CN104894293A - Porcine circovirus type 2 isothermal PCR on-site rapid detection kit - Google Patents
Porcine circovirus type 2 isothermal PCR on-site rapid detection kit Download PDFInfo
- Publication number
- CN104894293A CN104894293A CN201510219751.7A CN201510219751A CN104894293A CN 104894293 A CN104894293 A CN 104894293A CN 201510219751 A CN201510219751 A CN 201510219751A CN 104894293 A CN104894293 A CN 104894293A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- circular ring
- isothermal
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a porcine circovirus type 2 isothermal PCR on-site rapid detection kit. The kit comprises primers, a 10-fold isothermal amplification reaction liquid, DNA polymerase, a positive contrast, a negative contrast and a color developing agent. The primers comprise outer primers and inner primers. The kit realizes qualitative and quantitative determination of a porcine circovirus type 2. Through use of Bst DNA enzyme strand displacement characteristics, the four primers are designed andsix zones of a target sequence can be recognized, a lot of repeated stem-loop-type structures are produced under isothermal conditions, and in qualitative detection, determination can be realized only by reaction pipe color change observed through naked eyes without any special equipment. Therefore, the kit has the characteristics of specificity, high sensitivity, detection time shorter than that of common PCR and pig farm on-site rapid detection feasibility.
Description
Technical field
The invention belongs to technical field of bioengineering, relate to a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits.
Background technology
Pig circular ring virus (porcine circovirus, PCV) is a kind of ring-type, Single-stranded DNA virus without cyst membrane, and it comprises pig 1 type PCV-II (PCV-1) and pig 2 type PCV-II (PCV-2) two genotype.Swinery ubiquity PCV-1, but PCV-1 does not have pathogenic, and the infection of PCV-2 can cause pmws (Postweaning Multisystemic wasting syndrome, PMWS), farrowing sow breeding difficulty, scorching nephrotic syndrome (the Porcine dermatitis and nephropathy syndrome of pigskin, PDNS), sick syndrome (the Porcine respiratory disease complex of porcine respiratory, and A2 type congenital tremors (the Congenital tremors of piglet PRDC), the various diseases such as CT).
Postweaning multisystemic respiratory insufficiency syndrome (PMWS) major effect 6-8 week age swinery, be mainly in the child care later stage and turn the preliminary stage of fattening house, cardinal symptom is retarded growth, skin and visual mucous membrane is pale or jaundice, anaemia, expiratory dyspnea, ochrodermia, become thin, suffer from diarrhoea, body surface lymphoglandula, particularly inguinal lymphadenopathy, occasionally have the symptoms such as cough and central nervous system disorder, mortality ratio is about 8% ~ 35%.In addition, PMWS normal with breeding with the cause of disease generation polyinfection such as dyspnoea syndrome virus, swine influenza virus, pig parvoviral, haemophilus parasuis, actinobacillus pleuropneumoniae, swine streptococcus, and make the symptom of PMWS more complicated; The scorching nephrotic syndrome (PDNS) of pigskin is a kind of immune-mediated vascular disease, and its major lesions is at skin and kidney.The swinery sickness rate that this disease betides 8 ~ 18 week age is usually 0.15% ~ 2%, sometimes reaches 7%.Clinical symptom is mainly place's skins such as perineal position, four limbs, thorax abdomen and ear and circular or irregular protuberance occurs, take on a red color or purple, central authorities are the patch of black, and these patches are fused into ribbon sometimes mutually, and dermatosis can disappear on rare occasions.Sick pig performance apocleisis, become thin, pale, limping, conjunctivitis, diarrhoea, subcutaneous dropsy, sometimes body temperature rise.It is pale that ill pig cuts open the visible kidney of inspection, enlargement, and there is ecchymosis on surface, and Histopathologic changes is hemorrhagic necrotic dermatitis, arteritis and exudative glomerulonephritis and interstitial nephritis; Sow breeding difficulty (Reproductive failure), PCV-2 infects swinery and there will be the symptom of breeding difficulty, cause pregnant sow to be miscarried, stillborn foetus, mummy tire and the front piglet mortality ratio of wean high; The growing and fattening pigs in 11 ~ 22 week age of porcine respiratory syndrome (PRDC) major effect and bred pigs, the symptoms such as main clinic symptoms is poor growth, spirit is depressed, feed efficiency low, apocleisis, heating, cough, diarrhoea and expiratory dyspnea.But general PCV-2 simple infection there will not be the clinical symptom of PRDS, but breed with pig and other cause of disease polyinfections such as dyspnoea syndrome virus, porcine influenza, mycoplasma hyopneumoniae, actinobacillus pleuropneumoniae just cause PRDC; The pig in 6 ~ 14 week age of Hypertrophic and necrotizing pneumonia (PNP) major effect of pig, mortality ratio reaches 4% ~ 10%, shows as Hypertrophic and necrotizing pneumonia.The lung injury of PNP energy morphogenesis characters, it is made a definite diagnosis mainly according to changes in histopathology (as gangrenosum acne and exedens bronchiolitis, bronchiolitis fibrosa obliterans, alveolus wall forms granulomatous inflammation etc.).
