CN104894287A - HDA detection method and reagent kit for rice ingredients in grain powder food - Google Patents

HDA detection method and reagent kit for rice ingredients in grain powder food Download PDF

Info

Publication number
CN104894287A
CN104894287A CN201510380048.4A CN201510380048A CN104894287A CN 104894287 A CN104894287 A CN 104894287A CN 201510380048 A CN201510380048 A CN 201510380048A CN 104894287 A CN104894287 A CN 104894287A
Authority
CN
China
Prior art keywords
hda
primer pair
rice
rice composition
cereal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510380048.4A
Other languages
Chinese (zh)
Inventor
张帆涛
谢建坤
罗向东
周毅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangxi Normal University
Original Assignee
Jiangxi Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangxi Normal University filed Critical Jiangxi Normal University
Priority to CN201510380048.4A priority Critical patent/CN104894287A/en
Publication of CN104894287A publication Critical patent/CN104894287A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an HDA detection method and a reagent kit for rice ingredients in grain powder food. The method comprises the following steps: extracting DNA from a to-be-detected grain sample as a template for the HDA reaction; taking a primer pair or a primer pair containing the primer pair in a reagent kit as an amplification primer, performing HDA amplification reaction, and obtaining an amplification product; detecting the amplification product, and making judgment. The provided primer pair is extremely high in specificity, a corresponding specific fragment only can be amplified from rice, so that the rice ingredients in the grain powder food can be detected; moreover, a great amount of samples can be detected simultaneously. The method has the characteristics of simplicity, sensitivity, accuracy and rapidness.

