CN104911156B - A kind of clone of gene of rice protein repair enzyme coding and its application - Google Patents

Abstract

The present invention relates to molecular biology of plants and gene engineering technology fields, and in particular to a kind of albumen repair enzyme (rice Os PIMT1) Gene Isolation clone, functional verification and the application related with seed vitality in rice keeping quality.Full-length cDNA is cloned, and then obtain OsPIMT1 full-length genome sequences using Smarter RACE technologies.Mutant testing result illustrates that lack OsPIMT1 has certain influence for the keeping quality of seed.The overexpression and interference expression vector of OsPIMT1 genes are then constructed, passes through agrobacterium mediation converted japonica rice Nipponbare.Transgenic progeny seed ageing results show that OsPIMT1 genes can improve rice keeping quality and seed vitality.

Description

A kind of clone of gene of rice protein repair enzyme coding and its application

Technical field

The present invention relates to molecular biology of plants and gene engineering technology fields, and in particular to it is a kind of in rice keeping quality and Seed vitality related albumen repair enzyme (rice Os PIMT1) Gene Isolation clone, functional verification and application.

Background of invention

Rice due to Deterioration and goes mouldy to wait and causes tens jin of loss every year in storage, accounts for about gross reserves 3%, this not only influences national food security, also food-safe to cause very big influence.Meanwhile caused by storage Germination percentage declines, and directly or indirectly economic loss is even more immeasurable caused by working rice breeding.Selection and breeding are to shelf-stable Rice improved seeds be very important for improving national food security and foodsafety.Therefore, the modern times point are utilized Sub- biological means excavate new gene, and the keeping quality and seed vitality for improving rice have great realistic meaning

Protein is the material base of life, it is the direct participant and executor of the various vital movements of cell.Biology Body growth and development each stage maintains albumen into the cell all along with variations such as the synthesis of multiple proteins, modification, decomposition The stabilization of matter structure and function, is necessary to ensureing cell or even body normal growth and development and organism is to antibiont And abiotic stress, the key factor survived in changeable external environment.Protein can all occur certainly in vivo The covalent bond reaction of hair, the covalent variation of these amino acid can cause the conformation of peptide chain to change, and this process is being coerced Under the conditions of can aggravate to react.These accumulation covalently damaged are that major reason, the organism altogether of organism aging process is caused usually to be led to Hydrolysis isomerism protein is crossed to recombine to reduce their influences to cell and tissue again.Nevertheless, some are related to aging Albumen covalently damage can be repaired by other approach.In general, covalently damage is always easier to be happened at polarity Amino acid, such as aspartic acid (Aspartic acid, Asp), asparagine, the covalent damage of some amino acid can pass through spy Different approach is inversely repaired.Albumen repairs different aspartic acid transmethylase (Protein Repair L- Isoaspartyl Methyltransferase, PIMT) it just can directly repair isomery aspartic acid (iso- on peptide chain Aspartic acid, isoAsp) and asparagine so that peptide chain can revert to normal space conformation, reactivate its life Object activity.PIMT is widely present in organism, from bacterium, plant to higher mammal, including the mankind.In bacterium and nematode In, PIMT can help ageing tissues Antagonistic Environment to coerce, and such as in high temperature stress, improve survival rate and extend the service life.

In rice, there is no any for plant PIMT for the report about PIMT gene-correlations, the particularly country Documents and materials, therefore, for PIMT as an important plant stress-resistance albumen, its function and application in rice is to be worth pass Note.In terms of the research of plant field is primarily upon PIMT for seed longeivity and keeping quality, these research may be due to The reparation pattern of PIMT determines, since it repairs albumen it is only necessary to seldom energy and cost with regard to allosteric protein activity can be made extensive It is multiple, therefore it is limited in matter and energy, the metabolism more slow stage may play the effect of bigger.Using seed as , after seed maturity, water content reduces, and the content of various composition and form tend towards stability in seed, new old after in suspend mode Metabolism and cellular activity are very low, however internal vital movement does not stop, and various Storage proteins play important work( It can maintain the normal operation of seed and fight the variation of external environment.Extension and extraneous ring with seed storage time Border such as the variation of temperature, humidity, will necessarily cause the isomery of storage protein in seed, and then lead to protein inactivation.Seed is main Nutrition is provided by endosperm or cotyledon and maintains body, as the nutrition stored in vivo constantly consumes, generates secondary metabolism therewith Object and peroxide will necessarily cause to damage to seed, and then seed is made to go bad inactivation.Therefore, PIMT is for hatching egg each in seed The white stability of structure and the integrality of cell function, which should have, to have certain effect.