At present, the PCV-2 detection technique of domestic employing mainly contains: Viral isolation, indirect immunofluorescence, immunoenzyme monolayer assay, in situ hybridization, enzyme linked immune assay etc., and these methods all exist that complicated operation, requirement for experiment condition are high, not strong, the consuming time length of specificity, be not suitable for the deficiencies such as extensive detection.Therefore, develop quick, the easy PCV2 detection method being used for routine experimentation, realize the quick diagnosis of PCV2, to the prevention and corntrol important in inhibiting of epidemic disease.
Summary of the invention
The object of the invention is to overcome the defect existed in prior art, one boar 2 type PCV-II (PCV-2) isothermal PCR field quick detection test kit is provided, the present invention utilizes the strand displacement characteristic of Bst DNA enzymatic, design 4 primers, identify 6 regions of target sequence, generate a large amount of stem ring texture repeated under isothermal conditions, any specific installation is not needed when qualitative detection, only need observe reacting pipe colour-change can judge therefore have specificity, susceptibility is high and detection time is shorter than regular-PCR, be applicable to the features such as the rapid detection at scene, pig farm.
The present invention realizes especially by following technical scheme:
A kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits, comprise Primer composition, 10 times of isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developers, described Primer composition is made up of outer primer and inner primer, described outer primer sequence is SEQ ID NO.1 and SEQ ID NO.2, and described inner primer is SEQ ID NO.3 and SEQ ID NO.4.
Outer primer of the present invention is 1:6 ~ 9 with the ratio of the mole number of inner primer;
10 times of described isothermal amplification liquid are made up of the dNTPs of 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 40 ~ 100mmol/L magnesium sulfate, 4 ~ 10mol/L trimethyl-glycine, 5 ~ 18mmol/L and the Triton X-100 of mass percentage concentration 0.1%.
Described dNTPs is the equal amount of mixture containing four kinds of dNTP.
Described archaeal dna polymerase is the Bst archaeal dna polymerase with strand displacement effect, and vigor is 8 activity unit/microlitres;
Described positive control is the positive plasmid having segment genome one section of distinguished sequence containing insertion pig 2 type PCV-II ORF2, and isothermal amplification amplification region is arranged in this distinguished sequence, and its concentration is 10
7copy/μ L, its making method is: adopt pcr amplification one section of pig 2 type PCV-II ORF2 to have segment genome distinguished sequence, then PMD18-T carrier is loaded, be converted into DH5 α competence bacterium, extract plasmid DNA after sequence is determined, adopt ultraviolet spectrophotometer measure the concentration of plasmid DNA and use sterilizing distilled water adjustment copy number to 10
7copy/μ L.
Described negative control is sterilizing distilled water;
Described developer is 20 times of SYBR Green I.
The present invention is claimed above-mentioned Primer composition also, and provides the application of this Primer composition in 2 type pig circular ring virus detect.
Beneficial effect of the present invention is: 1) detect quick, it is slow that Standard PCR detection technique compares this technical speed, and from sampling out, result is minimum needs 48h, and this technology only needs 30-90 minute; 2) easy to use, Standard PCR needs the plant and instrument that PCR instrument, electrophoresis system, gel imaging system etc. are large-scale, expensive, and this technology only needs a thermostat container or thermos cup; 3) result of the present invention judges not need through electrophoresis, simpler than PCR, very easily promotes.For detection by quantitative, although by means of quantitative real time PCR Instrument, do not need to synthesize fluorescent probe, only need by fluorescence dye SYBR Green I, cost lowers greatly; 4) temperature of reaction of the present invention is at 60 DEG C ~ about 65 DEG C, and identifies target gene 6 specific regions, and primer polymer and non-specific amplification probability reduce greatly, and dosing accuracy improves greatly.
