CN104928263B - A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application - Google Patents
A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application Download PDFInfo
- Publication number
- CN104928263B CN104928263B CN201410105875.8A CN201410105875A CN104928263B CN 104928263 B CN104928263 B CN 104928263B CN 201410105875 A CN201410105875 A CN 201410105875A CN 104928263 B CN104928263 B CN 104928263B
- Authority
- CN
- China
- Prior art keywords
- acid
- shell
- olefin
- cell
- streptomyces
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
- A23L27/00—Spices; Flavouring agents or condiments; Artificial sweetening agents; Table salts; Dietetic salt substitutes; Preparation or treatment thereof
- A23L27/30—Artificial sweetening agents
- A23L27/33—Artificial sweetening agents containing sugars or derivatives
- A23L27/36—Terpene glycosides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
- C12Y114/13079—Ent-kaurenoic acid oxidase (1.14.13.79)
Abstract
The present invention relates to a kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application.The present inventor is cloned into a kind of new α '-hydroxylase genes of shell olefin(e) acid 13 from STEVIA REBAUDIANA first, and is successfully applied to the heterologous organisms synthesis of stevioside.The present invention lays the first stone for the heterologous route of synthesis of microorganism of reconstruct steviol glycoside and plant cellular genetic transformation.
Description
Technical field
The present invention relates to molecular biology and bioengineering field, there is provided a kind of shell alkene in new STEVIA REBAUDIANA source
Acid -13 α-hydroxylase (KAH) gene and the application in steviol glycoside biosynthesis.
Background technology
As threat of the angiocardiopathies such as fat and hypertension to human health aggravates, need of the mankind to novel sweetener
Ask more and more urgent.Steviol glycoside is two that one kind is originated from feverfew STEVIA REBAUDIANA (Stevia RebaudianaBertoni)
Terpene glycoside compounds, there is the characteristics of high sugariness, low calorie, its sugariness is 200-300 times of sucrose, and calorific value is only sucrose
1/300.Stevioside is widely used as medicinal herbs in South America and East Asia Region and has had centuries history for sugar, often eats sweet tea
Synanthrin can the illness such as preventing hypertension, diabetes, obesity, heart disease, carious tooth.As the states such as America and Europe are to stevioside security
Gradually accreditation, STEVIA REBAUDIANA is as novel sweetener and functional food additives by with increasing market.
Relevant steviol glycoside biosynthesis pathway research is relatively clear at present.As typical diterpene-kind compound,
Steviol glycoside is mainly by the common precursor of terpene --- 3 isopentenylpyrophosphates (Isopentyl diphosphate, IPP) and 1
Individual dimethyl propylene alkenyl pyrophosphoric acid (Dimethylallyl diphosphate, DMAPP) unit is burnt through Mang ox base Mang ox base
Phosphate synthase (Geranylgeranyl diphosphate synthase, GGPPS), Ke's ent- Buckie pyrophosphate synthetase
(ent-copalyl diphosphate synthase, CDPS), shell alkene synzyme (Kaurene synthase, KS) formation
Diterpene skeleton shell alkene.Subsequent shell alkene through two step cytochrome P 450 enzymes, i.e., shell alkene oxidizing ferment (Kaurene oxidase,
KO) and -13 α of shell olefin(e) acid-hydroxylase (13 α-kaurenoic acid hydroxylase, KAH), respectively in diterpene skeleton
C19 and C13 positions form carboxyl and hydroxyl, form important intermediate steviol.Last steviol is through four step glycosylations, most
End form is into stevioside content rebaudioside-A (Rebaudioside A), as shown in Figure 1.
The gene of all enzymes has been obtained for reporting in stevioside route of synthesis at present, and is transformed for plant cellular genetic
The research for improving stevia rebaudianum candy output and the heterologous synthesis steviol glycoside of microorganism lays the foundation.As catalysis shell olefin(e) acid to stevia rebaudianum
Second cytochrome P 450 enzymes KAH of alcohol, though the sequence for having had multiple STEVIA REBAUDIANA sources is reported, and partial sequence is
Bioconversion research is carried out in steviol glycoside synthesis or yeast cells to improve through being overexpressed in plant, but it is still at present sweet tea
The rate-limiting step of synanthrin biosynthesis, and still do not have can in prokaryotic hosts activity expression KAH report.
The content of the invention
It is an object of the invention to provide a kind of new -13 α of shell olefin(e) acid-hydroxylase, its encoding gene and its application.
In the first aspect of the present invention, there is provided a kind of -13 α of shell olefin(e) acid-hydroxylase of separation, it is selected from the group：
(a) such as SEQ ID NO:The polypeptide of 2 amino acid sequences；
(b) by SEQ ID NO:2 amino acid sequences are by one or more (such as 1-20, preferably 1-10；More preferably
1-5；More preferably 1-3) amino acid residue substitution, missing or addition and formed, and with (a) polypeptide function by
(a) polypeptide derived from；
(c) there is the SEQ ID NO of (a) polypeptide function:2 protein fragments；Or
(d) with (a) polypeptide function and with (a) polypeptide (preferably more than 95% with more than 90%；More preferably 98% with
On；More preferably more than 99%) polypeptide of Amino acid sequence identity.
In a preference, described -13 α of shell olefin(e) acid-hydroxylase derives from STEVIA REBAUDIANA.
In the first aspect of the present invention, there is provided a kind of polynucleotides of separation, its encode as mentioned the α of shell olefin(e) acid-13-
Hydroxylase.
In a preference, there is provided the nucleotide sequence of the polynucleotides such as SEQ ID NO:Shown in 1.
In another preference, the nucleotide sequence such as SEQ ID NO of the polynucleotides:(codon optimization sequence shown in 5
Row).