Invention content

The primary and foremost purpose of the present invention is to provide a kind of encoding gene of rice Os PIMT1 albumen.

Another object of the present invention is to provide above-mentioned rice Os PIMT1 albumen.

Encoding gene it is still another object of the present invention to provide above-mentioned rice Os PIMT1 albumen is in prepare transgenosis plant In application.

Description of the drawings

The acquisition of Fig. 1 Nipponbare PIMT1 full length genes CDS.A. Nipponbare RNA electrophoresis.3 ' the RACE of B.OsPIMT1, M are Molecular marker DNA markerDL2000,1 is OsPIMT1 products.5 ' the RACE of C.OsPIMT1, M are molecular labeling DNAmarkerDL2000.Figure 24 ZH T-DNA are inserted into tying composition.R represents T-DNA right margins, and L represents T-DNA left margins, S Represent forward primer, A represents reverse primer.

The PCR detections of Figure 34 ZH.M is DNAmarker (DL2000), and ZH11 is that 11,1-4 of China is 4ZH plant.

Fig. 4 RT-PCR of4ZH.M is DNA marker (DL2000), and ZH11 is that 11,4ZH of China is that 4ZH T-DNA are inserted into Strain.

ZH11 and 4ZH germination percentages change after Fig. 5 agings.* 5% significance is represented.

Fig. 6 OsPIMTs are overexpressed and the PCR of RNAi is detected.M is DNA marker (DL2000), and P is positive plasmid, and 1 is Nipponbare negative control, 2-14 are transfer-gen plant.

Fig. 7 OsPIMT1 are overexpressed the southem hybridization checks of transfer-gen plant.

The semi-quantitative RT-PCR analysis of Fig. 8 transfer-gen plants.

Fig. 9 OsPIMT1 transfer-gen plants aging data is analyzed.

Specific embodiment

Hereafter by embodiment, the present invention will be further described

Embodiment 1

The clone of OsPIMT1 genes

The acquisition of overall length CDS

By ncbi database, utilize the PIMT gene coding regions of arabidopsis and wheat (coding sequence, CDS) Sequence is retrieved, and is obtained the EST (expressed sequence tags, ESTs) of high homology, is passed through sequence Row splicing cDNA sequence.Primer is designed according to its conserved sequence and clones full-length cDNA using Smarter RACE technologies, 5 ' The RACE primers of RACE and 3 ' are as follows：

MT1R5：5’GTTCAACACCAACTGCTCGCCCTTCTG3’

MT1R3：5’ATCGGTTACAACGCCACCATTTC3’

The RNA (Figure 1A) of the blade of extraction japonica rice Nipponbare and root first, passes through SMARTer^TM RACE CDNAAmplification Kit reverse transcription mRNA, prepare respectively for containing 5 ' RACE of specific linkers sequence and 3 ' The cDNA of RACE, transcriptive process,reversed are carried out by the specification that manufacturer provides.Using 5 ' and 3 ' RACE cDNA masterplates dilute 50 times as RT-PCR masterplates, the universal primer UMP progress PCR amplification provided respectively with kit with 5 ' RACE and 3 ' RACE primers (Figure 1B, 1C), sample presentation is sequenced after amplified production being connected to pJET1.2 cloning vectors.

