:
10×SSC buffer 1μl
The each 5pmol of positive and negative oligonucleotide chain
Aseptic ultrapure water polishing volume to 10 μ l
Annealing reaction condition: 94 DEG C of 10min;
0℃ 10min;
72℃ 20min
Embodiment 2
The structure of new expression vector pcDNA3.1-secreting
(1) double digestion of pcDNA3.1 carrier: pcDNA3.1 (+) vector plasmid (Invitrogen) DNA is fully digested through the restriction endonuclease Nhe I of Takara company and Hind III, digestion product, through 0.8% agarose gel electrophoresis analysis, reclaims kits 5400bp large fragment with the glue of Qiagene company;
(2) connection of digestion products and conversion: mix with the molar ratio of 5:1 by the oligonucleotide chain of annealing with through pcDNA3.1 (+) the carrier large fragment that enzyme cuts back to close, and spend the night with T4DNA ligase enzyme 16 DEG C of connections of Takara company, be built into expression vector pcDNA3.1-secreting.(conversion operation presses F. Ao Sibai to connect product conversion E.coli DH5 α competent cell, R. Brunt, R.E. James Kingston, D.D. Moore, J.G. Sai Deman, J.A. Smith, K. Si Telaer " fine works molecular biology experiment guide " USA New York John Wiley & Sons press nineteen ninety-five third edition P39-40), with acillin resistance screening transformant.
(3) checking of expression vector pcDNA3.1-secreting: the positive transformant selected is spread cultivation, (Plasmid DNA Extractions presses J. Pehanorm Brooker to extract plasmid DNA, E.F. Flitch, T. Manny A Disi " Molecular Cloning: A Laboratory guide " USA New York Cold Spring Harbor Publications calendar year 2001 third edition P27-30), and it is correct to carry out DNA sequencing confirmation connection with the two deoxidation chain termination method of Sanger.
Embodiment 3
The practical application of new expression vector pcDNA3.1-secreting and effect assessment
(1) encoding recombinant human IL-6(rhIL-6) gene rhil-6 fragment purchased from the total length ORF cloned plasmids of Sino Biological company, with this plasmid for DNA profiling, according to the coding gene sequence of IL-6, design PCR primer is as follows:
il-6F:5’-TGGATCCAACTCCTTCTCCACAAGC-3’
il-6R:5’-CGAATTCCTACATTTGCCGAAGAGC-3’
Primer upstream and downstream adds BamHI and EcoRI restriction enzyme site respectively.
(2) carry out Standard PCR reaction with the PCR kit of Takara company, concrete PCR reaction conditions is: 94 DEG C 5 minutes; 94 DEG C 30 seconds+55 DEG C 30 seconds+72 DEG C 60 seconds (30 circulations); 72 DEG C 5 minutes.PCR primer, through 1% agarose gel electrophoresis analysis, reclaims kits 640bp fragment with the glue of Qiagene company.
(3) fragment reclaimed fully digests through the restriction endonuclease BamHI of Takara company and EcoRI, and digestion product, through 1% agarose gel electrophoresis analysis, reclaims kits 640bp fragment with the glue of Qiagene company.
(4) plasmid DNA: pcDNA3.1-secreting and pcDNA3.1 (+), all fully digest with the restriction endonuclease BamHI of Takara company and EcoRI, digestion product, through 0.8% agarose gel electrophoresis analysis, reclaims kits 5400bp large fragment with the glue of Qiagene company.
(5) pcDNA3.1-secreting and pcDNA3.1 (+) the plasmid DNA fragment after respectively double digestion in (4) being reclaimed, with the rhil-6 fragment of the 640bp obtained in (3), mix with the molar ratio of 1:5, and spend the night with T4DNA ligase enzyme 16 DEG C of connections of Takara company, be built into expression vector pcDNA3.1-secreting-rhil-6 and pcDNA3.1-rhil-6.(conversion operation presses F. Ao Sibai to connect product conversion E.coli DH5 α competent cell, R. Brunt, R.E. James Kingston, D.D. Moore, J.G. Sai Deman, J.A. Smith, K. Si Telaer " fine works molecular biology experiment guide " USA New York JohnWiley & Sons press nineteen ninety-five third edition P39-40), with acillin resistance screening transformant.
(6) positive transformant selected is spread cultivation, (Plasmid DNA Extractions presses J. Pehanorm Brooker to extract plasmid DNA, E.F. Flitch, T. Manny A Disi " Molecular Cloning: A Laboratory guide " USA New York Cold Spring Harbor Publications calendar year 2001 third edition P27-30), and it is correct to carry out DNA sequencing confirmation connection with the two deoxidation chain termination method of Sanger.
(7) by the rhIL-6 expression vector pcDNA3.1-secreting-rhil-6 that builds and pcDNA3.1-rhil-6 plasmid DNA, with the cell transfection kit lipofectamineLTX & PLUS of Invitrogen company, transfected HEK 293, operate according to test kit specification sheets, within after transfection 12 hours, change substratum, continue at 37 DEG C, the CO of 5%
2cultivate 48 hours under concentration.
(8) respectively collecting cell medium supernatant (component A), and by attached cell with trysinization, PBS cleaning twice, then to wait PBS solution re-suspended cell of culture volume, homogenate is broken, centrifugal 20min collection supernatant (B component) of 12000g.
With enzyme-linked immunosorbent assay (ELISA) detection kit of the people IL-6 of Abcam company, analyze the rhIL-6 expression contents in A and B component.Absorbancy is read and calculation result with microplate reader.By ELISA result known (accompanying drawing 1), with the rhIL-6 of pcDNA3.1 (+) carrier at HEK293 cells, basic branch is in tenuigenin, and in substratum, content is extremely low; And with the rhIL-6 of the new expression vector pcDNA3.1-secreting built in the present invention at HEK293 cells, can be effectively secreted in cell culture medium, be convenient to follow-up isolation and purification.