In the first aspect of the present invention, there is provided a kind of recombinant vector, it contains above any described polynucleotides.
In the first aspect of the present invention, there is provided a kind of host cell, it contains described recombinant vector, or in its genome
It is integrated with described polynucleotides.
In another preference, described host cell is bacterial cell, fungal cell or plant cell；Described fungi
Cell includes yeast cells (Yeast), such as Pichia pastoris (Pichiapastoris), saccharomyces cerevisiae (Saccharomyces
Cerevisiae), Kluyveromyces lactis (Saccharomyces cerecisiae) etc..Described prokaryotic includes：Intestines
Bacillus (Enterobacter), such as Escherichia coli (Escherichia coli), bacillus (Bacillus), such as withered grass
Bacillus (Bacillus subtilis), streptomyces (Streptomyces), streptomyces coelicolor (Streptomyces
Coelicolor), muta lead mycillin (Streptomyces lividans), Avid kyowamycin (Streptomyces
Avermitilis), streptomyces venezuelae (Streptomyces venezuelae) etc., the more born of the same parents Pseudomonas of sugar
(Saccharopolyspora), such as the red mould more born of the same parents bacterium of sugar (Saccharopolyspora erythraea).
In the first aspect of the present invention, there is provided a kind of preparation method of described -13 α of shell olefin(e) acid-hydroxylase, this method
Comprising：(a) the described host cell of culture；(b) described -13 α of shell olefin(e) acid-hydroxylase is isolated from culture.
In the first aspect of the present invention, there is provided the purposes of described -13 α of shell olefin(e) acid-hydroxylase, for by shell olefin(e) acid
It is converted into steviol；It is preferred that shell olefin(e) acid is converted into sweet tea in the case where Cytochrome P450 redox protein be present
Synanthrin alcohol.
It is described that shell olefin(e) acid is converted into steviol in plant cell or non-plant cell in a preference
Carry out；It is preferred that described non-plant cell includes bacterial cell, fungal cell；Described fungal cell includes yeast cells
(Yeast), such as Pichia pastoris (Pichiapastoris), saccharomyces cerevisiae (Saccharomyces cerevisiae), lactic acid gram
Shandong dimension yeast (Saccharomyces cerecisiae) etc..Described prokaryotic includes：Enterobacter
(Enterobacter), such as Escherichia coli (Escherichia coli), bacillus (Bacillus), such as bacillus subtilis
Bacterium (Bacillus subtilis), streptomyces (Streptomyces), streptomyces coelicolor (Streptomyces
Coelicolor), muta lead mycillin (Streptomyces lividans), Avid kyowamycin (Streptomyces
Avermitilis), streptomyces venezuelae (Streptomyces venezuelae) etc., the more born of the same parents Pseudomonas of sugar
(Saccharopolyspora), such as the red mould more born of the same parents bacterium of sugar (Saccharopolyspora erythraea).
In the first aspect of the present invention, there is provided a kind of method for preparing steviol, this method include：Utilize described shellfish
Shell olefin(e) acid is converted into steviol by shellene acid -13 α-hydroxylase.
In a preference, methods described includes：
(1) the described host cell of culture, so as to express described -13 α of shell olefin(e) acid-hydroxylase；
(2) in the case where Cytochrome P450 redox protein (CPR) be present, the shell described in step (1) is utilized
Shell olefin(e) acid is converted into steviol by the α of olefin(e) acid-13-hydroxylase.
In another preference, described Cytochrome P450 redox protein is as the host cell described in step (1)
Expression.
In another preference, also include in the recombinant vector included in the host cell described in step (1)：Cytochromes
The encoding gene of P450 redox proteins.
In another aspect of this invention, there is provided a kind of composition, it contains the described shell olefin(e) acid -13 of safe and effective amount
α-hydroxylase and bromatology or industrial acceptable carrier.
The other side of the present invention is apparent to those skilled in the art due to this disclosure
's.
Brief description of the drawings
Fig. 1, stevioside glycosides compound biosynthesis pathway.
The PCR amplifications of Fig. 2, KAH genetic fragment.Swimming lane 1-4 is to apply primer pair 8-40-3US/8-40-4DS, 8- respectively
40-2DS/8-40-3US, 8-40-1US/8-40-4DS, 8-40-1US/8-40-2D enter the amplified production that performing PCR amplification obtains
Electrophoretogram.
The PCR amplifications of Fig. 3, KAH full length DNA.
Fig. 4, plasmid pSY183 collection of illustrative plates.
Fig. 5, plasmid pET21a-srcpr collection of illustrative plates.
Fig. 6, plasmid pSY198 collection of illustrative plates.
Fig. 7, KAH S2 protein expressions SDS-PAGE are analyzed.M：Protein markers；1：Whole bacterial protein is not induced；2：Not
Induce supernatant protein；3：16 DEG C of induction 5h whole bacterial proteins；4：16 DEG C of induction 5h supernatant proteins；5：16 DEG C of induction 16h whole bacterial proteins；
6：16 DEG C of induction 16h supernatant proteins；7：28 DEG C of induction 5h whole bacterial proteins；8：28 DEG C of induction 5h supernatant proteins；9：28 DEG C of induction 16h
Whole bacterial protein；10：28 DEG C of induction 16h supernatant proteins.
Fig. 8, the synthesis steviol mass spectral analysis of resting cell bioconversion shell olefin(e) acid.A's, control strain DH10B (DE3)
Bioconversion result；B, bacterial strain DH10B (DE3) pSY183 bioconversion result；C, steviol standard items (Steviol
Standard testing result).
Fig. 9, resting cell bioconversion shell olefin(e) acid synthesis steviol mass spectra peak molecular ion peak.A, bacterial strain DH10B
(DE3) molecular ion peak of pSY183 target peak；B, the target peak of steviol standard items (Steviol Standard)
Molecular ion peak.