Embodiment
Below in conjunction with embodiment, the present invention is described further, the following stated, only to preferred embodiment of the present invention, not do other forms of restriction to the present invention, any those skilled in the art may utilize the technology contents of above-mentioned announcement to be changed to the Equivalent embodiments of equal change.Everyly do not depart from the present invention program's content, any simple modification done following examples according to technical spirit of the present invention or equivalent variations, all drop in protection scope of the present invention.
Pig 2 type PCV-II isothermal PCR field quick detection test kit, is made up of a set of Primer composition, 10 times of isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developers.Primer composition is outer primer is that 1:6 ~ 9 form with the ratio of the mole number of inner primer, and its sequence is:
Outer primer 1:TGTCACCCTGGGTGATCG;
Outer primer 2:GCATCTTCAACACCCGCC;
Inner primer 1:CTCAAACCCCCGCTCTGTGCCAGGGCCAGAATT CAACCT;
Inner primer 2:AATCTCATCATGTCCACCGCCC-CTCCCGCACCTT CGGATA.
10 times of isothermal amplification liquid (represent by the form of " 10 × LAMP reaction solution " usually, the multiple diluted when what numeral " 10 " represented is and uses) be made up of the dNTP s of 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 40 ~ 100mmol/L magnesium sulfate, 4 ~ 10mol/L trimethyl-glycine, 5 ~ 18mmol/L and the Triton X-100 of mass percentage concentration 0.1%, dNTPs is the equal amount of mixture containing four kinds of dN TP.
Archaeal dna polymerase is the Bst archaeal dna polymerase with strand displacement effect, and vigor is 8 activity unit/microlitres; Positive control is the positive plasmid having segment genome one section of distinguished sequence containing insertion pig 2 type PCV-II ORF2, and isothermal amplification amplification region is arranged in this distinguished sequence, and its concentration is 10
7copy/μ L.The making method of positive plasmid is: adopt pcr amplification one section of pig 2 type PCV-II ORF2 to have segment genome distinguished sequence, then PM D18-T carrier is loaded, be converted into DH5 α competence bacterium, extract plasmid DNA after sequence is determined, adopt ultraviolet spectrophotometer measure the concentration of plasmid DNA and use sterilizing distilled water adjustment copy number to 10
7copy/μ L; Negative control is sterilizing distilled water; Developer is 20 times of SY BR Green I.SYBR Green I is highly sensitive DNA fluorescence dye.The avidity of SYBR Green I and double-stranded DNA is very high, does not have restraining effect to enzyme conventional in molecular biology.
The principle of this test kit for: isothermal amplification process be first by external primer amplification go out inner primer increase required for template and the synthesis of initial reactant template; And then synthesis target gene DNA fragmentation is guided by inner primer, because the DNA fragmentation of inner primer amplification contains this primer 5, the reverse complementary sequence of end DNA fragmentation, thus loop-stem structure is formed by hybridization between these reverse complementary sequences, guiding chain replacement synthesis after an other inner primer and its complementary strand anneal, create new loop-stem structure in other one end of the DNA fragmentation of amplification, form dumbbell structure, in one hour, this circulating reaction can make target DNA be accumulated to 10
9copy, after electrophoresis, visible amplification end product is made up of the DNA fragmentation differed in size, and in scalariform band, also observes amplification by fluorescence dye.The whole reaction of LAMP divides three steps to complete, i.e. the originally synthesis of reactant template, cyclic amplification stage, extension and recirculation.
Embodiment 1
1) Acquire and process of sample:
The sample of vivo porcine collection is one of nasal secretion, urine, ight soil, nasal mucosa, and bronchia mucosal and nasal secretion are best living materials; The sample of sick dead pig collection is one of segmental bronchus, lungs, tonsilla, kidney, spleen, with lungs, tonsilla, bronchial lymph nodes the best.The fluent materials such as secretory product gather 100 μ L, organization material 100mg, organization material suitably shred or grinding effect better.
2) sample gathered does not need further process, directly adds reaction tubes;
3) example reaction pipe, positive control pipe, negative control pipe are slightly shaken;
4) sample, the positive and negative control pipe are put into 65 DEG C of water-baths or constant incubator 60min simultaneously;
5) result judges: meet the requirements as examination criteria when negative tube still keeps colourless, positive pipe to become light blue; Example reaction pipe is colourless shows Sample Negative, namely infects without circovurus type 2; Example reaction pipe is light blue shows Sample Positive, and namely this pig exists circovurus type 2 infection;
Embodiment 2
Shangnan County Rui Sheng limited industrial company pig livestock on hand 4000, suitable numerous sow 200, in July, 2013, September gathers 250 parts (wherein sows 50 parts) respectively, 180 parts of (wherein sow 50 parts) nasal secretions detect, this test kit detects bred pigs positive rate 1.57%, sow positive rate 0.0%.Standard PCR detects bred pigs positive rate 1.36%, sow positive rate 0.0%.Result shows that easy, consuming time short, the susceptibility of this kit test method is higher than Standard PCR.