Claims (2)
1. carrier cloning expresses district's gene, it is characterized in that: have base sequence in sequence table SEQ ID NO:1.
2. a protein excretion type mammalian cell expression vector, it is characterized in that: the Nhe I and the HindIII restriction enzyme enzyme recognition site that base sequence in sequence table SEQ ID NO:1 are cloned into mammalian cell expression vector pcDNA3.1 are interval, are built into protein excretion type mammalian cell expression vector pcDNA3.1-secreting.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410109231.6A CN104928285A (en) | 2014-03-21 | 2014-03-21 | Vector cloning and expression region gene and protein secretion type mammal cell expression vector |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410109231.6A CN104928285A (en) | 2014-03-21 | 2014-03-21 | Vector cloning and expression region gene and protein secretion type mammal cell expression vector |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104928285A true CN104928285A (en) | 2015-09-23 |
Family
ID=54115712
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410109231.6A Pending CN104928285A (en) | 2014-03-21 | 2014-03-21 | Vector cloning and expression region gene and protein secretion type mammal cell expression vector |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104928285A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114195880A (en) * | 2021-12-31 | 2022-03-18 | 南京岚煜生物科技有限公司 | Preparation method and application of recombinant IL-6 protein |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1834246A (en) * | 2005-03-16 | 2006-09-20 | 中国科学院沈阳应用生态研究所 | Expression control of TrxA, encoding zone gene, its prepn. and uses |
WO2007045465A1 (en) * | 2005-10-21 | 2007-04-26 | F. Hoffmann-La Roche Ag | Method for the recombinant expression of a polypeptide |
CN101921315A (en) * | 2010-09-17 | 2010-12-22 | 上海凯茂生物医药有限公司 | Artificially synthesized signal peptide and application thereof |
-
2014
- 2014-03-21 CN CN201410109231.6A patent/CN104928285A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1834246A (en) * | 2005-03-16 | 2006-09-20 | 中国科学院沈阳应用生态研究所 | Expression control of TrxA, encoding zone gene, its prepn. and uses |
WO2007045465A1 (en) * | 2005-10-21 | 2007-04-26 | F. Hoffmann-La Roche Ag | Method for the recombinant expression of a polypeptide |
CN101921315A (en) * | 2010-09-17 | 2010-12-22 | 上海凯茂生物医药有限公司 | Artificially synthesized signal peptide and application thereof |
Non-Patent Citations (2)
Title |
---|
XIAOLIN LI ET AL.: "Construction of a Recombinant Eukaryotic Expression Plasmid Containing Human Calcitonin Gene and Its Expression in NIH3T3 Cells", 《JOURNAL OF BIOMEDICINE AND BIOTECHNOLOGY》 * |
杜寿文 等: "新型双基因表达盒真核载体的构建及功能验证", 《中国生物工程杂志》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114195880A (en) * | 2021-12-31 | 2022-03-18 | 南京岚煜生物科技有限公司 | Preparation method and application of recombinant IL-6 protein |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109796531B (en) | Monoclonal antibody of swine Delta coronavirus N protein, epitope and application thereof | |
HRP20240408T1 (en) | Ultra-long acting insulin-fc fusion proteins and methods of use | |
TW200732472A (en) | Method for the recombinant expression of a polypeptide | |
CN104725515A (en) | Elastin-like protein polypeptide-coxsackie adenovirus receptor fused protein as well as preparation method and application thereof | |
CN102533839B (en) | Amalgamation and expression contains the method for disulfide bond protein matter | |
CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
CN110760541B (en) | Selection method and application of signal peptide when Chinese hamster ovary cells express foreign proteins | |
CN103509812B (en) | The specific transgene carrier of salivary organization and construction process thereof | |
CN105255895A (en) | MAR transcription regulation and control element for improving protein expression level in eucaryotic cell line and expression system for eucaryotic cell line | |
CN104928285A (en) | Vector cloning and expression region gene and protein secretion type mammal cell expression vector | |
CN102659928A (en) | Synthetic signal peptide and application thereof | |
CN1425069B (en) | Method for purifying proteins | |
Wu et al. | Enhancing expression of the pseudorabies virus glycoprotein E in yeast and its application in an indirect sandwich ELISA | |
CN103570817B (en) | Plasmodium vivax PvMSP1 recombinant antigenic protein as well as preparation method and application thereof | |
CN103603057B (en) | Based on can the antibody screening in infecting virus particle type heavy chain of antibody storehouse/light chain storehouse and preparation method | |
CN107033245A (en) | The preparation method and purposes of the polyclonal antibodies of one breeder caspase 1 | |
CN106478773B (en) | Novel artificially synthesized signal peptide | |
CN104974226A (en) | Signal peptide for protein expression | |
CN102071214A (en) | Construction, expression and purification of human cystatin C eucaryon expression vector | |
CN103397038B (en) | Production method of human interleukin-38 | |
CN101921315B (en) | Artificially synthesized signal peptide and application thereof | |
EP3159411B1 (en) | Vector comprising gene fragment for enhancement of recombinant protein expression and use thereof | |
CN103614340A (en) | Cell line for stable expression of chicken interleukin 10 protein, as well as construction method and application thereof | |
CN106478774B (en) | Signal peptide for protein expression | |
CN103450358A (en) | Swine GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) protein antibody and preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150923 |
|
RJ01 | Rejection of invention patent application after publication |