Figure 10, pichia yeast expression system KAHS2 Activity determinations HPLC detect chromatogram.
Figure 11, pichia yeast expression system KAHS2 activity MS testing results.
Embodiment
The present inventor is cloned into a kind of new shell olefin(e) acid -13 from STEVIA REBAUDIANA first by substantial amounts of research and screening
α-hydroxylase (KAH) gene, and successfully it is applied to the heterologous organisms synthesis of stevioside.
As used herein, described " heterologous " refer to two or more pieces nucleic acid from separate sources or protein sequence it
Between relation, or relation of the albumen (or nucleic acid) between host cell from separate sources.If for example, nucleic acid and host
The combination of cell is not usually naturally occurring, then nucleic acid is heterologous for the host cell.Particular sequence is for it
The cell inserted is " heterologous " for organism.
As used herein, term " polypeptide of the invention ", " albumen of the invention " or " KAH polypeptides (albumen) " is interchangeable makes
With all referring to -13 α of shell olefin(e) acid-hydroxylation enzyme amino acid sequence (SEQ ID NO:2 or its variant form or derivative) egg
White or polypeptide.
As used herein, term " gene (polynucleotides) of the invention " or " KAH genes " refer to the described shell alkene of coding
The polynucleotides of acid -13 α-hydroxylase.
As used herein, " separation " it is (former if crude to refer to that material is separated from its primal environment
Beginning environment is natural surroundings).If the polynucleotide under the native state in active somatic cell and polypeptide are not isolate and purify
, but same polynucleotide or polypeptide such as from native state with being separated in other existing materials, then to isolate and purify
's.
The polypeptide of the present invention can be the product of native purified product, the product of recombination expression or chemical synthesis.
Described KAH fragment, derivative and analog is also included in the present invention.As used herein, term " fragment ",
" derivative " and " analog " refers to the polypeptide for the natural KAH identicals biological function or activity for being kept substantially the present invention.
Polypeptide fragment, the derivative or the like of the present invention can be that (i) has one or more conservative or non-conservative amino acid residues
(preferably conservative amino acid) substituted polypeptide, and such substituted amino acid residue can be may not be by
Genetic code encoding, or (ii) have polypeptide of substituted radical in one or more amino acid residues, or (iii) ripe more
Peptide and another compound (for example extend the compound of polypeptide half-life period, such as polyethylene glycol) the formed polypeptide of fusion, or
(iv) additional amino acid sequence is fused to this peptide sequence and formed polypeptide (such as targeting sequencing or secretion sequence or for pure
Change the sequence or proprotein sequence of this polypeptide, or the fusion protein with the formation of antigen I gG fragments).According to teaching herein, this
A little fragment, derivative and analogs belong to scope known to those skilled in the art.
In the present invention, term " KAH polypeptides " includes the SEQ ID NO with KAH activity:The polypeptide of 2 sequences, also includes
With with KAH polypeptide identical functions, SEQ ID NO:The variant form of 2 sequence coded polypeptides.These variant forms include
(but being not limited to)：One or more (being usually 1-30, preferably 1-20, more preferably 1-10, most preferably 1-5) ammonia
Missing, insertion and/or the substitution of base acid, and in C-terminal and/or N-terminal addition or missing one or several (usually 20
Within, within preferably 10, more preferably within 5) amino acid.For example, in the art, with similar nature or similar
Amino acid when being substituted, will not generally change polypeptide function.Such as in C-terminal and/or N-terminal addition or missing one
Or several amino acid will not generally also change polypeptide function；Again for example, only express the partial domain of the polypeptide can also obtain and
The same catalysis of complete polypeptide.Therefore the term also includes the active fragment and reactive derivative of KAH polypeptides.
Invention also provides the analog of KAH albumen or polypeptide.The difference of these analogs and natural KAH polypeptides can be ammonia
Difference on base acid sequence or difference on the modified forms of sequence is not influenceed, or had both at the same time.These polypeptide bags
Include natural or induction genetic variant.
In the present invention, " KAH albumen conservative variations polypeptide " refers to and SEQ ID NO:2 amino acid sequence is compared, and is had
At most 20, preferably at most 10, more preferably at most 5, most preferably at most 3 amino acid are by property is similar or similar ammonia
Base acid is replaced and forms polypeptide.These conservative variation's polypeptides carry out amino acid substitution preferably based on table 1 and produced.
Table 1
| Initial residue | Representational substitution | Preferable substitution |
| Ala(A) | Val;Leu;Ile | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
The polynucleotides of the present invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or people
The DNA of work synthesis.DNA can be single-stranded or double-strand.DNA can be coding strand or noncoding strand.Encoding mature polypeptide
Coding region sequence can be with SEQ ID NO:Coding region sequence shown in 1 is identical or the variant of degeneracy.Such as this paper institutes
With " variant of degeneracy " refers to that coding has SEQ ID NO in the present invention:2 protein, but with SEQ ID NO:1 institute
The differentiated nucleotide sequence of coding region sequence shown.
Encode SEQ ID NO:The polynucleotides of 2 mature polypeptide include：The coded sequence of encoding mature polypeptide；It is ripe
The coded sequence of polypeptide and various additional coding sequences；The coded sequence (and optional additional coding sequence) of mature polypeptide and
Non-coding sequence.
Term " polynucleotides of coded polypeptide " can be included encoding the polynucleotides of this polypeptide or also include
The polynucleotides of additional code and/or non-coding sequence.