Description

The HDA detection method of rice composition and test kit in a kind of cereal powdery-food
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to a kind of the HDA detection method and the test kit that detect rice composition in cereal powdery-food.
Technical background
Along with the raising day by day of people's living standard, and the quickening of rhythm of life, increasing cereal powdery-food appears in daily life.Rice has special morphological specificity before undressed, and easy and other cereal is distinguished, but if rice is made powdery, mixes mutually, then not easily distinguish with the cereal of other powdery.Some fake and inferior commodities mark, containing rice composition, may not contain rice composition, and replace with other cereal; And some marks are not containing the commodity of rice composition, but rice composition may be with the addition of.From cereal powdery-food, detect rice composition is the task that food inspection is enforced the law with supervision.
The detection method of current cereal powdery food ingredient mainly comprises: organoleptic method, chemical method and near infrared spectroscopic method.
Utilize organoleptic method precise Identification rice composition difficulty from different grain flour shape mixture comparatively large, there is people for misjudgment, not there is science and cogency.Utilizing chemical method to detect grain component is utilize different chemical reagent and grain component to react, thus detects its composition and identify.The chemical composition of cereal generally all comprises protein, starch, lipid and inorganic salt etc.Different types of cereal has similar chemical composition, thus utilize the method to detect rice composition susceptibility from cereal pulverulent mixture and specificity poor.Near infrared spectroscopic method is a kind of food detection method comparatively conventional at present.Though the method can detect grain component, instrument requirements is higher, needs enough expertise Modling model just can analyze, comparatively complicated; In addition, for different types of cereal mixing pulverized specimen, the background interference existed during mensuration also may affect detected result.
The dependence enzyme dna isothermal amplification technique (Helicase-Dependent isothermal DNA Amplification, be called for short HDA) that untwists invented a kind of nucleic acid isothermal amplification technology by NEB company of the U.S. in 2004.This technology only need be carried out at a constant temperature, do not need the process of temperature variation, therefore, in actually operating and instrument requirements, HDA technology is all more simple and cheap than common nucleic acid amplification technique (PCR), make the detection of sample achieve quick, easy and high-throughput, thus be more easily developed out the application product of detection.
HDA know-why utilizes helicase to untie DNA double chain under constant temperature, simultaneously the stable strand untied of DNA single chain binding protein (SSB) provides in conjunction with template for primer, then complementary strand is catalyzed and synthesized by archaeal dna polymerase, the double-strand of new synthesis forms strand again under the effect of helicase, and enter cyclic amplification reaction as the template of next round synthesis, finally realize the exponential growth of target sequence.The advantage of this technology is: isothermal duplication, and HDA technology just can complete amplified reaction a steady temperature, does not need the temperature variation circulated as regular-PCR; Easy and simple to handle, the design of HDA to primer is similar to regular-PCR, does not need complicated design of primers, does not also need to do any special processing for other reactive components; Equipment is simple, and HDA reaction does not need complicated equipment, only needs a simple thermostatted just can carry out.Therefore, HDA technology has broad application prospects.
Have not yet to see the report utilizing HDA technology to detect rice composition from cereal powdery-food.
Summary of the invention
The object of the invention is the deficiency for existing detection technique, a kind of HDA detection method and the test kit that simple, accurate, quick, high-throughoutly can detect rice composition from cereal powdery-food are provided.
For achieving the above object, the invention provides a kind of HDA primer pair detecting rice composition from cereal powdery-food, described primer pair sequence is the sequence shown in SEQ ID No:1 and SEQ ID No:2.
The present invention also provides a kind of test kit, the test kit namely containing the primer pair shown in SEQ ID No:1 and SEQ ID No:2.
Detection method concrete steps of the present invention are:
1, from testing sample, DNA is extracted as the template detected;