Embodiment 3
Starlight breeding pig numerous cultivation company limited pig livestock on hand 80000, suitable numerous sow 600, there are miscarriage, mummy tire, cad pig and part hog cholera immune antibody horizontal instability etc. in March, 2014 in field, gather sow nasal secretion 230 parts, cad pig and 26 parts, mummy tire immediately to detect, this kit results display sow positive rate 23%, cad pig and mummy tire positive rate 78%.Standard PCR detection display sow positive rate 21.8%, cad pig and mummy tire positive rate 77.6%.The said firm uses certain company's PCV-II inactivated vaccine subsequently, in July, 2014 miscarries in field and cad pig significantly reduces, collection sow nasal secretion 180 parts, bred pigs 220 parts detect with this test kit again, sow positive rate 6.08%, bred pigs positive rate 8.73%.
Claims (8)
1. a type pig circular ring virus isothermal PCR field quick detection test kit, it is characterized in that: comprise Primer composition, 10 times of isothermal amplification liquid, archaeal dna polymerase, positive control, negative control and developers, described Primer composition is made up of outer primer and inner primer, described outer primer sequence is SEQ ID NO.1 and SEQ ID NO.2, and described inner primer is SEQ ID NO.3 and SEQ ID NO.4.
2. a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits according to claim 1, is characterized in that: described outer primer is 1:6 ~ 9 with the ratio of the mole number of inner primer.
3. a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits according to claim 1, is characterized in that: 10 times of described isothermal amplification liquid are made up of the dNTPs of 200mmol/L Tri(Hydroxymethyl) Amino Methane Hydrochloride, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 40 ~ 100mmol/L magnesium sulfate, 4 ~ 10mol/L trimethyl-glycine, 5 ~ 18mmol/L and the Triton X-100 of mass percentage concentration 0.1%.
4. a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits according to claim 3, is characterized in that: described dNTPs is the equal amount of mixture containing four kinds of dNTP.
5. a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits according to claim 1, it is characterized in that: described archaeal dna polymerase is the Bst archaeal dna polymerase with strand displacement effect, vigor is 8 activity unit/microlitres.
6. a kind of 2 type pig circular ring virus isothermal PCR field quick detection test kits according to claim 1, it is characterized in that: described positive control is the positive plasmid having segment genome one section of distinguished sequence containing insertion pig 2 type PCV-II ORF2, its making method is: adopt pcr amplification one section of pig 2 type PCV-II ORF2 to have segment genome distinguished sequence, then PMD18-T carrier is loaded, be converted into DH5 α competence bacterium, extract plasmid DNA after sequence is determined, ultraviolet spectrophotometer is adopted to measure the concentration of plasmid DNA and adjust copy number to 10 with sterilizing distilled water
7copy/μ L.
7. Primer composition according to claim 1, it is characterized in that: described Primer composition is made up of outer primer and inner primer, described outer primer sequence is SEQ ID NO.1 and SEQ ID NO.2, and described inner primer is SEQ ID NO.3 and SEQ ID NO.4.