The invention further relates to the variant of above-mentioned polynucleotides, and it is encoded has the more of identical amino acid sequence with the present invention
The fragment of peptide or polypeptide, analogs and derivatives.The variant of this polynucleotides can be the allelic variant that naturally occurs or
The variant that non-natural occurs.These nucleotide variants include substitution variants, Deletion variants and insert variation.Such as this
Known to field, allelic variant is the alternative forms of a polynucleotides, it be probably one or more nucleotides substitution,
Missing or insertion, but not from substantially change its coding polypeptide function.
The KAH nucleotides full length sequence of the present invention or its fragment can generally use PCR TRAPs, recombination method or artificial synthesized
Method obtain., can be according to relevant nucleotide sequence, especially ORFs disclosed in this invention for PCR TRAPs
Sequence designs primer, and with commercially available cDNA storehouses or the cDNA storehouses as prepared by conventional method well known by persons skilled in the art
As template, expand and obtain relevant sequence.
Once obtain relevant sequence, it is possible to obtain relevant sequence in large quantity with recombination method.This is typically will
It is cloned into carrier, then is transferred to cell, then by conventional method from the host cell after propagation isolated relevant sequence.
In addition, relevant sequence can be also synthesized with artificial synthesized method.Preferably used using round pcr DNA amplification/RNA method
In the gene for obtaining the present invention.The DNA/RNA fragments of amplification such as can be separated and purified by gel electrophoresis with conventional method.
Compiled the present invention also relates to the carrier of the polynucleotides comprising the present invention, and with the carrier or KAH albumen of the present invention
Code sequence is through host cell caused by genetic engineering, and the method through recombinant technique generation polypeptide of the present invention.
By the recombinant DNA technology of routine, it can be used to express using the polynucleotide sequence of the present invention or produce weight
The KAH polypeptides of group.In general there are following steps：(1) polynucleotides (or variant) of the encoded K AH polypeptides of the present invention,
With containing the polynucleotides recombinant expression carrier conversion or suitable host cell of transduceing；(2) is in suitable culture medium
The host cell of culture；(3) separated from culture medium or cell, protein purification.
In the present invention, KAH polynucleotide sequences can be plugged into recombinant expression carrier.Term " recombinant expression carrier " refers to this
Bacterial plasmid, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus known to field
Or other carriers.As long as it can be replicated in host and stably, any plasmid and carrier can be used.One weight of expression vector
It is characterized in usually containing replication orgin, promoter, marker gene and translation control element.
Method well-known to those having ordinary skill in the art can be used to build DNA sequences encoding containing KAH and suitable transcription/translation
The expression vector of control signal.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..Institute
The DNA sequence dna stated can be effectively connected in the appropriate promoter in expression vector, to instruct mRNA to synthesize.Expression vector also includes
The ribosome bind site and transcription terminator of translation initiation.In addition, expression vector is preferably comprising one or more selections
Property marker gene.
Comprising above-mentioned appropriate DNA sequence dna and the carrier of appropriate promoter or control sequence, it is suitable to can be used for conversion
When host cell, allow it to marking protein.
Host cell can be prokaryotic, such as bacterial cell；Or low eukaryotic, such as yeast cells；It is or high
Deng eukaryotic, such as mammalian cell.Representative example has：Prokaryotic such as Escherichia coli；Fungal cell's such as yeast；Plant
Cell；Drosophila S2 or Sf9 insect cell；CHO, COS, 293 cells or Bowes melanoma cells zooblast etc..As
The preferred embodiment of the present invention, described host cell is prokaryotic or yeast cells.
Persons skilled in the art are aware that how to select appropriate carrier, promoter, enhancer and host cell.With
Recombinant DNA conversion host cell can be carried out with routine techniques well known to those skilled in the art.
This patent reports a kind of KAH genes in new STEVIA REBAUDIANA source, and it has been carried out into activity in microbial cell
Expression, and the bioconversion for having carried out shell olefin(e) acid to steviol is studied, and is the fully synthetic approach of steviol glycoside in microbial cell
Structure lay the foundation.
The KAH of restructuring can be applied to the bioconversion of steviol, including：Shell olefin(e) acid is converted into steviol.
In the prior art, it is difficult to realize the activity expression KAH in heterologous host (such as prokaryotic hosts or yeast host) so that shell olefin(e) acid
Rate-limiting step is transformed into steviol.And the KAH that the present inventor is cloned into can be realized in microorganism it is heterologous
Expression, it is clear that this has marked improvement meaning.
After the KAH enzymes of the present invention are obtained, according to the prompting of the present invention, those skilled in the art can easily apply the enzyme
To implement bioconversion of the shell olefin(e) acid to steviol.As the preferred embodiment of the present invention, a kind of formation biology is additionally provided
Method for transformation, this method include：Described KAH is converted into host cell；Cytochrome P450 redox protein be present
(CPR) in the case of, shell olefin(e) acid is converted into steviol using KAH.Wherein, CPR can be the CPR of various source of species
(such as STEVIA REBAUDIANA, artemisia annua, dark spherical cavity bacterium, gibberella fujikuroi, arabidopsis thaliana source), as long as it can play KAH chaperone
Function (contributing to electron transmission in course of reaction).
As the preferred embodiment of the present invention, described Cytochrome P450 redox protein is as the place described in step (1)
Chief cell is expressed.It is preferred that include simultaneously in a recombinant vector：The table of the encoding gene of -13 α of shell olefin(e) acid-hydroxylase
Up to box and the expression cassette of the encoding gene of Cytochrome P450 redox protein, host is converted, expression product is used to carry out shellfish
Bioconversion of the shellene acid to steviol.Another way, Cytochrome P450 be present when host's (such as yeast cells) is endogenous
During redox protein, the expression cassette of the encoding gene of -13 α of shell olefin(e) acid-hydroxylase is converted into the host, by cellular endogenous
Existing Cytochrome P450 redox protein, carry out bioconversion of the shell olefin(e) acid to steviol.