2, utilize HDA primer pair or containing the primer pair in the test kit of primer pair, carry out HDA reaction, obtain amplified production;
3, detect amplified production, and judge.
Described primer pair sequence is:
SEQ ID No：1：5’-AGCACCTTCTTGTTACCGCG-3’；
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’。
Described primer pair is synthesized by Shanghai Sheng Gong biotechnology company limited.
Described HDA reaction system is: the 10 × damping fluid of 5 μ L, the ATP of 0.2 μm of ol, the dNTPs of 0.1 μm of ol, 10 U Bst polymerase, 5 μ g RecA albumen, 0.2 μ g UvrD helicase, 25 μMs of trehaloses, the upstream primer of 10 μm of ol/L of 2 μ L, the downstream primer of 10 μm of ol/L of 2 μ L, the sample gene group DNA of 2 μ L, uses ddH 2o mends to 50 μ L.
Described HDA reaction method is: reaction system is put into 60-70 oconstant-temperature amplification 2h in C constant-temperature metal bath.
Described detection amplified production to judge be adopt the method for agarose gel electrophoresis to carry out, occurs that namely the specific amplification band of about 205 bp is judged as detecting rice composition.
Present invention also offers a kind of test kit for detecting rice composition from cereal powdery-food.
Test kit for detecting rice composition from cereal powdery-food of the present invention comprises 10 × damping fluid, ATP, dNTPs, Bst polymerase, RecA albumen, UvrD helicase, trehalose, HDA primer pair, positive control dna and ddH 2o.
Described HDA primer pair sequence is:
SEQ ID No：1：5’-AGCACCTTCTTGTTACCGCG-3’；
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’。
Described primer pair is synthesized by Shanghai Sheng Gong biotechnology company limited.
Beneficial effect of the present invention is: HDA primer pair of the present invention has high specificity, only can amplify corresponding specific fragment from rice, rice composition in cereal powdery-food can be detected, and a large amount of sample can be detected simultaneously, there is simple, accurate, quick, high-throughout feature.
Primer pair of the present invention is by analyzing the paddy rice and other cereal chloroplast gene reported rpoBgene order designs.
Primer pair of the present invention is used to detect.Cereal crop mainly comprise paddy rice, barley, wheat, Chinese sorghum, corn, soybean, Job's tears etc., and 5 kinds of different manufacturers or the brand of therefore buying often kind of cereal respectively detect.Embodiment 1 shows, and only have the specific amplified band detecting 205 bp of rice, other cereal does not all detect the amplified band of 205 bp, and accuracy rate is 100%.
Meanwhile, commercially 10 kinds of different cereal powdery commodity, use primer pair of the present invention to detect.Embodiment 2 shows, cereal powdery commodity containing rice composition can detect the specific band of 205 bp, and the cereal powdery commodity not containing rice composition do not detect the amplified band of 205 bp, detected result illustrates consistent with the composition outside commodity packaging, and accuracy rate is 100%.
Above result shows that provided primer pair has very high specificity, accuracy and sensitivity, can be used for the HDA rapid detection of rice composition in cereal powdery commodity.
Accompanying drawing explanation
Fig. 1 is the test-results figure that HDA method of the present invention detects different cereal;
Fig. 2 is the test-results figure that HDA method of the present invention detects different cereal powdery commodity.
Embodiment
Below in conjunction with embodiment, the present invention is further detailed explanation.The experimental technique used in the embodiment of the present invention if no special instructions, is ordinary method in this area.Agents useful for same or the unreceipted production firm person of instrument, be the conventional products that can be obtained by commercial sources.
the design of primer pair:
According to rice chloroplast gene rpoBsequence (Genbank sequence number: japonica rice oryza sativa Japonica: OrsajCp015; Long-grained nonglutinous rice oryza sativa Indica: OrsaiCp08; Wild-rice oryza rufipogon: OrruC_p010, i.e. SEQ ID No:3; SEQ ID No:4; SEQ ID No:5) and other cereal chloroplast gene rpoBsequence (Genbank sequence number: HvsvCp012, TraeCp012, SobiCp012, ZemaCp013, GnpaC_p061, ColajoC_p011) design obtains, and concrete primer pair sequence is as follows:
SEQ ID No：1：5’-AGCACCTTCTTGTTACCGCG-3’；
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’。
Primer sequence is synthesized by Shanghai Sheng Gong biotechnology company limited.
the synthesis of primer pair and the preparation of test kit:
According to above-mentioned nucleotide sequence information by Shanghai Sheng Gong biotechnology company limited synthetic primer pair;
Above-mentioned synthetic primer pair is mixed with respectively concentration be the solution of 10 μm of ol/L as test kit, for subsequent use.
Upstream primer rpoB-F described in following examples is SEQ ID No:1, and downstream primer rpoB-R is SEQ ID No:2.
the extraction of sample gene group DNA(using ZD Biotech plant seed DNA extraction kit to extract the genomic dna detecting sample):
1) getting different grain sample liquid nitrogen is fully milled into Powdered.Therefrom get about 150 mg and be placed in centrifuge tube, add 600 μ L ST solution, vortex shakes 30 s and scatters completely to sample;
2) add 10 μ L RNase A and 10 μ L Proteinase Ks, whirlpool mixes.37 DEG C of water-bath 30 min, and constantly shake;
3) centrifugal 2 min of 12000 rpm.Get 200 μ L supernatant liquors to move in new centrifuge tube, add 200 μ L solution GL, mixing of turning upside down.Add 200 μ L dehydrated alcohols, mixing of turning upside down;
4) will mix liquid moves in centrifugal column, centrifugal 1 min of 12000 rpm.Take out centrifugal column and discard solution in collection tube, centrifugal column being put back in collection tube;
5) in centrifugal column, add 550 μ L solution W 1.Centrifugal 1 min of 12000 rpm.Take out centrifugal column and discard solution in collection tube, centrifugal column being put back in collection tube;
6) in centrifugal column, add 550 μ L solution W 2.Centrifugal 10 sec of 12000 rpm.Take out centrifugal column and discard solution in collection tube, centrifugal column is put back in collection tube.Centrifugal 2 min of 12000 rpm;
7) centrifugal column taken out and put into 1.5 mL centrifuge tubes.Xiang Zhuzhong adds the sterilizing deionized water that 50 μ L are preheating to 50-60 DEG C.Leave standstill centrifugal 1 min of 2-3 min, 12000 rpm.Namely DNA solution is collected in centrifuge tube.
amplified reaction and electrophoresis detection:
1) HDA reaction system and reaction conditions
The genomic dna extracted with step 3, for template, carries out HDA reaction.
Reaction system is 50 μ L, namely in the PCR reaction tubes of 0.2 mL, the 10 × damping fluid of 5 μ L is added, the ATP of 0.2 μm of ol, the dNTPs of 0.08 μm of ol, 10 U Bst polymerase, 5 μ g RecA albumen, 0.2 μ g UvrD helicase, 25 μMs of trehaloses, the upstream primer rpoB-F of 10 μm of ol/L of 2 μ L, the downstream primer rpoB-R of 10 μm of ol/L of 2 μ L, the sample gene group DNA of 2 μ L, uses ddH 2o mends to 50 μ L.
Described HDA reaction method is: reaction system is put into 60-70 oconstant-temperature amplification 2h in C constant-temperature metal bath.
2) electrophoresis detection of amplified production
The sepharose of 1.5% is prepared with 1 × TAE electrophoretic buffer.Get after amplified production mixes with 5 μ L 10 × sample-loading buffers, in the loading wells of the sepharose prepared, carry out point sample.Arrange voltage (3V/cm-5V/cm), electrophoresis time is 50 min-60 min.With gel imaging instrument Taking Pictures recording.
Adopt the rice of above-mentioned primer pair specific amplification rpoBwhether whether gene fragment length is 205 bp, produce in the amplified band judgement sample of 205 bp containing rice composition according to detecting sample.
3) from cereal powdery-food, detect the determination of the HDA method of rice composition
In experiment, all cereal and pulverized specimen are all from large supermarket or the market of farm produce, contain the main species of cereal: paddy rice, wheat, barley, corn, Chinese sorghum, soybean and Job's tears, and often kind of cereal buys 5 kinds of different manufacturers or brand respectively.Meanwhile, buy 10 kinds of different cereal powdery commodity, extract genomic dna respectively as stated above, and carry out HDA amplification, detected through gel electrophoresis result.Gel electrophoresis results is shown in Fig. 1 and Fig. 2.Fig. 1 display only has rice specific detection can go out the amplified band of 205 bp, and other cereal does not all detect the amplified band of 205 bp, and accuracy rate is 100%.Fig. 2 shows, cereal powdery commodity containing rice composition can detect the specific band of 205 bp, and the cereal powdery commodity not containing rice composition can not detect the amplified band of 205 bp, detected result illustrates consistent with the composition outside commodity packaging, and accuracy rate is 100%.
In Fig. 1, M is DNA marker, and 1-5 is paddy rice sample; 6-10 is wheat samples; 11-15 is barley sample; 16-20 is corn sample; 21-25 is Chinese sorghum sample; 26-30 is soybean sample; 31-35 is the HDA detected result of Job's tears sample.The swimming lane M of Fig. 2 cereal powdery commodity that to be DNA marker, 1-4 be containing rice composition, 5-10 is the HDA detected result of the cereal powdery commodity not containing rice composition.Above result shows that provided primer pair has very high specificity, accuracy and sensitivity, and the method that applying provides can carry out rapid detection to the rice composition in cereal powdery commodity.
：1：5’-AGCACCTTCTTGTTACCGCG-3’
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’
sEQ ID No:3:japonica rice ( oryza sativa Japonica) rpoBgene order (Genbank sequence number: OrsajCp015)
ATGCTCCGGAATGGAAATGAGGGAATGTCCACAATACCCGGATTTAGTCAGATCCAATTCGAGGGATTTTGTAGGTTCATTAATCAAGGCTTGGCAGAAGAACTTGAGAAGTTTCCAACAATTAAAGATCCAGATCACGAAATTTCATTTCAATTATTTGCGAAAGGATATCAATTGCTAGAACCTTCGATAAAAGAAAGGGATGCTGTGTATGAATCACTCACCTATTCTTCCGAATTATACGTATCCGCGCGATTAATTTTTGGTTTCGATGTGCAAAAGCAAACCATTTCTATTGGAAACATTCCTATAATGAATTCCTTAGGAACCTTTATAATAAATGGAATATACCGAATTGTGATCAATCAAATATTGCTAAGTCCTGGTATTTACTACCGCTCGGAATTAGACCATAAAGGAATTTCTATCTACACCGGGACTATAATATCAGATTGGGGAGGAAGATCGGAATTAGCAATTGATAAAAAAGAAAGGATATGGGCTCGCGTGAGTAGAAAACAAAAGATATCTATTCTAGTTCTATCATCAGCTATGGGTTCAAATCTAAAAGAAATTCTAGATAATGTTTCCTACCCTGAAATTTTCTTGTCTTTCCCTAATGCTAAGGAGAAGAAGAGGATTGAGTCAAAAGAAAAAGCTATTTTGGAGTTTTATCAACAATTTGCTTGTGTAGGTGGGGACCTGGTATTTTCGGAATCCTTATGTGAGGAATTACAAAAGAAATTTTTTCAACAAAAATGTGAATTAGGAAGGATTGGTCGACGAAATATGAATCGAAGACTGAATCTTGATATACCTCAGAACAGCACCTTCTTGTTACCGCGAGATGTATTGGCCGCTACGGATCATTTGATTGGAATGAAATTTGAAACGGGTATACTTGACGATGACGATATGAATCACTTGAAAAATAAACGTATTCGTTCGGTTGCGGATCTGTTACAAGATCAATTCGGACTGGCTCTTGGTCGTTTACAACATGCGGTTCAAAAAACTATCCGTAGAGTATTCATACGTCAATCAAAACCGACTCCACAAACTTTGGTAACTCCAACTTCAACCTCGATTTTATTAATAACTACTTACGAGACCTTCTTTGGTACATATCCCTTATCTCAAGTTTTTGATCAAACCAATCCATTGACACAAACGGTTCATGGGCGAAAAGTGAGTTGTTTGGGTCCTGGAGGATTGACGGGGAGAACTGCAAGTTTTCGGAGCCGAGATATCCATCCGAGTCACTATGGGCGTATTTGTCCAATTGACACGTCCGAAGGAATCAACGTTGGACTTACTGGATCTTTAGCTATTCATGCGAGAATTGATCATTGGTGGGGATCCGTAGAGAGTCCTTTTTATGAAATATCTGAGAAAGCAAAGAAAAAAAAAGAGAGACAGGTGGTTTATTTATCACCAAATAGAGATGAGTATTATATGATAGCAGCAGGAAATTCTTTGTCCTTGAATCGGGGTATTCAGGAAGAACAGGTTGTTCCAGCTAGATACCGTCAAGAATTCCTGACTATTGCATGGGAACAGATTCATGTTAGAAGTATTTTTCCTTTCCAATATTTTTCTATTGGGGGTTCTCTCATTCCTTTTATTGAGCATAATGATGCGAATCGAGCTTTAATGAGTTCTAATATGCAGCGCCAAGCAGTTCCGCTTTCTCGGTCCGAGAAGTGCATTGTTGGAACTGGATTGGAACGCCAAACAGCTCTAGATTCGAGGGTTTCTGTTATAGCCGAACGCGAGGGAAAGATCATTTCTACTAATAGTCACAAGATCCTTTTATCAAGTAGTGGGAAGACTATAAGTATTCCTTTAGTTACCCATCGGCGCTCTAACAAAAATACTTGTATGCACCAAAAACCTCGGGTTCCGCGGGGTAAATCCATTAAAAAAGGACAAATTTTAGCGGAGGGGGCTGCTACGGTTGGTGGGGAACTTGCTTTAGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGACGCAGTATTAATTAGCGAACGTTTGGTATATGAGGATATTTATACTTCTTTTCACATCCGAAAATATGAAATTCAGACGGATACAACAAGCCAAGGCTCCGCTGAAAAAATCACTAAAGAAATACCACATCTAGAAGAACATTTACTCCGCAATTTGGACAGAAATGGAGTTGTGAAGTTGGGGTCCTGGGTAGAAACAGGCGATATTTTAGTAGGTAAATTAACGCCTCAGATAGCGAGCGAATCGTCCTATATCGCGGAAGCTGGATTATTACGGGCCATATTTGGTCTTGAGGTATCCACTTCAAAAGAAACTTCTCTCAAACTACCGATAGGTGGAAGAGGACGCGTTATCGATGTGAAATGGATCCAGAGGGATCCCCTCGACATAATGGTTCGTGTATATATTTTACAAAAACGCGAAATCAAAGTTGGGGATAAAGTAGCCGGAAGACACGGGAATAAGGGGATCATTTCCAAAATTTTGCCTAGGCAAGATATGCCCTATTTGCAAGATGGAACGCCTGTTGATATGGTTTTCAATCCCTTAGGAGTACCCTCCCGAATGAATGTGGGACAAATATTTGAAAGCTCGCTCGGATTAGCAGGGGATCTGCTAAAGAAACATTATAGAATAGCACCCTTTGATGAGAGATATGAGCAAGAGGCTTCAAGAAAACTTGTGTTTTCAGAATTATATGAAGCCAGTAAACAAACAAAAAATCCGTGGGTATTTGAACCCGAGTACCCGGGAAAAAGCAGAATATTTGATGGAAGAACAGGAGACCCCTTCGAACAGCCTGTTCTAATAGGGAAGTCCTATATCTTAAAATTAATTCATCAAGTTGATGAGAAAATCCACGGACGCTCTACTGGGCCCTATTCACTTGTTACACAACAACCCGTTAGAGGAAGAGCCAAGCAAGGGGGACAACGAATAGGAGAAATGGAAGTTTGGGCTTTAGAAGGATTTGGTGTTGCTCATATTTTACAAGAGATACTTACTTATAAATCTGATCATCTTATAGCTCGCCAAGAAATACTTAACGCTACGATCTGGGGAAAACGAGTACCTAATCACGAGGATCCTCCAGAATCTTTTCGAGTGCTTGTTCGAGAACTACGATCTTTGGCTCTAGAACTGAACCATTTCCTTGTATCTCAGAAGAACTTCCAGGTTAATAGGGAAGAAGTTTGA
sEQ ID No:4:long-grained nonglutinous rice ( oryza sativa Indica) rpoBgene order (Genbank sequence number: OrsaiCp08)
ATGCTCCGGAATGGAAATGAGGGAATGTCCACAATACCCGGATTTAGTCAGATCCAATTCGAGGGATTTTGTAGGTTCATTAATCAAGGCTTGGCAGAAGAACTTGAGAAGTTTCCAACAATTAAAGATCCAGATCACGAAATTTCATTTCAATTATTTGCGAAAGGATATCAATTGCTAGAACCTTCGATAAAAGAAAGGGATGCTGTGTATGAATCACTCACCTATTCTTCCGAATTATACGTATCCGCGCGATTAATTTTTGGTTTCGATGTGCAAAAGCAAACCATTTCTATTGGAAACATTCCTATAATGAATTCCTTAGGAACCTTTATAATAAATGGAATATACCGAATTGTGATCAATCAAATATTGCTAAGTCCTGGTATTTACTACCGCTCGGAATTAGACCATAAAGGAATTTCTATCTACACCGGGACTATAATATCAGATTGGGGAGGAAGATCGGAATTAGCAATTGATAAAAAAGAAAGGATATGGGCTCGCGTGAGTAGAAAACAAAAGATATCTATTCTAGTTCTATCATCAGCTATGGGTTCAAATCTAAAAGAAATTCTAGATAATGTTTCCTACCCTGAAATTTTCTTGTCTTTCCCTAATGCTAAGGAGAAGAAGAGGATTGAGTCAAAAGAAAAAGCTATTTTGGAGTTTTATCAACAATTTGCTTGTGTAGGTGGGGACCTGGTATTTTCGGAATCCTTATGTGAGGAATTACAAAAGAAATTTTTTCAACAAAAATGTGAATTAGGAAGGATTGGTCGACGAAATATGAATCGAAGACTGAATCTTGATATACCTCAGAACAGCACCTTCTTGTTACCGCGAGATGTATTGGCCGCTACGGATCATTTGATTGGAATGAAATTTGAAACGGGTATACTTGACGATGACGATATGAATCACTTGAAAAATAAACGTATTCGTTCGGTTGCGGATCTGTTACAAGATCAATTCGGACTGGCTCTTGGTCGTTTACAACATGCGGTTCAAAAAACTATCCGTAGAGTATTCATACGTCAATCAAAACCGACTCCACAAACTTTGGTAACTCCAACTTCAACCTCGATTTTATTAATAACTACTTACGAGACCTTCTTTGGTACATATCCCTTATCTCAAGTTTTTGATCAAACCAATCCATTGACACAAACGGTTCATGGGCGAAAAGTGAGTTGTTTGGGTCCTGGAGGATTGACGGGGAGAACTGCAAGTTTTCGGAGCCGAGATATCCATCCGAGTCACTATGGGCGTATTTGTCCAATTGACACGTCCGAAGGAATCAACGTTGGACTTACTGGATCTTTAGCTATTCATGCGAGAATTGATCATTGGTGGGGATCCGTAGAGAGTCCATTTTATGAAATATCTGAGAAAGCAAAGAAAAAAAAAGAGAGACAGGTGGTTTATTTATCACCAAATAGAGATGAGTATTATATGATAGCAGCAGGAAATTCTTTGTCCTTGAATCGGGGTATTCAGGAAGAACAGGTTGTTCCAGCTAGATACCGTCAAGAATTCCTGACTATTGCATGGGAACAGATTCATGTTAGAAGTATTTTTCCTTTCCAATATTTTTCTATTGGGGGTTCTCTCATTCCTTTTATTGAGCATAATGATGCGAATCGAGCTTTAATGAGTTCTAATATGCAGCGCCAAGCAGTTCCGCTTTCTCGGTCCGAGAAGTGCATTGTTGGAACTGGATTGGAACGCCAAACAGCTCTAGATTCGAGGGTTTCTGTTATAGCCGAACGCGAGGGAAAGATCATTTCTACTAATAGTCACAAGATCCTTTTATCAAGTAGTGGGAAGACTATAAGTATTCCTTTAGTTACCCATCGGCGCTCTAACAAAAATACTTGTATGCACCAAAAACCTCGGGTTCCGCGGGGTAAATCCATTAAAAAAGGACAAATTTTAGCGGAGGGGGCTGCTACGGTTGGTGGGGAACTTGCTTTAGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGACGCAGTATTAATTAGCGAACGTTTGGTATATGAGGATATTTATACTTCTTTTCACATCCGAAAATATGAAATTCAGACGGATACAACAAGCCAAGGCTCCGCTGAAAAAATCACTAAAGAAATACCACATCTAGAAGAACATTTACTCCGCAATTTGGACAGAAATGGAGTTGTGAAGTTGGGGTCCTGGGTAGAAACAGGCGATATTTTAGTAGGTAAATTAACGCCTCAGATAGCGAGCGAATCGTCCTATATCGCGGAAGCTGGATTATTACGGGCCATATTTGGTCTTGAGGTATCCACTTCAAAAGAAACTTCTCTCAAACTACCGATAGGTGGAAGAGGACGCGTTATCGATGTGAAATGGATCCAGAGGGATCCCCTCGACATAATGGTTCGTGTATATATTTTACAAAAACGCGAAATCAAAGTTGGGGATAAAGTAGCCGGAAGACACGGGAATAAGGGGATCATTTCCAAAATTTTGCCTAGGCAAGATATGCCCTATTTGCAAGATGGAACGCCTGTTGATATGGTTTTCAATCCCTTAGGAGTACCCTCCCGAATGAATGTGGGACAAATATTTGAAAGCTCGCTCGGATTAGCAGGGGATCTGCTAAAGAAACATTATAGAATAGCACCCTTTGATGAGAGATATGAGCAAGAGGCTTCAAGAAAACTTGTGTTTTCAGAATTATATGAAGCCAGTAAACAAACAAAAAATCCGTGGGTATTTGAACCCGAGTACCCGGGAAAAAGCAGAATATTTGATGGAAGAACAGGAGACCCCTTCGAACAGCCTGTTCTAATAGGGAAGTCCTATATCTTAAAATTAATTCATCAAGTTGATGAGAAAATCCACGGACGCTCTACTGGGCCCTATTCACTTGTTACACAACAACCCGTTAGAGGAAGAGCCAAGCAAGGGGGACAACGAATAGGAGAAATGGAAGTTTGGGCTTTAGAAGGATTTGGTGTTGCTCATATTTTACAAGAGATACTTACTTATAAATCTGATCATCTTATAGCTCGCCAAGAAATACTTAACGCTACGATCTGGGGAAAACGAGTACCTAATCACGAGGATCCTCCAGAATCTTTTCGAGTGCTTGTTCGAGAACTACGATCTTTGGCTCTAGAACTGAACCATTTCCTTGTATCTCAGAAGAACTTCCAGGTTAATAGGGAAGAAGTTTGA
sEQ ID No:5:wild-rice ( oryza rufipogon) rpoBgene order (Genbank sequence number: OrruC_p010)
ATGCTCCGGAATGGAAATGAGGGAATGTCCACAATACCCGGATTTAGTCAGATCCAATTCGAGGGATTTTGTAGGTTCATTAATCAAGGCTTGGCAGAAGAACTTGAGAAGTTTCCAACAATTAAAGATCCAGATCACGAAATTTCATTTCAATTATTTGCGAAAGGATATCAATTGCTAGAACCTTCGATAAAAGAAAGGGATGCTGTGTATGAATCACTCACCTATTCTTCCGAATTATACGTATCCGCGCGATTAATTTTTGGTTTCGATGTGCAAAAGCAAACCATTTCTATTGGAAACATTCCTATAATGAATTCCTTAGGAACCTTTATAATAAATGGAATATACCGAATTGTGATCAATCAAATATTGCTAAGTCCTGGTATTTACTACCGCTCGGAATTAGACCATAAAGGAATTTCTATCTACACCGGGACTATAATATCAGATTGGGGAGGAAGATCGGAATTAGCAATTGATAAAAAAGAAAGGATATGGGCTCGCGTGAGTAGAAAACAAAAGATATCTATTCTAGTTCTATCATCAGCTATGGGTTCAAATCTAAAAGAAATTCTAGATAATGTTTCCTACCCTGAAATTTTCTTGTCTTTCCCTAATGCTAAGGAGAAGAAGAGGATTGAGTCAAAAGAAAAAGCTATTTTGGAGTTTTATCAACAATTTGCTTGTGTAGGTGGGGACCTGGTATTTTCGGAATCCTTATGTGAGGAATTACAAAAGAAATTTTTTCAACAAAAATGTGAATTAGGAAGGATTGGTCGACGAAATATGAATCGAAGACTGAATCTTGATATACCTCAGAACAGCACCTTCTTGTTACCGCGAGATGTATTGGCCGCTACGGATCATTTGATTGGAATGAAATTTGAAACGGGTATACTTGACGATGACGATATGAATCACTTGAAAAATAAACGTATTCGTTCGGTTGCGGATCTGTTACAAGATCAATTCGGACTGGCTCTTGGTCGTTTACAACATGCGGTTCAAAAAACTATCCGTAGAGTATTCATACGTCAATCAAAACCGACTCCACAAACTTTGGTAACTCCAACTTCAACCTCGATTTTATTAATAACTACTTACGAGACCTTCTTTGGTACATATCCCTTATCTCAAGTTTTTGATCAAACCAATCCATTGACACAAACGGTTCATGGGCGAAAAGTGAGTTGTTTGGGTCCTGGAGGATTGACGGGGAGAACTGCAAGTTTTCGGAGCCGAGATATCCATCCGAGTCACTATGGGCGTATTTGTCCAATTGACACGTCCGAAGGAATCAACGTTGGACTTACTGGATCTTTAGCTATTCATGCGAGAATTGATCATTGGTGGGGATCCGTAGAGAGTCCATTTTATGAAATATCTGAGAAAGCAAAGAAAAAAAAAGAGAGACAGGTGGTTTATTTATCACCAAATAGAGATGAGTATTATATGATAGCAGCAGGAAATTCTTTGTCCTTGAATCGGGGTATTCAGGAAGAACAGGTTGTTCCAGCTAGATACCGTCAAGAATTCCTGACTATTGCATGGGAACAGATTCATGTTAGAAGTATTTTTCCTTTCCAATATTTTTCTATTGGGGGTTCTCTCATTCCTTTTATTGAGCATAATGATGCGAATCGAGCTTTAATGAGTTCTAATATGCAGCGCCAAGCAGTTCCGCTTTCTCGGTCCGAGAAGTGCATTGTTGGAACTGGATTGGAACGCCAAACAGCTCTAGATTCGAGGGTTTCTGTTATAGCCGAACGCGAGGGAAAGATCATTTCTACTAATAGTCACAAGATCCTTTTATCAAGTAGTGGGAAGACTATAAGTATTCCTTTAGTTACCCATCGGCGCTCTAACAAAAATACTTGTATGCACCAAAAACCTCGGGTTCCGCGGGGTAAATCCATTAAAAAAGGACAAATTTTAGCGGAGGGGGCTGCTACGGTTGGTGGGGAACTTGCTTTAGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGACGCAGTATTAATTAGCGAACGTTTGGTATATGAGGATATTTATACTTCTTTTCACATCCGAAAATATGAAATTCAGACGGATACAACAAGCCAAGGCTCCGCTGAAAAAATCACTAAAGAAATACCACATCTAGAAGAACATTTACTCCGCAATTTGGACAGAAATGGAGTTGTGAAGTTGGGGTCCTGGGTAGAAACAGGCGATATTTTAGTAGGTAAATTAACGCCTCAGATAGCGAGCGAATCGTCCTATATCGCGGAAGCTGGATTATTACGGGCCATATTTGGTCTTGAGGTATCCACTTCAAAAGAAACTTCTCTCAAACTACCGATAGGTGGAAGAGGACGCGTTATCGATGTGAAATGGATCCAGAGGGATCCCCTCGACATAATGGTTCGTGTATATATTTTACAAAAACGCGAAATCAAAGTTGGGGATAAAGTAGCCGGAAGACACGGGAATAAGGGGATCATTTCCAAAATTTTGCCTAGGCAAGATATGCCCTATTTGCAAGATGGAACGCCTGTTGATATGGTTTTCAATCCCTTAGGAGTACCCTCCCGAATGAATGTGGGACAAATATTTGAAAGCTCGCTCGGATTAGCAGGGGATCTGCTAAAGAAACATTATAGAATAGCACCCTTTGATGAGAGATATGAGCAAGAGGCTTCAAGAAAACTTGTGTTTTCAGAATTATATGAAGCCAGTAAACAAACAAAAAATCCGTGGGTATTTGAACCCGAGTACCCGGGAAAAAGCAGAATATTTGATGGAAGAACAGGAGACCCCTTCGAACAGCCTGTTCTAATAGGGAAGTCCTATATCTTAAAATTAATTCATCAAGTTGATGAGAAAATCCACGGACGCTCTACTGGGCCCTATTCACTTGTTACACAACAACCCGTTAGAGGAAGAGCCAAGCAAGGGGGACAACGAATAGGAGAAATGGAAGTTTGGGCTTTAGAAGGATTTGGTGTTGCTCATATTTTACAAGAGATACTTACTTATAAATCTGATCATCTTATAGCTCGCCAAGAAATACTTAACGCTACGATCTGGGGAAAACGAGTACCTAATCACGAGGATCCTCCAGAATCTTTTCGAGTGCTTGTTCGAGAACTACGATCTTTGGCTCTAGAACTGAACCATTTCCTTGTATCTCAGAAGAACTTCCAGGTTAATAGGGAAGAAGTTTGA。