8. the application of Primer composition according to claim 7 in 2 type pig circular ring virus detect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510219751.7A CN104894293A (en) | 2015-04-30 | 2015-04-30 | Porcine circovirus type 2 isothermal PCR on-site rapid detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510219751.7A CN104894293A (en) | 2015-04-30 | 2015-04-30 | Porcine circovirus type 2 isothermal PCR on-site rapid detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104894293A true CN104894293A (en) | 2015-09-09 |
Family
ID=54027244
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510219751.7A Pending CN104894293A (en) | 2015-04-30 | 2015-04-30 | Porcine circovirus type 2 isothermal PCR on-site rapid detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104894293A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307367A (en) * | 2008-02-20 | 2008-11-19 | 中国农业科学院兰州兽医研究所 | Technology for rapidly detecting porcine circovirus type2 |
| CN101586169A (en) * | 2009-06-30 | 2009-11-25 | 中国兽医药品监察所 | Porcine circovirus 2 LAMP detection kit and detecting method |
| CN103725795A (en) * | 2013-09-30 | 2014-04-16 | 上海佳牧生物制品有限公司 | Porcine circovirus type 2 LAMP (loop-mediated isothermal amplification) detection method |
| CN103820580A (en) * | 2014-03-16 | 2014-05-28 | 贵州省畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) diagnostic kit for porcine circovirus type 2 |
-
2015
- 2015-04-30 CN CN201510219751.7A patent/CN104894293A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307367A (en) * | 2008-02-20 | 2008-11-19 | 中国农业科学院兰州兽医研究所 | Technology for rapidly detecting porcine circovirus type2 |
| CN101586169A (en) * | 2009-06-30 | 2009-11-25 | 中国兽医药品监察所 | Porcine circovirus 2 LAMP detection kit and detecting method |
| CN103725795A (en) * | 2013-09-30 | 2014-04-16 | 上海佳牧生物制品有限公司 | Porcine circovirus type 2 LAMP (loop-mediated isothermal amplification) detection method |
| CN103820580A (en) * | 2014-03-16 | 2014-05-28 | 贵州省畜牧兽医研究所 | Loop-mediated isothermal amplification (LAMP) diagnostic kit for porcine circovirus type 2 |
Non-Patent Citations (5)
| Title |
|---|
| CHO,S.-H.等: "Porcine circovirus2", 《GENBANK DATABASE》 * |
| FANGWANG等: "Genetic variation analysis of Chinese strains of porcine circovirus type 2", 《VIRUS RESEARCH》 * |
| FRANZO,G.等: "Porcine circovirus-2 isolate 694/11/2012_Padova_10_06/04/2012, complete genome", 《GENBANK DATABASE》 * |
| WANG,F.等: "Porcine circovirus 2 strain TJ04, complete genome", 《GENBANK DATABASE》 * |
| 何逸民 等: "猪圆环病毒2型环介导等温扩增(LAMP)检测方法的研究", 《中国兽医杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ouyang et al. | Recent progress on porcine circovirus type 3 | |
| CN101307367B (en) | Technology for rapidly detecting porcine circovirus type2 | |
| CN101665781B (en) | High-titer Porcine circovirus 2-type cultured cell, preparation method and use thereof | |
| CN111321248B (en) | African swine fever virus MGF-505R gene fluorescence PCR detection reagent, kit and application thereof | |
| WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
| Shen et al. | Recombinant porcine norovirus identified from piglet with diarrhea | |
| Wan et al. | Specific detection of the novel goose astrovirus using a TaqMan real-time RT-PCR technology | |
| CN104651534A (en) | Porcine circovivus loop-mediated isothermal amplification kit and application thereof | |
| CN106399585A (en) | Universal PCR primers and method for detecting group I aviadenovirus and detection kit | |
| Wan et al. | Specific detection and differentiation of classic goose parvovirus and novel goose parvovirus by TaqMan real-time PCR assay, coupled with host specificity | |
| Chen et al. | Development of recombinase aided amplification combined with disposable nucleic acid test strip for rapid detection of porcine circovirus type 2 | |
| Miyabe et al. | Porcine rotavirus B as primary causative agent of diarrhea outbreaks in newborn piglets | |
| Li et al. | Rapid detection of porcine deltacoronavirus and porcine epidemic diarrhea virus using the duplex recombinase polymerase amplification method | |
| CN103820580B (en) | Porcine circovirus 2 type LAMP diagnostic kit | |
| CN107419034A (en) | Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application | |
| Yang et al. | Prevalence and phylogenetic analysis of porcine circovirus type 2 (PCV2) and type 3 (PCV3) in the Southwest of China during 2020–2022 | |
| CN108342510B (en) | Multiple RT-PCR kit for BTV-11 type, 17 type, 20 type, 23 type and 24 type genotype typing identification and detection method thereof | |
| CN103952498A (en) | Porcine circovirus II SYBR Green fluorescence PCR (Polymerase Chain Reaction) diagnostic kit and application thereof | |
| CN107385077B (en) | Specific primer for detecting salmonella pullorum, kit containing primer and application of kit | |
| CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
| CN102286638B (en) | A kind of authentication method of avian infectious bronchitis virus | |
| CN101392299A (en) | Equine influenza detection kit and detection method | |
| CN104894293A (en) | Porcine circovirus type 2 isothermal PCR on-site rapid detection kit | |
| CN114752710A (en) | CrRNA, kit and method for rapid visual detection of SADS-CoV | |
| CN113046482B (en) | Pigeon adenovirus B-type loop-mediated isothermal amplification detection primer set and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150909 |
|
| RJ01 | Rejection of invention patent application after publication |