The foundation of expression cassette has been at present technology familiar to the person skilled in the art.Therefore, required selection is being known
Enzyme after, those skilled in the art be easy to carry out expression cassette foundation.The gene order of codase can be inserted into difference
Expression cassette (such as expression vector) in, can also be inserted into same expression cassette, as long as enzyme can be by after cell is transferred to
Effectively express.Prepare the promoter needed for expression cassette or terminator can be any applicable promoter or terminator,
It is not limited to those of the invention specific described.The selection of applicable promoter or terminator is that those skilled in the art can be with
Carry out, can be depending on the species of host cell.For example, when being recombinantly expressed applied to yeast, prior art has been taken off
Some Yeast promoters or terminator are shown, so as to be susceptible to select.
For prokaryotic and eukaryotic, which suitable expression vector known in the art is, therefore people are easy to select
Skeleton carrier of the suitable expression vector as clones coding gene is selected, for example, when described cell is bacterial cell, is adopted
Each enzyme is recombinantly expressed with pET series expression vector or pSY serial carriers；When described cell is yeast cells, using pSY systems
Row expression vector.
Present invention also offers a kind of composition, it contain on the KAH polypeptides of the invention and bromatology of effective dose or
Industrial acceptable carrier or excipient.This kind of carrier includes (but being not limited to)：Water, buffer solution, glycerine, ethanol and its
Combination.
The beneficial effects of the invention are as follows：
(1) it is stevioside biosynthesis present invention obtains a kind of new -13 α of shell olefin(e) acid-hydroxylase (KAH) gene
The further parsing of approach lays the first stone.
(2) present invention realizes -13 α of shell olefin(e) acid-hydroxylase (KAH) gene activity expression in prokaryotic hosts, success
Ground realizes Kaurenic acid to the bioconversion of steviol, is that plant metabolism is engineered and stevioside biosynthesis way
The reconstruction in footpath lays the first stone.
Following examples are to cloning a kind of -13 α of shell olefin(e) acid in new STEVIA REBAUDIANA source-hydroxylase (KAH) in the present invention
Gene, and with microorganism Escherichia coli host carried out Kaurenic acid to steviol bioconversion research explained in detail
State.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.Do not noted in the following example
The experimental method of bright actual conditions, generally write according to normal condition such as J. Pehanorm Brookers etc., Molecular Cloning:A Laboratory guide, the
Three editions, Science Press, the condition described in 2002, or according to the condition proposed by manufacturer.
The acquisition of embodiment 1, KAH genes
1st, STEVIA REBAUDIANA mRNA extracting
The stevioside leaf agreement that contracts a film or TV play to an actor or actress 100mg in the maturity period is chosen, is put into mortar, liquid nitrogen grinding is added, after grinding
Powder is transferred in 1.5ml centrifuge tube, adds 700 μ l Extraction buffer (2%CTAB (W/V), 2%PVPK30 (W/V), 100mM
Tris-HCl (pH8.0), 20mM Na2EDTA (pH8.0), 1.4mM NaCl, 2% beta -mercaptoethanol), vortex oscillation mixes.50
DEG C water-bath 20min, centre mixing 2-3 times, makes RNA fully separate out.12000g centrifuges 10min, and supernatant is drawn to new centrifuge tube
In, add isometric phenol：Chloroform：Isoamyl alcohol (25：24：1), after mixing, 12000g centrifugations 10min.Supernatant is drawn to centrifugation
Guan Zhonghou, after repeating extracting supernatant again with isometric chloroform once.The precooling absolute ethyl alcohol of 2 times of volumes is added into supernatant,
Ice bath places 30min, 12000g centrifugations 10min.After abandoning supernatant, add 75% ethanol into precipitation and wash again, spontaneously dry
Afterwards, 60 μ l RNase-Free water dissolving is added, is expanded for reverse transcription PCR.
2nd, the RT-PCR amplifications and sequencing identification of KAH genes
Using the mRNA of STEVIA REBAUDIANA as template, using the PrimeScript of precious bioengineering (Dalian) Co., LtdTMRT-PCR
Kit synthesizes cDNA.With reference to United States Patent (USP) US7927851, synthetic primer 8-40-1US, 8-40-2DS, 8-40-3US and 8-
40-4DS.Then PrimstarDNA polymerases are used, using cDNA as template, respectively with primer pair 8-40-1US/8-40-2DS, 8-
40-1US/8-40-4DS, 8-40-2DS/8-40-3US, 8-40-3US/8-40-4DSPCR expand KAH genetic fragments, amplification production
Thing electrophoresis result such as Fig. 2.Four kinds of PCR primers are sequenced to more than, after sequence assembly, obtain the KAH sequences of total length.Then
According to the KAH sequences of total length, design primer KAH F/KAH R.It is primer and cDNA as mould using KAH-XbaIF/KAH-BamHI R
Plate, the KAH genes of total length, amplified production electrophoresis result such as Fig. 3 are expanded with Primestar archaeal dna polymerases PCR.Glue reclaim KAH
PCR primer, KAH PCR primers and pET21a (+) plasmid (Novagen) after then being reclaimed with XbaI and BamHI difference digestions,
Plasmid pSY183, such as Fig. 4 are built after both are connected.
Meanwhile the present inventor also optimizes KAH codons when for Bacillus coli expression, the KAH genes after optimization
Sequence such as SEQ ID NO:5.
Table 1
Underscore is restriction endonuclease sites, and " ACTAGT " sequence of black runic represents " SpeI " site.Sequence
" aataattttgtttaactttaagaaggagatatacat " represents the sequence between XbaI and NdeI sites in pET21a plasmids
Row.