Claims (7)

1. the HDA detection method of rice composition in cereal powdery-food, is characterized in that:
(1) from testing sample, DNA is extracted as the template detected;
(2) utilize HDA primer pair or containing the primer pair in the test kit of primer pair, carry out HDA reaction, obtain amplified production;
(3) detect amplified production, and judge.
2. the HDA detection method of rice composition in a kind of cereal powdery-food according to claim 1, it is characterized in that, described primer pair sequence is:
SEQ ID No：1：5’-AGCACCTTCTTGTTACCGCG-3’；
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’；
Described primer pair is synthesized by Shanghai Sheng Gong biotechnology company limited.
3. the HDA detection method of rice composition in a kind of cereal powdery-food according to claim 1, it is characterized in that, described HDA reaction system is: the 10 × damping fluid of 5 μ L, the ATP of 0.2 μm of ol, the dNTPs of 0.1 μm of ol, 10 U Bst polymerase, 5 μ g RecA albumen, 0.2 μ g UvrD helicase, 25 μMs of trehaloses, the upstream primer of 10 μm of ol/L of 2 μ L, the downstream primer of 10 μm of ol/L of 2 μ L, the sample gene group DNA of 2 μ L, uses ddH 2o mends to 50 μ L.
4. the HDA detection method of rice composition in a kind of cereal powdery-food according to claim 1, it is characterized in that, described HDA reaction method is: reaction system is put into 60-70 oconstant-temperature amplification 2h in C constant-temperature metal bath.
5. the HDA detection method of rice composition in a kind of cereal powdery-food according to claim 1, it is characterized in that: described detection amplified production to judge be adopt the method for agarose gel electrophoresis to carry out, occur that namely the specific amplification band of about 205 bp is judged as detecting rice composition.
6. the HDA detection kit of rice composition in a cereal powdery-food, it is characterized in that: the described test kit for detecting rice composition from cereal powdery-food comprises 10 × damping fluid, ATP, dNTPs, Bst polymerase, RecA albumen, UvrD helicase, trehalose, HDA primer pair, positive control dna and ddH 2o.
7. the HDA detection kit of rice composition in described a kind of cereal powdery-food according to claim 6, is characterized in that: described HDA primer pair sequence is:
SEQ ID No：1：5’-AGCACCTTCTTGTTACCGCG-3’；
SEQ ID No：2：5’-GAACCGCATGTTGTAAACGA-3’；
Described primer pair is synthesized by Shanghai Sheng Gong biotechnology company limited.
CN201510380048.4A 2015-06-27 2015-06-27 HDA detection method and reagent kit for rice ingredients in grain powder food Pending CN104894287A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510380048.4A CN104894287A (en) 2015-06-27 2015-06-27 HDA detection method and reagent kit for rice ingredients in grain powder food

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510380048.4A CN104894287A (en) 2015-06-27 2015-06-27 HDA detection method and reagent kit for rice ingredients in grain powder food

Publications (1)

Publication Number Publication Date
CN104894287A true CN104894287A (en) 2015-09-09

Family

ID=54027238

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510380048.4A Pending CN104894287A (en) 2015-06-27 2015-06-27 HDA detection method and reagent kit for rice ingredients in grain powder food

Country Status (1)

Country Link
CN (1) CN104894287A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060057572A1 (en) * 2002-02-15 2006-03-16 Nisshin Seifungroup Inc. Method of testing food
CN104593521A (en) * 2015-03-03 2015-05-06 河北省食品检验研究院 HDA primers for identifying sweet potato plant-derived ingredients in processed food and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060057572A1 (en) * 2002-02-15 2006-03-16 Nisshin Seifungroup Inc. Method of testing food
CN104593521A (en) * 2015-03-03 2015-05-06 河北省食品检验研究院 HDA primers for identifying sweet potato plant-derived ingredients in processed food and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
赵红敬: "重要水稻资源分子查验技术研究", 《中国优秀硕士学位论文全文数据库》 *

Similar Documents

Publication Publication Date Title
CN103397101B (en) A kind of fluorescent marker gene composite amplification method simultaneously identifying goat, sheep, pig and duck source property
CN104774958A (en) Primer probe composition for identifying sources of animals including donkeys, horses and foxes, kit and multiplex real-time fluorescence quantitative PCR detecting method
CN104498597A (en) Multiplex PCR rapid detection method for common contraindicant ingredients in muslem food
CN103361422A (en) Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof
CN104017859A (en) Method for identifying sugarcane germplasm resources based on SSR (Simple Sequence Repeats) and CE (capillary electrophoresis) technique
Wei et al. Development of a single-tube nested PCR-lateral flow biosensor assay for rapid and accurate detection of Alternaria panax Whetz
CN109913565A (en) A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method
CN106636441A (en) Probe for detecting mutation of gene ALDH2, as well as application thereof and kit
CN109136389A (en) A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach
CN111850134A (en) Specific forward and reverse primers and probe for rainbow trout, detection kit and application of specific forward and reverse primers and probe
CN114438214A (en) Colorectal cancer tumor marker and detection method and device thereof
CN113621734B (en) Molecular marker primer combination for rapidly identifying super-large fruit type characters of waxberries and application thereof
CN108103220B (en) High-flux transgenic element screening detection method
CN114231665A (en) Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof
CN108949929A (en) For detecting the product and its methods and applications of MTHFR and MTRR gene pleiomorphism simultaneously
CN106811514A (en) Soft-shelled turtle subfamily biotic component specificity real-time fluorescence detection method and its kit
CN107723362A (en) For detecting primer, probe and the kit of 1,675 1681 mutation of C KIT genes
CN107630089A (en) For detecting primer, probe and the kit of the mutation of C-KIT gene 1689-1718 positions
CN102559919B (en) Real-time PCR (Polymerase Chain Reaction) detection method of buffalo components in food and feed
CN106319035A (en) Primer, probe and kit for detection of C-KIT gene mutation
CN104894287A (en) HDA detection method and reagent kit for rice ingredients in grain powder food
CN108411030A (en) The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108
CN102367472A (en) Single/duplex PCR (polymerase chain reaction) detection method for botanical adding material in milk or milk powder
CN104419755A (en) Method for rapidly detecting adulteration amount of honeysuckle ingredient
CN103436601A (en) Functional marker Wx-a/b for analyzing rice Wx gene by using DNA melting temperature, use method and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20150909