CN104894272A - Molecular detection method for tea anthracnose infected leaves - Google Patents

Abstract

The invention discloses a molecular detection method for tea anthracnose infected leaves. The method is characterized in that the DNA of naturally infected leaves can be extracted by mainly adopting a fungal genomic DNA kit from the TIANGEN Co., Ltd, an ITS primer is adopted, and by PCR amplification and agarose gel electrophoresis, the bacteria carrying situation of the field can be detected by the amplification product (the fragment length is about 437 bp). According to the molecular detection method for tea anthracnose infected leaves, the specific molecular detection primer and the application thereof can be applied to quick, sensitive and specific detection of tea anthracnose infected tea leaves in production practice, and at the same time, can be applied to early diagnosis of field diseases and monitoring and identification for infected leaves, provides a reliable technical and theoretical base for prevention and control of tea anthracnose infected leaves.

Description

The molecular detecting method of the sick leaf of a kind of tea anthrax

Technical field

The invention belongs to corps diseases to detect and Prevention Technique field, be specifically related to the molecular detecting method of the sick leaf of a kind of tea anthrax.

Background technology

Tea anthrax is one of China's each tea growing areas Common Diseases, tealeaves can produce the greyish white or sorrel scab of about 1/3, often cause the underproduction of more than 5%, and dry tea profile is broken, flavour is thin out.Its pathogenic bacteria is invaded from the tea tree tender leaf back side, hide 5-20 days, illness and tea moire blight, the leaf diseases such as brown leaf spot are obscured, therefore, conventional disease screening technology based on morphological specificity is difficult to generation tea anthrax promptly and accurately being detected, thus cause this disease to be difficult to obtain prevention and control efficiently in time, from 2009, after this study group establishes the PCR authentication method of tea anthrax pathogenic bacteria, have no the direct Molecular Detection of the sick sample of nature always, therefore, set up a kind of can monitor tea anthrax leaf survive the winter and more stirring of love condition quick, accurate detection technique meaning is very great.

Summary of the invention

The object of the invention is the defect for above-mentioned prior art and the molecular method that a kind of quick, accurate detection tea anthrax leaf is provided.

The technical solution adopted in the present invention is, the molecular detecting method of the sick leaf of a kind of tea anthrax, comprises the following steps:

1) sample collecting, the sick leaf sample of random acquisition tea anthrax, use deionized water rinsing blade ,-80 DEG C save backup;

2) TIANGEN company fungal genomic DNA test kit is adopted to extract leaves genomic DNA;

3) with step 2) in extract leaves genomic DNA be that template carries out specific PCR amplification;

4) pcr amplification product is carried out electrophoresis, there is specific band in 437bp place, then blade carries disease germs.

Feature of the present invention is also,

In step 3, PCR amplification system is as follows: 10 × Buffer 2.5 μ L, 25mmol/LMgCL22.0 μ L, 2.5mmol/LdNTP 1.5 μ L, upstream primer and each 20 ~ 40ng of downstream primer, leaves genomic DNA 10 ~ 40ng, Taq archaeal dna polymerase 1.0U, finally uses aseptic deionized water polishing to 25 μ L.

The gene order of upstream primer, as shown in SEQ ID NO.2, is specially: ITSF:TTACGTCCCTGCCCTTTGTA; The gene order of downstream primer, as shown in SEQ ID NO.3, is specially: ITSR:AATGTGCGTTCAAAGATTCG.

PCR response procedures in step 3 is: the first circulation 94 DEG C of denaturation 2min; Then 94 DEG C of sex change 1min, 54 DEG C of annealing 1min, 72 DEG C extend 2min, totally 35 circulations; 72 DEG C extend 10min.

Deposition condition in step 3 is: PCR primer is with electrophoretic analysis in 0.5 × tbe buffer liquid on 1.0% sepharose, and voltage is 4-5V/cm.

The invention has the beneficial effects as follows: Molecular Identification has merged the accurate quantification of spectroscopic techniques, the specificity of DNA hybridization and its susceptibility, testing in process to germ, be separated tieback to identify compare with morphologic observation and germ, can be implemented in the early stage Rapid identification not showing disease period of tea anthrax, 2 day time accurately can complete sample survey in batches, be conducive to the promptly and accurately control of disease, thus realize the effective upgrading synergy in tea place.

Accompanying drawing explanation

Fig. 1 is the electrophoretogram of primer of the present invention specific amplified under 54 DEG C of annealing temperatures, wherein, and M:Marker2000; 1: tea anthrax bacteria 1 (ACT primer); 2: tea anthrax bacteria 2 (ACT primer); 3: sick leaf-ITS-botanical agents box (ITS primer, 437bp);

Fig. 2 is that the check order evolutionary tree of product and comparison 4 sequences of the present invention builds.

Embodiment

Below in conjunction with embodiment, the present invention is described in detail.

The invention provides a kind of tea anthrax leaf molecular detecting method, comprise the following steps:

1. the special design of primers of tea anthrax leaf detection

According to the characteristic of tea anthrax leaf DNA sequence dna, synthesize the pair of primers to the effect of tea anthrax leaf tool specific amplified: ITSF:TTACGTCCCTGCCCTTTGTA, ITSR:AATGTGCG TTCAAAGATTCG;

2. the foundation of tea anthrax leaf detection system

(1) TIANGEN company fungal genomic DNA test kit is adopted to extract the STb gene infecting tea anthrax blade.