3rd, the codon optimization and synthesis of STEVIA REBAUDIANA Cytochrome P450 redox protein gene
The Cytochrome P450 redox protein (CPR, ABB88839) of STEVIA REBAUDIANA is chosen, its gene order is carried out close
After numeral optimization, gene order SEQ ID NO are obtained:3, and it is named as srcpr；It encodes SrCPR amino acid sequence SEQ
ID NO:4.By on NdeI the and BamHI restriction enzyme sites of the srcpr gene clonings optimized to pET21a (+), plasmid is obtained
PET21a-srcpr (Fig. 5).Then XbaI and HindIII double digestion plasmid pSY183 are used, with SpeI and HindIII digested plasmids
PET21a-srcpr, the DNA fragmentation and pET21a-srcpr carriers of the gene containing KAH is separately recovered, matter is built after both are connected
Grain pSY198 (Fig. 6).
The expression of embodiment 2, KAH in Escherichia coli
By plasmid pSY183 conversion BL21 (DE3), after spread plate, 37 DEG C of overnight incubations.Picking single bacterium colony and 2ml liquid
LB culture mediums (ampicillin 100mg/L), 220r/min, seed liquor are used as after 37 DEG C of overnight incubations.It will be planted by 1% inoculum concentration
Sub- liquid is inoculated into new 2ml LB culture mediums, 220r/min, after 37 DEG C of cultures are about 0.3-0.5 to OD600, adds final concentration
For 0.1mM IPTG, after 220r/min is placed in 16 DEG C or 28 DEG C of Fiber differentiations 5h or 16h, sample is collected, carries out SDS-PAGE
Analysis.
As a result such as Fig. 7, it can be seen that when inducing 16h for 16 DEG C, KAH expression clearly, and albumen solubility compared with
It is good.In addition, when inducing for 28 DEG C KAH also can normal expression, but it is soluble compared to 16 DEG C of inductions when it is slightly worse.
Embodiment 3, using prokaryotic expression KAH carry out shell olefin(e) acid to steviol bioconversion
By plasmid pSY198 conversion bacterial strain DH10B (DE3), l containing 100mg is coated with-1After amicillin resistance flat board, 37
DEG C overnight incubation.Picking monoclonal is in 2ml l containing 100mg-In 1 ampicillin liquid LB culture mediums, 37 DEG C of overnight incubations.So
It is transferred to afterwards with 1% inoculum concentration in new LB culture mediums, 37 DEG C of culture 2h to OD600About 0.6, IPTG is added to final concentration
0.1mM, 16 DEG C of Fiber differentiation 16h.4 DEG C, thalline is collected by centrifugation in 6000g, with isometric M9 salt/phosphoric acid buffer system (4.2mM
Na2HPO4；2.2mM KH2PO4；0.9mM NaCl；1.9mM NH4Cl) wash twice.Then turned with the biology for adding certain volume
Change buffer system and (M9 salt/phosphoric acid buffer system+50mg l is resuspended-1Yeast extract), control thalline weight in wet base is about after being resuspended
4g l-1.Take the above thalline suspension 4ml, 5 × NADPH regenerating system 1ml (5mM NADP, 25mM6- glucose 1-phosphate1-s and
5Unit/ml glucose-6-phosphate dehydrogenase), the 100g/L μ l of shell olefin(e) acid mother liquor 30 are placed in and shaken in 100ml shaking flask
On bed, 28 DEG C, 150r/min reactions 16h.Isometric ethyl acetate extraction is added into reaction solution, organic phase is drawn and carries out
HPLC-MS is analyzed.
As a result such as Fig. 8-9, it can be seen that steviol is successfully detected in sample, and its molecular ion peak is
317.2, it is consistent with steviol standard items (Steviol Standard).
Embodiment 4, using Yeast expression KAH carry out shell olefin(e) acid to steviol bioconversion
1st, the structure of yeast expression system pSY220 recombinant plasmids
Using pSY220F and pSY220R as primer, using pSY183 as template PCR amplifications KAHS2 genes.PCR primer is returned through glue
After receipts, with BglII/NotI digestions, digestion products are then reclaimed again, are connected to what is handled with BamHI/NotI
On pPIC3.5k carriers (being purchased from Invitorgen), plasmid pSY220 (pPIC3.5k-KAHS2) is obtained.
pSY220F(SEQ ID NO:14)：GGAAGATCTATGAAATTCAAAAAGTTTTCTTGTACCCAC (underscores
For BamHI restriction enzyme sites)；
pSY220R(SEQ ID NO:15)：ATAAGAATGCGGCCGCTTAGAGTTTGTGTAAAATCAAGTGAGCACC
(underscore is NotI restriction enzyme sites).
2nd, restructured Pichia pastoris in expression method
The Cytochrome P450 redox protein that Pichia pastoris itself contains can just provide for external source P450 oxidizing ferment
The effect of electron transmission, therefore do not need extra expressing heterologous CPR genes just to make KAHS2 in Pichia pastoris in the present embodiment
Middle carry out activity expression.