The clone of OsPIMT1 genome sequences

By ncbi database, it is compared using existing overall length CDS with rice genome, it is determined that OsPIMT1's Open reading frame, and pass through bioinformatics software and predict its promoter region, covering OsPIMT1 promoter regions are devised, it is outer aobvious Sub-district, includes the primer sequence of sub-district and terminator district, and primer sequence is as follows：

MT1g-F：5’GAATTCAGCATCCTACCCCATCAAGACCTCGC3’

MT1g-R：5’AAGCTTCCTGATTTTGAGTCCTCCCGTCC3’

Gene cloning is carried out as masterplate using the CTAB methods extraction rice leaf genomic DNA of improvement, by amplified production Sample presentation is sequenced after being connected to pJET1.2 cloning vectors, the results showed that OsPIMT1 genes include 3 intrones, 4 extrons.

Case study on implementation 2

Influence of the OsPIMT1 deletants for seed keeping quality

By the mutant information of RiceGE rice mutant database search OsPIMT1, the T- of an OsPIMT1 is found DNA insertion mutation body 04Z (Fig. 2) belong to Rice Mutant Database (RMD), and online Tail-PCR results are carried out Blast, which is compared, to be found, insertion point is likely located at OsPIMT1 third intrones.In order to improve the verification mutant whether Corresponding position is inserted in, utilizes carrier flank primers NTL5B：5 ' AATCCAGATCCCCCGAATTA3 ' and flanking genomic primer 4Z-A：5 ' GGCACATAGCGCACAG-CCGTCTCAT3 ' carry out PCR identifications (Fig. 3), the results showed that the region has occurred really Insertion mutation shows its insertion point in third introne by sequencing.RT-PCR analyses (Fig. 4) are then carried out to it, are tied Fruit shows that the T-DNA in 4ZH is inserted into bit end and does not influence promoter activity, and upstream sequence still can transcribe, but after insertion point Missing, results in the change of OsPIMT1 gene cDNA sequences.

RT-PCR analyses then are carried out to it, the results showed that the T-DNA in 4ZH, which is inserted into bit end, does not influence promoter work Property, upstream sequence still can be transcribed, but be lacked after insertion point, result in the change of OsPIMT1 gene cDNA sequences.On wherein Trip primer is qPCR-MT1-F and qPCR-MT1-R, and across introne primer is that qPCR-MT1-F and MT1-R, UBC5 reference gene draw Object is UBC5-2-F and UBC5-2-R, and primer sequence is as follows：

qPCR-MT1-F：5’ATGCGTGCTCTGGATGT3’

qPCR-MT1-R：5’GAAGTAACCAACTCTGGGATA3’

MT1-R：5’ATGCGTGCTCTGGATGT3’

UBC5-2-F：5’ACCACTTCGACCGCCACTACT3’

UBC5-2-R：5’ACGCCTAAGCCTGCTGGTT3’

It 4ZH mutant seeds with China 11 compare into seed respectively sorts 100 and be wrapped in mesh bag and be positioned over 30 DEG C of baking ovens It dries 3 days, seed is put into 42 DEG C of temperature immediately, aging (Fig. 5) in the ageing oven of relative humidity RH88%.It will kind after aging Attached bag is rolled in filter paper germinates in 28 DEG C of temperature, relative humidity RH70% growth cabinets.Three repetitions of progress per treatment, Coprocessing three times, using SPSS19.0 analyzed (Fig. 5) by data.The result shows that when unaged, both sides' germination percentage difference is not Significantly.After artificial ageing 21 days, 11 and 4ZH of wild type China is decreased obviously, however the germination percentage downward trend of China 11 More slowly, germination percentage is higher than mutant close to 60%, and the average bud length of significant difference (P ＜ 0.05) and mutant is only It is the 50% of wild type, illustrates that lack OsPIMT1 has certain influence for the keeping quality of seed.

Case study on implementation 3

Influence of the OsPIMT1 transfer-gen plants to rice keeping quality and seed vitality

The structure of OsPIMT1 transgene carriers

The primer containing restriction enzyme site is designed using Nipponbare cDNA as masterplate, carries out the amplification of OsPIMTs code areas.Primer Sequence is as follows：

PIMT1-CDS-F：5’TCGAGTGTTCTCTCACTTTCGC3’

PIMT1-CDS-R：5’TATGGGTCACC(underscore is BstEII digestions position to ATTCAGTTAGCCTGCAGCT3 ' Point)

It is obtained after this segment is attached after NcoI and BstEII double digestions with plant expression vector pCAMBIA1301 Obtain OsPIMT1 over-express vectors MT1-OE.

It is compared by Blast, chooses OsPIMT1 specific regions sequence as a purpose, design the primer with restriction enzyme site, PTCK303 plant RNA interference carriers, carrier construction method reference are connected to by a PCR digestion twice.Primer is as follows：

MT1-kpnI+speI：5’ACGGTACCACTAGTGCACCGACTGTGGTCAAGC3’

MT1-BamHI+sacI：5’AAGGATCCGAGCTCGGGCTGTCGAAATAGGGAG3’

The acquisition of OsPIMT1 transfer-gen plants

It will be in above-mentioned two vector introduction japonica rice Nipponbare (Fig. 6) by agriculture bacillus mediated rice conversion method.It is overexpressed Transfer-gen plant obtains positive 10 by the PCR identifications of hygromycin Hyg gene primers HYG1-F and HYG1-R and clones 186 plants Transfer-gen plant, interference expression transfer-gen plant is identified by the PCR of hygromycin Hyg gene primers HYG1-F and HYG1-R, is obtained 8 clones, 98 plants of transfer-gen plants are obtained, the primer is as follows：

HYG1-F：5’TACTTCTACACAGCCATCGGTCCAG3’

HYG1-R：5’AGGGCGAAGAATCTCGTGCTTTC3’

HYG2-F：5’TGCTTGACATTGGGGAGTTTAG3’

HYG2-R：5’AAGATGTTGGCGACCTCGTATT3’

Copy number (the figure of transgenic positive plant extraction DNA progress Southern Blot detection insertion genes will be overexpressed 7), the transfer-gen plant that singly copies of selection divides single plant to collect seed, then take after 100 or more germinations using hygromycin into Row screening, shows that seed is homozygous if without death.

The homozygous overexpression transgenic seed of selection, interference expression transgenic seed and wild rice Nipponbare kind After son is sprouted, using Yoshida culture rice to 3 leaf phases, rice RNA is then extracted, using rice UBC5 as reference gene, into Row semi-quantitative RT-PCR analysis (Fig. 8).Rise the result shows that being overexpressed OsPIMT1 expression in transfer-gen plant, and interfere expression It expresses and declines in transfer-gen plant, PCR primer qPCR-MT1-F used and qPCR-MT1-R sequences are for example above-mentioned.

In order to examine influence of the transfer-gen plant to rice keeping quality, will be overexpressed and interference expression transgenic seed with Respectively sorting 100 is wrapped in mesh bag and is positioned over 30 DEG C of baking ovens and dries 3 days control Nipponbare seed, and seed is put into temperature 42 immediately DEG C, aging in the ageing oven of relative humidity RH88%.Seed is wrapped in filter paper in 28 DEG C of temperature after aging, it is relatively wet It germinates in degree RH70% growth cabinets.Three repetitions of progress per treatment, three times, data are carried out coprocessing using SPSS19.0 Analysis.The result shows that when unaged, both sides' germination percentage difference is not notable.After artificial ageing 21 days, it is overexpressed transgenosis and plants The germination percentage of strain is maintained at 30%, and it is 10% or so to compare, the two significant difference (P ＜ 0.05).Express transgenic is interfered to plant Strain is fallen to less than 3%, compared with the control significant difference.The above result shows that OsPIMT1 genes can improve rice keeping quality With seed vitality (Fig. 9).

All data analyses of this experiment are standardized initial data using Excel softwares, Ran Houyong SPSS19.0 softwares are for statistical analysis.Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention And be not restricted to the described embodiments, the change made under other any Spirit Essences and principle without departing from the present invention is repaiied Decorations are substituted, combination, are simplified, and be should be equivalent substitute mode, are included within protection scope of the present invention.

Claims (1)

1. applications of the gene OsPIMT1 in rice paddy seed keeping quality and seed vitality is improved, the DNA of gene OsPIMT1 Sequence is as shown in SEQ ID NO.1-2.