(2) pcr amplification, 25 μ L reaction systems are put into successively respectively in PCR thin-walled tube: 10 × Buffer2.5 μ L, 25mmol/LMgCL22.0 μ L, 2.5mmol/LdNTP 1.5 μ L, upstream primer and each 20 ~ 40ng of downstream primer, leaves genomic DNA 10 ~ 40ng, Taq archaeal dna polymerase 1.0U, finally use aseptic deionized water polishing to 25 μ L.Centrifugal 10sec, puts into PCR instrument by PCR thin-walled tube and increases.Amplification condition is: the first circulation 94 DEG C of denaturation 2min; Then 94 DEG C of sex change 1min, 54 DEG C of annealing 1min, 72 DEG C extend 2min, totally 35 circulations; 72 DEG C extend 10min polishing end, and amplification completes.

(3) PCR primer is with electrophoretic analysis in 0.5 × tbe buffer liquid on 1.0% sepharose, and voltage is 4-5V/cm, and electrophoresis terminates rear gel imaging system analysis, and as shown in Figure 1, specific band appears in 437bp place, then blade carries disease germs.

The primer of the present invention has very high specificity to tea anthrax leaf, can be used in the detection of the tea anthrax distinguishing tea anthrax leaf.

Embodiment 1

1, sample collecting

On August 22nd, 2014, the sick leaf sample of Pingjiang county Hunan province random acquisition 300 strain.Deionized water rinsing blade ,-80 DEG C save backup.

2, tea anthrax leaf detects

(1) TIANGEN company fungal genomic DNA test kit is adopted to extract leaves genomic DNA.

(2) pcr amplification, 50 μ L reaction systems are put into successively respectively in PCR thin-walled tube: each 1 μ L of 10 × Taq Buffer 5 μ L, 10mMdNTP 1 μ L, 10uM upstream primer and 10uM downstream primer, leaves genomic DNA 10ng, 2U/ μ L Taq archaeal dna polymerase 1 μ L, finally use aseptic deionized water polishing to 50 μ L.After mixing, PCR thin-walled tube is put into PCR instrument to increase.PCR thin-walled tube is put into PCR instrument increase.Amplification condition is: the first circulation 94 DEG C of denaturation 2min; Then 94 DEG C of sex change 1min, 54 DEG C of annealing 1min, 72 DEG C extend 2min, totally 35 circulations; 72 DEG C extend 10min polishing end, and amplification completes.

(3) PCR primer is with electrophoretic analysis in 0.5 × tbe buffer liquid on 1.0% sepharose, and voltage is 4-5V/cm, and electrophoresis terminates rear gel imaging system and analyzes.

3, detected result

Have 3 strain samples and occur a special band at 437bp, its recall rate is 1.33%, this result and tea anthrax leaf in 2003 survive the winter before the result generally investigated of field, the bacterium source state of an illness basically identical, this shows that this detection system can monitor the field Carriage of bacterium seedbed band tea anthrax leaf of surviving the winter in early days.

4, utilize precious biotech firm pMDTM19-T carrier to carry out the clone of PCR primer, method is with reference to pMDTM19-T carrier specification sheets.Select the clone that Insert Fragment length is consistent with cloned sequence length, deliver Hua Da biotech firm sequencing analysis, sequence is as SEQ ID NO.1.Blast program is utilized to search for correlated series from GenBank mensuration gained sequence, in Mega6.0 software, constructing system tree carries out taxonomic identification respectively, the results are shown in Figure 2, according to Fig. 2, the PCR specific amplified sequence that the present invention obtains and anthrax bacteria belong to same kind.

Claims (5)

1. a molecular detecting method for the sick leaf of tea anthrax, is characterized in that, comprise the following steps:

1) sample collecting, the sick leaf sample of random acquisition tea anthrax, use deionized water rinsing blade ,-80 DEG C save backup;

2) TIANGEN company fungal genomic DNA test kit is adopted to extract leaves genomic DNA;

3) with step 2) in extract leaves genomic DNA be that template carries out specific PCR amplification;

4) pcr amplification product is carried out electrophoresis, there is specific band in 437bp place, then blade carries disease germs.

2. the molecular detecting method of the sick leaf of tea anthrax according to claim 1, it is characterized in that, in described step 3, PCR amplification system is as follows: 10 × Buffer 2.5 μ L, 25mmol/LMgCL22.0 μ L, 2.5mmol/LdNTP 1.5 μ L, upstream primer and each 20 ~ 40ng of downstream primer, leaves genomic DNA 10 ~ 40ng, Taq archaeal dna polymerase 1.0U, finally uses aseptic deionized water polishing to 25 μ L.

3. the molecular detecting method of the sick leaf of tea anthrax according to claim 2, it is characterized in that, the gene order of described upstream primer, as shown in SEQ ID NO.2, is specially: ITSF:TTACGTCCCTGCCCTTTGTA; The gene order of downstream primer, as shown in SEQ ID NO.3, is specially: ITSR:AATGTGCGTTCAAAGATTCG.

4. the molecular detecting method of the sick leaf of tea anthrax according to claim 1, it is characterized in that, the PCR response procedures in described step 3 is: the first circulation 94 DEG C of denaturation 2min; Then 94 DEG C of sex change 1min, 54 DEG C of annealing 1min, 72 DEG C extend 2min, totally 35 circulations; 72 DEG C extend 10min.

5. the molecular detecting method of the sick leaf of tea anthrax according to claim 1, it is characterized in that, the deposition condition in described step 3 is: PCR primer is with electrophoretic analysis in 0.5 × tbe buffer liquid on 1.0% sepharose, and voltage is 4-5V/cm.