By plasmid pSY220 SalI digestions, the DNA fragmentation of linearisation is reclaimed, then by its electroporated Pichia yeast
Strain KM71 (being purchased from Invitrogen), it is coated with MD flat board (the basic nitrogen sources of 13.4g/L yeast (YNB)；0.4mg/L biotins；20g/
L glucose), after 28 DEG C are cultivated 3 days, verified through PCR and obtain recombinant bacterial strain.Recombinant bacterial strain is inoculated into 2ml YPD culture mediums,
28 DEG C, 250r/min, after cultivating 24h, using it as seed, by 1% inoculum concentration, be inoculated into containing 50ml BMGY (2% peptone, 1%
Yeast extract, 100mM kaliumphosphate buffers (pH6.0), 1.34%YNB, 4 × 10-5% biotins, 0.5% glycerine) culture medium
In 500ml shaking flasks, totally two bottles, continue to cultivate 24h.Bacterium solution is collected with 50ml centrifuge tubes, totally 2 pipe, 2000r/min, centrifuges 5min,
Abandon most culture medium supernatant.Respectively with 5mlBMMY (2% peptone, 1% yeast extract, 100mM kaliumphosphate buffers (pH6.0),
1.34%YNB, 4 × 10-5% biotins, 0.5% methanol) culture medium suspension sedimentation cell, after thalline suspension is merged, common 10ml, turn
Move on in 100ml shaking flasks, 250r/min, 22 DEG C, 50 μ l methanol, Fiber differentiation 72h are added per 24h.
3rd, Activity determination
4 DEG C, thalline is collected by centrifugation in 2000g, with isometric M9 salt/phosphoric acid buffer system (4.2mMNa2HPO4；2.2mM
KH2PO4；0.9mM NaCl；1.9mM NH4Cl) wash twice.Then with the bioconversion buffer system weight for adding certain volume
Outstanding, control thalline weight in wet base is about 4g/L after being resuspended.Take thalline suspension 4ml, the 5 × NADPH regenerating system 1ml (5mM of the above
The glucose-6-phosphate dehydrogenase of NADP, 25mM6- glucose 1-phosphate1- and 5Unit/ml), the 100g/L μ l of shell olefin(e) acid mother liquor 30
In 100ml shaking flask, it is placed on shaking table, 28 DEG C, 150r/min reactions 16h.Isometric ethyl acetate is added into reaction solution
Extraction, draw organic phase and carry out HPLC-MS analyses.
Pichia yeast expression system KAHS2 Activity determinations HPLC detection chromatograms such as Figure 10；MS testing results such as Figure 11.By
Figure is as can be seen that successfully detect steviol, and its molecular ion peak is 317.2 in sample.
All it is incorporated as referring in this application in all documents that the present invention refers to, it is independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can
To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (16)
1. a kind of -13 α of shell olefin(e) acid-hydroxylase for being isolated from STEVIA REBAUDIANA, it is characterised in that it is selected from the group：
(a) such as SEQ ID NO:The polypeptide of 2 amino acid sequences；
(b) with (a) polypeptide function and with (a) polypeptide with more than 99% Amino acid sequence identity, and with (a) it is more
The polypeptide as derived from (a) of peptide function.
2. a kind of polynucleotides of separation, it is characterised in that it encodes-13 α of shell olefin(e) acid as claimed in claim 1-hydroxylation
Enzyme.
3. polynucleotides as claimed in claim 2, it is characterised in that the nucleotide sequence of the polynucleotides such as SEQ ID NO:
Shown in 1.
4. a kind of recombinant vector, it is characterised in that it contains any described polynucleotides of claim 2-3.
5. a kind of host cell, it is characterised in that it contains integrates in the recombinant vector described in claim 4, or its genome
Have the right any described polynucleotides of requirement 2-3.
6. the preparation method of -13 α of shell olefin(e) acid-hydroxylase described in a kind of claim 1, it is characterised in that this method includes：
(a) host cell described in claim 5 is cultivated；
(b) -13 α of shell olefin(e) acid-hydroxylase described in claim 1 is isolated from culture.
7. the purposes of -13 α of shell olefin(e) acid-hydroxylase described in claim 1, for shell olefin(e) acid to be converted into steviol.
8. purposes as claimed in claim 7, it is characterised in that described that shell olefin(e) acid is converted into steviol is thin in plant
Carried out in born of the same parents or non-plant cell；Described non-plant cell includes prokaryotic, fungal cell.
9. purposes as claimed in claim 8, it is characterised in that described fungal cell includes yeast cells (Yeast)；It is described
Prokaryotic include：Enterobacter (Enterobacter) cell, bacillus (Bacillus) cell, streptomyces
(Streptomyces) cell, more born of the same parents Pseudomonas (Saccharopolyspora) cells of sugar.
10. purposes as claimed in claim 9, it is characterised in that described yeast cells includes：Pichia pastoris
(Pichiapastoris), saccharomyces cerevisiae (Saccharomyces cerevisiae), Kluyveromyces lactis
(Saccharomyces cerecisiae)。
11. purposes as claimed in claim 9, it is characterised in that described Enterobacter includes Escherichia coli
(Escherichia coli)；Described bacillus includes bacillus subtilis (Bacillus subtilis)；Described
Streptomyces includes streptomyces coelicolor (Streptomyces coelicolor), muta lead mycillin (Streptomyces
Lividans), Avid kyowamycin (Streptomyces avermitilis), streptomyces venezuelae (Streptomyces
venezuelae)；Described sugared more born of the same parents Pseudomonas include the red mould more born of the same parents bacterium of sugar (Saccharopolyspora erythraea).
A kind of 12. method for preparing steviol, it is characterised in that this method includes：Utilize the shell alkene described in claim 1
Shell olefin(e) acid is converted into steviol by acid -13 α-hydroxylase.
13. method as claimed in claim 12, it is characterised in that methods described includes：
(1) host cell described in claim 5 is cultivated, so as to express -13 α of shell olefin(e) acid-hydroxylation described in claim 1
Enzyme；
(2) in the case where Cytochrome P450 redox protein be present, using the α of shell olefin(e) acid -13 described in step (1) -
Shell olefin(e) acid is converted into steviol by hydroxylase.
14. method as claimed in claim 13, it is characterised in that described Cytochrome P450 redox protein is by step
(1) host cell expression described in.
15. method as claimed in claim 14, it is characterised in that the restructuring included in the host cell described in step (1) carries
Also include in body：The encoding gene of Cytochrome P450 redox protein.
16. a kind of composition, it is characterised in that it contains -13 α of shell olefin(e) acid-hydroxyl described in the claim 1 of safe and effective amount
Change enzyme and bromatology or industrial acceptable carrier.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410105875.8A CN104928263B (en) | 2014-03-20 | 2014-03-20 | A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application |
| PCT/CN2015/074344 WO2015139599A1 (en) | 2014-03-20 | 2015-03-17 | New 13a-kaurenoic acid hydroxylase, encoding gene and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410105875.8A CN104928263B (en) | 2014-03-20 | 2014-03-20 | A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928263A CN104928263A (en) | 2015-09-23 |
| CN104928263B true CN104928263B (en) | 2018-03-23 |
Family
ID=54115690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410105875.8A Active CN104928263B (en) | 2014-03-20 | 2014-03-20 | A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104928263B (en) |
| WO (1) | WO2015139599A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4043558A3 (en) * | 2015-10-05 | 2022-11-16 | DSM IP Assets B.V. | Kaurenoic acid hydroxylases |
| US10760085B2 (en) | 2015-10-05 | 2020-09-01 | Dsm Ip Assets B.V. | Kaurenoic acid hydroxylases |
| MX2021013124A (en) * | 2019-05-03 | 2022-01-24 | Amyris Inc | Kaurenoic acid 13-hydroxylase (kah) variants and uses thereof. |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011019875A2 (en) * | 2009-08-12 | 2011-02-17 | Melaleuca, Inc. | Antioxidant dietary supplement compositions |
| CN102220398A (en) * | 2010-04-16 | 2011-10-19 | Cj第一制糖株式会社 | Method for manufacturing rebaudioside A in high yield by recycling by-products produced from manufacturing process for rebaudioside A |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7927851B2 (en) * | 2006-03-21 | 2011-04-19 | Vineland Research And Innovation Centre | Compositions having ent-kaurenoic acid 13-hydroxylase activity and methods for producing same |
| US9284570B2 (en) * | 2010-11-30 | 2016-03-15 | Massachusetts Institute Of Technology | Microbial production of natural sweeteners, diterpenoid steviol glycosides |
| WO2013110673A1 (en) * | 2012-01-23 | 2013-08-01 | Dsm Ip Assets B.V. | Diterpene production |
-
2014
- 2014-03-20 CN CN201410105875.8A patent/CN104928263B/en active Active
-
2015
- 2015-03-17 WO PCT/CN2015/074344 patent/WO2015139599A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011019875A2 (en) * | 2009-08-12 | 2011-02-17 | Melaleuca, Inc. | Antioxidant dietary supplement compositions |
| CN102220398A (en) * | 2010-04-16 | 2011-10-19 | Cj第一制糖株式会社 | Method for manufacturing rebaudioside A in high yield by recycling by-products produced from manufacturing process for rebaudioside A |
Non-Patent Citations (2)
| Title |
|---|
| High-level semi-synthetic production of the potent antimalarial artemisinin;C. J. Paddon等;《Nature》;20131010;第496卷(第7446期);528-532 * |
| 复杂天然产物合成人工生物系统的设计与构建;汪建峰等;《生物工程学报》;20150825;第29卷(第8期);1146-1160 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015139599A1 (en) | 2015-09-24 |
| CN104928263A (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103710318B (en) | Method for producing stevioside compounds by using microorganisms | |
| CN105177100A (en) | A group of glycosyl transferase, and applications thereof | |
| KR102540615B1 (en) | Biosynthetic preparation of steviol glycosides and methods therefor | |
| JP2022137053A (en) | Group of udp-glycosyltransferases for catalyzing carbohydrate chain elongation and application thereof | |
| WO2015007748A1 (en) | Diterpene production | |
| CN105087739B (en) | A kind of new catalyst system and its application for preparing rare ginsenoside | |
| CN104928263B (en) | A kind of new the α hydroxylases of shell olefin(e) acid 13, its encoding gene and its application | |
| CN104894077A (en) | NADPH-cytochrome P450 reducing ferment and application thereof | |
| CN105985938A (en) | Glycosyl transferase mutant protein and applications thereof | |
| CN107922465B (en) | Steviol glycoside transport | |
| CN108138152B (en) | Kaurenoic acid hydroxylase | |
| KR102418138B1 (en) | Glycosyltransferases, mutants and applications thereof | |
| CN113265433B (en) | Bifunctional glycosyltransferase and application thereof | |
| Okada et al. | Enzymatic reactions by five chalcone synthase homologs from hop (Humulus lupulus L.) | |
| KR101533352B1 (en) | Recombinant microorganism with kaurene production ability and method for preparing kaurene using the same | |
| CN110892068B (en) | UDP-glycosyltransferase | |
| CN112553175B (en) | Preparation and application of glycosyltransferase UGT76G1 mutant | |
| CN114277024B (en) | Novel triterpene synthase and application thereof | |
| CN110343681B (en) | Glycosyl transferase mutant protein for synthesizing furanone and derivative glucoside thereof | |
| CN106318920A (en) | Flavones-6-hydroxylase and application thereof to scutellarin synthesis | |
| CN105316271A (en) | Method for constructing bacterium strain with high output of rhamnolipid | |
| Jun et al. | UGPase of Astragalus membranaceus: cDNA cloning, analyzing and expressing in Escherichia coli | |
| CN110072995A (en) | Kaurenic acid hydroxylase | |
| CN110106222B (en) | Application of glycosyltransferase in synthesizing glycyrrhizic acid | |
| CN113444703B (en) | Glycosyltransferase mutant for catalyzing sugar chain extension and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200610 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |