CN104887717B

CN104887717B - A kind of immune enhancing agents

Info

Publication number: CN104887717B
Application number: CN201510298011.7A
Authority: CN
Inventors: 季平; 李凡池; 于继彬
Original assignee: Love Hong Biomedical Technology (suzhou) Co Ltd
Current assignee: Aikangde Biotechnology (Suzhou) Co.,Ltd.
Priority date: 2015-06-04
Filing date: 2015-06-04
Publication date: 2019-05-31
Anticipated expiration: 2035-06-04
Also published as: CN104887717A

Abstract

The invention discloses a kind of immune enhancing agents, the AAV virus including carrying immunologic test point antibody molecule encoding gene；Immunologic test point is one of PD-1, PD-L1, CTLA-4 or several.The present invention is combined with each other using the AAV virus for carrying different immunologic test point antibody molecule encoding genes, by infecting the immunocytes such as T cell, natural killer cells, cytotoxic T lymphocyte or cytokine induced kill cell in vitro；Infected immunocyte expresses the antibody for secreting these immunologic test points after being fed back to neoplastic disease human body, to the combination of blocking immunity checkpoint receptor and its ligand, effective blocking immunity inhibits signal transmitting, destroy immune tumor suppression microenvironment, the killing ability for improving immunocyte, to improve the curative effect of adoptive immunotherapy.

Description

A kind of immune enhancing agents

Technical field

The invention belongs to fields of biomedicine, and in particular to a kind of immune enhancing agents can improve immune thin in vitro Activation, proliferation and the cytokine release ability of born of the same parents.

Background technique

By the adjusting of many surface molecular precisions, some promotion immune cell activations during immune cell activation；Have It is then Inhibitory receptor molecule, is responsible for transmitting and inhibits signal, to prevent immune system overactivity.These stimulations inhibit immune Switch molecule etc. is immunized in the molecule of cell-stimulating, commonly known as immunologic test point or immunologic test point molecule.

Immunologic test point includes Cytotoxic T lymphocyte associated antigen-4 (cytotoxic T lymphocyte- Associated antigen-4, CTLA-4) and programmed death receptor 1 and its ligand (programmed death 1, PD- 1/PD-L1) signal path molecule and PD-L2, IDO-1, IDO-2, KIR, OX40, CD70, LAG-3, TIM3 etc..CTLA-4 is The important lower regulatory factor of T cell activation.During T cell activation, CTLA-4 is by inhibiting interleukins-in nucleus 2(interleukin-2, IL-2) gene transcription and directly inhibit the cell cycle some key components expression to pressing down The activation and proliferation of T cell processed.And PD-1/PD-L1 signal path also plays negative immune adjustment effect.Research has shown that, Tumor cell surface is high extensively to express PD-L1 molecule.After PD-1 and PD-L1 when T cell surface are coupled, it can lead to T cell born of the same parents The tyrosine residue phosphorylation of the immunity receptor Tyrosine Inhibitory Motifs structural domain in matter area, can raise phosphatase protein tyrosinase 2 and protein-tyrosine enzyme 1, not only can blocks cellular extracellular signal-regulated kinase activation, can also block phosphatidyl-inositol 3-kinase With the activation of serine-threonine protein kinase enzyme, the final secretion for inhibiting T lymphocyte proliferation and relevant cell factor.Meanwhile Cytokine interleukin 2(IL-2), interferon gamma secretion also reduce.

It, can not by the intracorporal immune system of patient itself since tumour patient vivo immuning system monitoring balance is destroyed Effectively remove tumour cell.Therefore by feeding back the self or alloimmune effector cell for activating and expanding in vitro to tumour Patient's body, make its play in vivo killing tumor cell effect adoptive immunity cell therapy be able in clinic it is prevailing, Such as including common immune cell therapy method: cytokine induced kill cell (CIK) therapy, DC joint CIK cell are treated Method, natural killer cells (NK) therapy, neoplasm invasiveness cell therapy (TIL), cytotoxic T lymphocyte (CTL) tumor target To therapy etc..

But tumour cell has developed many mechanism to inhibit the antineoplastic immune activity of body.Tumor microenvironment is exempted from Epidemic disease inhibits main and inhibits signal to be regulated and controled by premunition checkpoint between tumour cell and immunocyte.Due to tumor patient Intracorporal immunosupress microenvironment, so that the immunocyte of these Activation In Vitros still can not overcome intracorporal exempt from after feeding back in vivo Epidemic disease inhibiting effect, therefore adoptive immunotherapy embodies the low-down limitation of its curative effect in a large amount of clinical test and application (Trajanoski Z, Maccalli C, Mennonna D, Casorati G, Parmiani G, Dellabona P (2015) Somatically mutated tumor antigens in the quest for a more efficacious patient-oriented immunotherapy of cancer. Cancer immunology, immunotherapy : CII 64:99-104).

Therefore, it is necessary to research and develop a kind of effective immunoreagent, the immune negative regulation that closing immunologic test point mediates, resistance Disconnected immunosupress signal transmitting improves the activation of the immunocyte for separating and expanding in vitro from patient blood, proliferation and thin Intracellular cytokine releasability, and further killing tumor cell, to promote adoptive immunotherapy to obtain substantial effect.

Summary of the invention

The object of the present invention is to provide a kind of immune enhancing agents of raising immune cell activation killing tumour function, can be with Joint closes the coinhibitory signals access that one or more immunologic test points mediate, and increases the activation of immunocyte, proliferation and thin Intracellular cytokine releasability effectively prevent the immunosupress of tumour cell, thus what raising was separated and expanded from blood samples of patients Ability of the immunocyte to tumor-killing.

To achieve the above object of the invention, the technical solution adopted by the present invention is a kind of immune enhancing agents, including carries and exempt from The AAV virus of epidemic disease checkpoint antibody molecule encoding gene, the AAV virus for carrying immunologic test point antibody molecule encoding gene In, immunologic test point is one of PD-1, PD-L1, CTLA-4 or several.The present invention utilizes the different immunologic test points of carrying The AAV virus of antibody molecule encoding gene is combined with each other, by infecting T cell, natural killer cells, cytotoxic T in vitro The immunocytes such as lymphocyte or cytokine induced kill cell；Infected immunocyte is fed back to neoplastic disease human body It is interior, and the antibody of secretory immune checkpoint is expressed, so that the combination of blocking immunity checkpoint receptor and its ligand, effectively blocks and exempts from Epidemic disease inhibits signal transmitting, improves the activation of immunocyte, the ability of proliferation and secrete cytokines, destroys immune tumor suppression Microenvironment, improves the killing ability of immunocyte, to improve the curative effect of adoptive immunotherapy.The tumour cell that the present invention is directed to Immunologic test point is one of PD-1, PD-L1, CTLA-4, two kinds or three kinds, is not interfered with from each other, common to improve The effect of immunoreagent, to effectively improve the killing ability of immunocyte.

In above-mentioned technical proposal, the amino acid sequence of the PD-1 antibody molecule heavy chain variable region be SEQ ID NO:1 or Person SEQ ID NO:3, the amino acid sequence of light chain variable region are SEQ ID NO:2 or SEQ ID NO:4；The PD-L1 is anti- The amino acid sequence of body molecule heavy chain variable region is SEQ ID NO:5, and the amino acid sequence of light chain variable region is SEQ ID NO: 6；The amino acid sequence of CTLA-4 antibody molecule heavy chain variable region is SEQ ID NO:7 or SEQ ID NO:9, light chain variable The amino acid sequence in area is SEQ ID NO:8 or SEQ ID NO:10.

In above-mentioned technical proposal, in the AAV virus for carrying immunologic test point antibody molecule encoding gene, PD-1 is encoded The DNA sequence dna of antibody molecule weight chain variabl area sequence is SEQ ID NO:11 or SEQ ID NO:13；Encode PD-1 antibody point The DNA sequence dna of sub- light-chain variable sequence is SEQ ID NO:12 or SEQ ID NO:14；Encode PD-L1 antibody molecule heavy chain The DNA sequence dna of variable region sequences is SEQ ID NO:15；Coding PD-L1 antibody molecule light-chain variable sequence DNA sequence dna be SEQ ID NO:16；The DNA sequence dna for encoding CTLA-4 antibody molecule weight chain variabl area sequence is SEQ ID NO:17 or SEQ ID NO:19；The DNA sequence dna for encoding CTLA-4 antibody molecule light-chain variable sequence is SEQ ID NO:18 or SEQ ID NO:20。

In the present invention, carry in the AAV virus of immunologic test point antibody molecule encoding gene, entrained DNA fragmentation is compiled The correspondence immunologic test point antibody molecule that code obtains is that scFv segment, Fab segment or overall length are anti-there may also be diversified forms Body.These molecular forms can be combined with corresponding immunosupress signal path, blocking immunity on immunocyte or tumour cell Combination between checkpoint and its ligand, to block the transmitting of tumour immunity inhibition signal.

In above-mentioned technical proposal, immune enhancing agents further include physiological saline or the buffer of PBS；Those skilled in the art Member can according to need addition.

The invention also discloses a kind of Immune-enhancing effect systems, by above-mentioned carrying immunologic test point antibody molecule encoding gene It is thin that AAV virus infects T cell, natural killer cells, cytotoxic T lymphocyte or cytokine-induced killer cell in vitro Born of the same parents are prepared, specially to containing T cell, natural killer cells, cytotoxic T lymphocyte or cytokine induction The AAV virus that above-mentioned carrying immunologic test point antibody molecule encoding gene is added in the culture medium of cell is killed, it must after culture To Immune-enhancing effect system, can be fed back in patient body；In patient body, infected immunocyte is anti-by secreting, expressing Body molecule, in conjunction with immunologic test point, the coinhibitory signals access of closing immunologic test point mediation.In conjunction with antigen molecule can To be the immunologic test point molecule on immunocyte surface, other participations for being also possible to tumour cell or other cell surfaces are immune The immunologic test point molecule of inhibition or immune activation.

The present invention also provides a kind of methods of external enhancing immune cells factor releasability, including following step Suddenly, the culture of Xiang Hanyou T cell, natural killer cells, cytotoxic T lymphocyte or cytokine induced kill cell The AAV virus that above-mentioned carrying immunologic test point antibody molecule encoding gene is added in base, is infected and is cultivated, by feeding back cell The immunocyte of factor releasability enhancing improves the activation of immunocyte, the energy of proliferation and secrete cytokines to human body Power can preferably kill tumour cell.

Immune cell media contains cell factor and other nutritional ingredients, can support immune cell growth and amplification Liquid can be used for the culture of all kinds of immunocytes such as T cell, CIK, NK.For example CIK cell culture uses basal medium such as The PBMC cell that the processing of RPMI1640 culture solution is separated from blood is subject to CD3 into culture solution after INF- γ stimulation again later Monoclonal antibody, interleukin 2 culture finally can be obtained CIK cell with the culture solution culture containing IL-2；The training of NK cell Base is supported using basal medium such as RPMI1640 and adds adhesion factor, IL-2, the cellular immunities factor such as IL-4, IL-12 etc., There are stronger stimulation or maturing to the growth of NK cell, the killing activity of activating immune cell can be improved；Human peripheral blood Lymphocytes culture medium is mainly by RPMI1640, potassium penicillin G, streptomycin sulphate, cow's serum, phytohemagglutinin (PHA) composition such as.

The AAV virus meeting infection immunity cell of immunologic test point antibody molecule encoding gene is carried, and carries out expression carrying Immunologic test point antibody molecule, infect into immunocyte virus will not self packaging or amplification generate there is infection ability Progeny virus.

The AAV virus of carrying immunologic test point antibody molecule encoding gene of the invention is prepared by the following steps:

(1) DNA sequence dna of composite coding immunologic test point antibody molecule heavy chain overall length and light chain overall length, through sequence verification After correct, heavy chain DNA fragmentation, light chain DNA fragments are obtained by polymerase chain reaction amplification；

(2) using the heavy chain DNA fragmentation of step (1), light chain DNA fragments as purpose segment, for the purpose of pAAV-MCS-IRES Carrier successively clones heavy chain DNA fragmentation and light chain DNA fragments into above-mentioned carrier, and final sequence verification is correctly wrapped afterwards Adeno-associated virus plasmid containing total length heavy chain and full-length light chains DNA molecular；

(3) into the HEK293 cell of culture, the adeno-associated virus plasmid of transfection procedure (2) carries out disease by conventional methods Poison packaging amplification after collecting cell lysate supernatant later, carries out column purification and obtains carrying immunologic test point antibody molecule coding The AAV virus of gene；

(4) preparation of immune enhancing agents；The different immunologic test point antibody molecules of the carrying that step (3) are obtained encode base In one of AAV virus of cause or several addition physiological saline or PBS buffer solution, immune enhancing agents are obtained.

In immune enhancing agents of the invention, can individually comprising carry PD-1 antibody molecule encoding gene AAV virus, It carries the AAV virus of PD-L1 antibody molecule encoding gene or carries the AAV virus of CTLA-4 antibody molecule encoding gene；? It may include two kinds therein or three kinds.When the AAV virus for carrying immunologic test point antibody molecule encoding gene is to carry PD- When the AAV virus of 1 antibody molecule encoding gene is with the AAV virus for carrying CTLA-4 antibody molecule encoding gene, it is anti-to carry PD-1 The virion quantity ratio of the AAV virus of the AAV virus and carrying CTLA-4 antibody molecule encoding gene of body molecule encoding gene For (6~3): 1；When the AAV virus for carrying immunologic test point antibody molecule encoding gene is to carry PD-L1 antibody molecule to encode base When the AAV virus of cause is with the AAV virus for carrying CTLA-4 antibody molecule encoding gene, PD-L1 antibody molecule encoding gene is carried AAV virus and carry CTLA-4 antibody molecule encoding gene AAV virus virion quantity ratio be (6~3): 1；When taking AAV virus with immunologic test point antibody molecule encoding gene is the AAV virus for carrying PD-1 antibody molecule encoding gene, carries When the AAV virus of PD-L1 antibody molecule encoding gene is with the AAV virus for carrying CTLA-4 antibody molecule encoding gene, PD- is carried The virion quantity of the AAV virus of the AAV virus and carrying PD-L1 antibody molecule encoding gene of 1 antibody molecule encoding gene Virion quantity ratio with the AAV virus for carrying CTLA-4 antibody molecule encoding gene is (6~3): 1.If carrying CTLA- The virion excessive number of the AAV virus of 4 antibody molecule encoding genes, then be easy to produce stronger side reaction.

The present invention utilizes the external overall length synthetic method of chemistry, the heavy chain DNA of composite coding immunologic test point antibody molecule Molecule full length sequence and light chain DNA molecular full length sequence.Immunologic test point antibody heavy chain molecules include signal peptide, heavy chain variable region And heavy chain constant region, light chain molecule include signal peptide, light chain variable region and constant region of light chain；Corresponding coded sequence is respectively to believe Number Peptide D NA sequence, heavy chain variable region DNA sequence dna, heavy chain constant region DNA sequence dna, light chain variable region DNA sequence dna and constant region of light chain DNA sequence dna.Referring to sequence table, heavy chain variable region DNA sequence dna and light chain variable region DNA sequence dna are SEQ ID NO:11- SEQ ID NO:20 amounts to 10, and signal peptide DNA sequence dna is SEQ ID NO:21, and heavy chain constant region DNA sequence dna is SEQ ID NO:22, gently Chain constant region DNA sequences are SEQ ID NO:23.

Respectively according to signal peptide, variable region and amino acid constant region sequence, three segment DNAs of its amino acid sequence of composite coding Sequence, and overlapping PCR method is utilized, it is spliced into the heavy chain and light chain DNA overall length of overall length.By every full length DNA sequence difference gram It is grand into pUC18-T carrier, after sequence verification is correct, obtain recombinant cloning vector plasmid；With above-mentioned recombinant cloning vector matter Grain is that template carries out polymerase chain reaction (PCR) amplification, recycles PCR product, respectively obtains encoding immune checkpoint antibody point The heavy chain and light chain full length DNA segment of son.

Take above-mentioned be mutually paired a heavy chain full length DNA segment and a light chain full length DNA segment.To heavy chain overall length DNA fragmentation, purpose carrier pAAV-MCS-IRES carry out XhoI-BglII double digestion respectively；By after digestion heavy chain DNA fragmentation with Linear purpose carrier prepares T4 coupled reaction system, and 16 DEG C of connections are overnight；Then 10 μ L connection reaction products is taken to convert to Stbl3 In E. coli competent, after monoclonal colonies are grown, chooses 3-5 monoclonal colonies and carry out shaking bacterium expansion culture；Finally make Plasmid, which is extracted, with the small extraction reagent kit of plasmid and carries out sequence verification correctly obtains the recombination positive plasmid for carrying heavy chain DNA fragmentation afterwards pAAV-Heavy；

It is bis- that BstBI-SalI is carried out respectively to above-mentioned light chain full length DNA segment and above-mentioned recombination positive plasmid pAAV-Heavy Digestion, recycling digestion products respectively obtain the light chain DNA fragments after digestion and digestion carrier；By the light chain DNA piece after digestion Section prepares T4 coupled reaction system with digestion carrier, and 16 DEG C of connections are overnight；Then connection product is taken to convert to Stbl3 Escherichia coli In competence, after monoclonal colonies are grown, chooses 3-5 monoclonal and carry out shaking bacterium expansion culture；Finally examination is proposed using plasmid is small Agent box extracts plasmid and carries out sequence verification correctly obtains the adeno-associated virus plasmid for carrying heavy chain and light chain DNA molecular afterwards pAAV-IgG；

It repeats the above steps, so that the adeno-associated virus plasmid of three groups of carrying heavy chains and light chain DNA molecular is obtained, it is right respectively Answer different immunologic test point molecules.

HEK293 suspension cell is cultivated in the Freestyle293 culture medium of serum-free, maintenance cell density is 4x10⁵ ~3x10⁶A cell/mL；First 1 day of transfection, adjustment cell density are 1x10⁶Cell/mL；It is heavy to be then centrifuged for processing collection cell It forms sediment, cell precipitation is resuspended with culture medium, adjustment cell density is 3x10⁶A cell/mL；Add according to the amount of final concentration of 3 μ g/mL In addition the adeno-associated virus plasmid for carrying heavy chain and light chain DNA molecular is stated, shaking table oscillation；Then according to final concentration of 9 μ g/mL's Amount adds PEI, and shaken cultivation is stayed overnight on shaking table；Then culture medium diluting cells are added, continue culture 3 days；Cultivating system is centrifuged, After collecting cell precipitation, cell precipitation is resuspended with PBS, the all-round nuclease of final concentration to 5U/mL is added after freeze thawing three times (Benzonase Nuclease), 37 DEG C of incubation 1h；Last centrifugal treating, draws supernatant, and progress column purification obtains carrying immune The AAV virus of checkpoint antibody molecule encoding gene.

Adeno-associated virus (Adreno-Associated Virus, AAV) according to the present invention is Parvoviridae (Parvoviridae) one of the member of family.This family member be it is a kind of it is small, without envelope and there is icosahedral structure of virus Virus.The diameter of virion between 20~26nm, containing size 4.7kb or so linear single stranded DNA genome. AAV is a kind of defective virus, its duplication and proliferation depend on the presence of helper virus.AAV cannot be independently duplicated, only exists In the presence of helper virus (such as adenovirus, herpes simplex virus, vaccinia virus), duplication and cytolytic infection just can be carried out, it is no Lysogenicity latent infection can only then be established.Without containing helper virus pollution, AAV serotype I-IV and replication defective It is I grades (most safe) that type, which recombinates AAV and is assessed as biological safety level by NIH and FDA,.

Immune enhancing agents of the invention through infection to T cell, natural killer cells, cytotoxic T lymphocyte or In cytokine induced kill cell, the activation of immunocyte, the ability of proliferation and secrete cytokines are improved, that is, is enhanced The killing ability of immunocyte.The immunocyte of killing ability enhancing is fed back to human body, can express blocking immunity and inhibit signal The antibody of transmitting can further increase immunological effect, and immunocyte is preferably identified and kills tumour cell.

Immune enhancing agents of the invention, the application of Immune-enhancing effect system are self in vitro or allogeneic adoptive immunity tumour is controlled It treats, the tumor type for the treatment of includes neoplastic hematologic disorder (such as leukaemia, lymphoid malignancy) and benign and malignant solid tumor；It is real The example of body tumor such as sarcoma and cancer includes embryonal-cell lipoma, celiothelioma, outstanding Yin Shi tumour, colon cancer, lymphoid malignancy, pancreas Cancer, breast cancer, lung cancer, oophoroma, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal-cell carcinoma, gland cancer, syringocarcinoma, first Shape gland cephaloma, papillary thyroid carcinoma, bronchiolar carcinoma, clear-cell carcinoma, hepatoma, cholangiocarcinoma, cervix cancer, testis are swollen Tumor, seminoma, bladder cancer, melanoma and CNS tumour.

Since above-mentioned technical proposal is used, compared with the prior art, the present invention has the following advantages:

(1) present invention prepares the recombinant adeno-associated virus for carrying immunologic test point antibody molecule encoding gene for the first time, uses it The immunocyte for infecting cultured and amplified in vitro makes it express immunologic test point antibody molecule, to close one or more The immune negative regulation that mediates of immunologic test point, improve the activation of immunocyte, the ability of proliferation and secrete cytokines, it is real The sustained activation of existing immunocyte.

(2) present invention is transported the encoding gene of antibody to immunocyte using AAV, then is fed back in patient body, is passed through Immunocyte carries out long-term expression antibody, can be realized the long-term effect after antibody enters in vivo, overcomes and directly adopt biological work Journey means obtain recombinant antibodies half-life period shorter problem in vivo, substantially prolong it and close immunologic test point and respective ligand In conjunction with effect increase the curative effect to tumour to improve the immune function of immunocyte.

(3) gene of present invention removal wild type AAV virus, only retains both ends ITR sequence, and removal AAV is integrated into human body The characteristic of chromosome, building recombination AAV can be to avoid the possible tumor suppressor gene inactivation of random integration and protooncogene activation Potentially danger, to further substantially increase its safety.

(4) present invention discloses that immune enhancing agents are motivated, and means are efficient, and raw material sources are extensive, at low cost, and is convenient for Storage and transport control convenient for industrialization production and quality；It uses in therapeutic process of adopting, can be completed in vitro, operation letter Just, substantial clinical therapeutic effect is obtained for adoptive immunotherapy to provide safeguard.

Detailed description of the invention

Fig. 1 is adeno-associated virus plasmid construct schematic diagram；

Fig. 2 is cytokine secretion expression figure；

Fig. 3 is cytokine secretion expression figure；

Fig. 4 is cytokine secretion expression figure；

Fig. 5 is cytokine secretion expression figure；

Fig. 6 is cell cycle distribution figure；

Fig. 7 is cell genomic dna agarose gel electrophoresis figure；

Fig. 8 is Hoechst nuclei dyeing chromatic graph；

Fig. 9 is to be injected intravenously before and after adeno-associated virus of the present invention, mouse liver and renal tissues pathology slice map.

Specific embodiment

Below with reference to embodiment, the invention will be further described with attached drawing

Immune enhancing agents of the present invention, i.e., by recombinating the gene order of encoding immune checkpoint monoclonal antibody to gland On correlated virus, after infection immunity cell, the antibody of expression can close the inhibition signal path of immunologic test point mediation, thus It can directly block and negative regulation mechanism is immunized caused by these immunologic test points, effectively improve the activation of immunocyte, raising is exempted from The killing ability of epidemic disease cells against tumor cells, specific preparation process are as follows.

The building and preparation of one immune enhancing agents of embodiment

(1) according to the corresponding relationship of table 1, the heavy chain and light chain of 10 codified immunologic test point monoclonal antibodies are synthesized Full length DNA sequence.Heavy chain DNA full length sequence is by signal peptide DNA sequence dna, heavy chain variable region DNA sequence dna, heavy chain constant region DNA sequence Column composition；The DNA full length sequence of light chain is by signal peptide DNA sequence dna, light chain variable region DNA sequence dna, constant region of light chain DNA sequence dna group At particular sequence is referring to sequence table.

The corresponding amino acid sequence in 1 encoding immune checkpoint antibody molecule variable region of table, nucleotide base sequence and this hair The viral code name of bright middle building

Total includes 5 heavy chain full length DNA sequences and 5 light chain full length DNA sequences；The signal peptide area of 10 DNA sequence dnas Sequence is unanimously SEQ ID NO:21, and corresponding encoding amino acid sequence is consistent；The heavy chain constant region sequence of 5 heavy chains is consistent For SEQ ID NO:22, corresponding encoding amino acid sequence is consistent；The constant light chain sequences of 5 light chains are unanimously SEQ ID NO:23, corresponding encoding amino acid sequence are consistent.Signal peptide area, constant region amino acid sequence be the prior art.

Every full length DNA sequence is passed through to the single strain oligonucleotide for synthesizing multiple forward and reverse complementations for having overlay region respectively (Oligo) segment is spliced to form the PCR product segment of double-stranded DNA by archaeal dna polymerase chain reaction (PCR)；PCR reacts item Part: 10 μ l, 5x buffer of Oligo segment mixture, 10 μ l, 10mmol dNTP, 1 μ l, Taq archaeal dna polymerase 1ul adds ultrapure water To 50ul；PCR response procedures, 98 DEG C of initial denaturation, 1 minute, 30 circulations (98 DEG C 10 seconds, 52 DEG C 30 seconds, 72 DEG C 45 seconds), 72 DEG C Extend after five minutes, is cooled to 4 DEG C；Segment, using after gel PCR product Purification Kit, passes through T4 after gel electrophoresis DNA connection is cloned into pUC18-T carrier, after sequence verification is correct, obtains the recombinant clone for carrying correct target DNA fragment Vector plasmid can get 10 recombinant cloning vector plasmids；

Using above-mentioned recombinant cloning vector plasmid as template, in the presence of primer (SEQ ID NO:24- SEQ ID NO:27) PCR amplification is carried out respectively, prepares PCR reaction system: 10 μ L, dNTP mix of 5x PCR buffer 4 μ L, 10 μ according to such as lower volume Forward and reverse primer of M each 1 μ L, recombinant cloning vector plasmid template 50ng, 1 μ L of Taq enzyme finally supply volume to 50 with ultrapure water μL；Set following PCR response procedures, 98 DEG C of initial denaturation, 1 minute, 30 circulations (98 DEG C 10 seconds, 52 DEG C 30 seconds, 72 DEG C 45 seconds), 72 DEG C extend after five minutes, are cooled to 4 DEG C.Compound concentration is 1% agarose, and PCR reaction product is carried out agarose gel electrophoresis, 120V electrophoresis 20 minutes, according to molecular weight standard, heavy chain or the corresponding band of light chain is cut down, recycled using DNA gel Kit is recycled.PCR product is recycled, DNA fragmentation is obtained；It can get totally 10 DNA fragmentations, wherein 5 heavy chain full length DNAs Segment, 5 light chain full length DNA segments；

The primer sequence are as follows:

Primer (SEQ ID NO:24): CCTCGAGATGGGATGGTCCTGTATTATCCTGT before heavy chain

Primer (SEQ ID NO:25): TAGATCTTCACTTGCCCAGGGACAGGGACAGG after heavy chain

Primer (SEQ ID NO:26): GATTCGAAGCCGCCACCATGGGATGGTCCTGTATTATCC before light chain

Primer (SEQ ID NO:27): CGGTCGACCTTATCAGCATTCGCCTCTATTGAAA after light chain

Heavy chain, light chain primer are selected respectively for heavy chain DNA and light chain DNA.

(2) preparation of adeno-associated virus plasmid；

PD-1 corresponding heavy chain full length DNA segment and the light chain overall length matched with it in the DNA fragmentation for taking step (1) DNA fragmentation；Cell Biolabs Inc is purchased to heavy chain full length DNA segment, purpose carrier pAAV-MCS-IRES() it carries out respectively XhoI-BglII double digestion；Double digestion system is 30 μ L of DNA fragmentation, enzyme respectively takes 1 μ L, 5 μ L of NEB cutsmart buffer, is used Ultrapure water supplies volume to 50 μ L；Double digestion condition is 2 hours of 37 DEG C of digestions；By the heavy chain DNA fragmentation after digestion and linearly Purpose carrier is according to heavy chain DNA fragmentation: the ratio that purpose carrier molar ratio is 3: 1, prepares T4 coupled reaction system, 16 DEG C of connections Overnight；Then 10 μ L connection reaction products are taken to convert into Stbl3 E. coli competent, specific Transformation Program is to connect 10 μ L Object of practicing midwifery is added in the Stbl3 competence thawed on ice, is placed in ice 30 minutes, then carries out 42 DEG C of 40 seconds thermal shocks, again It is placed in ice 1 minute, the LB liquid medium that 1mL37 DEG C of preheating is added takes 40 μ L bacteriums after 1 hour of incubator culture LB plate is placed in 37 DEG C of incubators and is incubated overnight, to Dan Ke by the even spread on the LB agar plate containing ammonia benzyl resistance After grand bacterium colony is grown, chooses 3-5 monoclonal and carry out shaking bacterium expansion culture；Finally plasmid is extracted using the small extraction reagent kit of plasmid to go forward side by side Row sequence verification correctly obtains the recombination positive plasmid pAAV-Heavy for carrying heavy chain DNA fragmentation afterwards；

The bis- enzymes of BstBI-SalI are carried out respectively to light chain full length DNA segment and above-mentioned recombination positive plasmid pAAV-Heavy It cuts, double digestion system is 30 μ L of DNA fragmentation, enzyme respectively takes 1 μ L, 5 μ L of NEB cutsmart buffer, supplies volume with ultrapure water To 50 μ L；Double digestion condition is 2 hours of 37 DEG C of digestions；Recycling digestion products obtain the light chain DNA fragments and enzyme after digestion Cut carrier；By after digestion light chain DNA fragments and digestion carrier according to light chain DNA fragments: digestion carrier molar ratio be 3: 1 ratio Column prepare T4 coupled reaction system, and 18 DEG C of connections are overnight；Then connection product is taken to convert into Stbl3 E. coli competent, Specific Transformation Program is that 10 μ L connection products are added in the Stbl3 competence thawed on ice, is placed in ice 30 minutes, then 42 DEG C of 40 seconds thermal shocks are carried out, are replaced in ice 1 minute, the LB liquid medium of 1mL37 DEG C of preheating are added, in incubator culture After 1 hour, 40 μ L bacteriums even spread on the LB agar plate containing ammonia benzyl resistance is taken, LB plate is placed in 37 DEG C of cultures It is incubated overnight in case, after monoclonal colonies are grown, chooses 3-5 monoclonal and carry out shaking bacterium expansion culture；It is finally small using plasmid Extraction reagent kit extracts plasmid and carries out sequence verification correctly obtains the adeno-associated virus plasmid for carrying heavy chain and light chain molecule afterwards pAAV-IgG；Attached drawing 1 is its structural schematic diagram, and the light chain and heavy chain DNA fragmentation of antibody molecule are subcloned to pAAV-IRES-MCS In carrier, wherein light chain DNA fragments are placed between CMV promoter and IRES, and heavy chain DNA fragmentation is placed in after IRES sequence.

To the heavy chain DNA fragmentation and a light chain DNA fragments being mutually paired in other DNA fragmentations；Repeat above-mentioned step Suddenly, to obtain 5 adeno-associated virus plasmids for carrying heavy chain and light chain molecule, corresponding three immunologic test point antibody molecules.

(3) HEK293 suspension cell is cultivated in the Freestyle293 culture medium of serum-free, maintenance cell density is 2x10⁶A cell/mL；First 1 day of transfection processing, adjustment cell density are 1x10⁶Cell/mL, is incubated overnight；It is then centrifuged for handling Cell precipitation is collected, cell precipitation is resuspended with culture medium, adjustment cell density is 3x10⁶A cell/mL；According to final concentration of 3 μ The adeno-associated virus plasmid of the carrying heavy chain and light chain molecule of amount addition step (2) of g/mL, shaking table oscillation；So according to final concentration PEI is added for the amount of 9 μ g/mL, shaken cultivation is stayed overnight on shaking table；Then it is added and is diluted with the isometric culture medium of cell culture fluid Cell continues culture 3 days；It is centrifuged cultivating system, after collecting cell precipitation, cell precipitation is resuspended with PBS, is added eventually after freeze thawing The all-round nuclease of concentration 5U/mL, 37 DEG C of incubation 1h；Last centrifugal treating draws supernatant, carries out column purification and obtains recombination gland phase Virus is closed, for the AAV virus for carrying immunologic test point antibody molecule encoding gene；Referring to table 1, this step obtains 5 kinds of recombination glands Correlated virus is divided into three groups, also corresponding with the DNA sequence dna of step (1).

(4) preparation of immune enhancing agents；One of recombinant adeno-associated virus that step (3) are obtained or it is several plus In the buffer for entering physiological saline or PBS, mix to get immune enhancing agents.The present embodiment can obtain 25 classes for not With the immune enhancing agents of immunologic test point combination.

The external cytokine release experimental verification of embodiment two

Using human lymphocyte separating liquid (Lymphoprep) reagent separating peripheral blood mononuclear cells from human peripheral (PBMC cell), and cultivated using RPMI1640,10%FBS, it is divided into blank group, control group, experimental group.

First group is added PHA activation periphery blood T cell in the medium, is blank group；Second group of T for PHA activation is thin Born of the same parents and tumour cell (lung carcinoma cell HCC829) co-cultivation group handle tumour using interferon first before being co-cultured Cell 24 hours, to improve immunologic test point molecule ligand (such as PD-L1 molecule) in the expression of tumor surface, then lead to Cross PBS washing three times to remove the INF- γ in culture medium after, the T cell that activation is added is co-cultured, be control group；Experiment Group is to add the different immune enhancing agents obtained by case study on implementation one respectively on the basis of second group of co-culture system (virus titer is adjusted to same concentration 5 × 10 with physiological saline¹³Vg/mL)；After infection 48 hours.Above-mentioned each group is taken respectively The culture medium supernatant of system checks the secreting, expressing of cell factor IL2, IFN-γ etc. using ELISA.

In experimental group, the included virus combination of the first immune enhancing agents is I-1:III-5=1:1；Second of combination For II-3:III-4=3:1；The third group is combined into I-2:II-3:III-4=1:3:1；4th kind of group be combined into I-1:II-3:III-5= 3:3:1；5th kind of group is combined into I-1:II-3=1:1；6th kind of group is combined into I-1:II-3:III-5=1:2:1；7th kind is I-2； 8th kind is II-3；9th kind is III-4.For viral code name referring to table 1, ratio is virion quantity ratio.

Cytokine release assay result:

Attached drawing 2-5 is cytokine secretion expression figure, wherein the first combination of the corresponding experimental group of attached drawing 2；Attached drawing 3 Second of corresponding experimental group combination；The third combination of the corresponding experimental group of attached drawing 4；Attached drawing the 4th kind of group of 5 corresponding experimental group It closes.

As can be seen that corresponding cytokine secretion expression significantly increases, thin with tumour after PHA activation T cell After born of the same parents co-culture, the expression of cell factor is significantly reduced；Different immune enhancing agents are added to above-mentioned co-cultivation body In system, with adding increasing for immune enhancing agents dosage, by inhibiting tumour cells T cell secrete cytokines (IL-2 and IFN-γ) ability step up, or even be restored to no tumour cell and there is the level inhibited.

Due to the ligand of tumor cell surface expression immunosupress checkpoint albumen, by the combination of receptor and ligand, to T Cell delivers negative regulation signal, and the cytokine secretion ability of T cell is caused to reduce；When combined immunologic test point will be carried After the recombinant adeno-associated virus of albumen is added in co-culture system, virion is entered in T cell, the immune suppression of great expression Checkpoint protein antibodies processed, the recombinant antibodies of expression and the immunosupress checkpoint protein binding on T cell surface or and tumour After the associated ligands of cell surface combine, the combination of this tumor cell surface ligand and T cell surface receptor has been blocked, thus It prevents tumour cell from transmitting negative regulation signal to immunocyte, realizes the sustained activation of T cell and persistently killing to tumour cell Wound effect.

Apoptosis-induced effect of the immunocyte of three secretory immune checkpoint antibody of embodiment to tumour cell

Using human lymphocyte separating liquid (Lymphoprep) reagent separating peripheral blood mononuclear cells from human peripheral (peripheral blood mononuclear cell, PBMC) cell, and cultivated using RPMI1640,10%FBS.? PHA activation periphery blood T cell is added in culture medium as effector cell；It is handled tumour cell 24 hours using interferon, with The immunologic test point ligand molecular for improving tumor cell surface, as then PD-L1 molecule leads in the expression of tumor surface PBS washing is crossed three times to remove the interferon in culture medium, through the processed tumour cell (liver cancer cells of interferon HepG2) it is used as target cell.The effector cell of activation is divided into two groups, take wherein one of one group of addition embodiment one it is immune Contrast agent (immunologic test point adeno-associated virus combines I-2:II-3:III-4=1:3:1), pairing effect cell is infected, and is made It can secreting, expressing immunologic test point antibody, after virus infection 48 hours, by express immunologic test point antibody effect it is thin Born of the same parents co-culture with target cell, and as experimental group, another group of effector cell is directly co-cultured with target cell, and is tried as control Test group；After co-culturing 48 hours, target cell is divided into three parts, a part of cell is taken to carry out changing for flow cytometry cell cycle Becoming, another cell uses genome extraction kit, full cellular genome is extracted, row agarose gel electrophoresis of going forward side by side experiment, Detect the genome crack conditions of apoptotic cell；Remaining cell carries out Hoechst dyeing, observes the change of cell caryogram.

The apoptosis-induced result of cell

Attached drawing 6 is cell cycle testing result.Control group tumour cell G0/G1 phase cell proportion is 45%, S phase cell ratio It is about 32.2% that example, which accounts for 22.8%, G2/M phase cell, shows that cell growth is more normal, the T cell of activation is not to tumour cell Period makes a significant impact；Compared with the control group, the immunocyte processing tumour that immunologic test point antibody is expressed in experimental group is thin After born of the same parents, there is apparent apoptosis in tumour cell cycle, and sub- G0/G1 phase cell is about that 22.5%, G0/G1 phase cell proportion is 50%, And S phase and G2/M phase cell proportion are reduced to 10% and 17.5% respectively.

Attached drawing 7 is cellular genome agarose gel electrophoresis experimental result.The result shows that the gene of control group tumour cell Group is more complete (swimming lane 1,2), and in experimental group (swimming lane 3), since apoptosis occurs for tumour cell, genomic DNA is fractured into The small molecule DNA of several hundred a bases or so.

Attached drawing 8 is Hoechst nuclear targeting result.Fig. 8-A is cellular control unit core, and nucleus fluorescent color is uniform, Fig. 8-B is experimental group group nuclear targeting as a result, nuclear collapse, in the graininess fluorescence that dense dye is fine and close, and fluorescence radiation is strong It spends inhomogenous.

Example IV Immune-enhancing effect system is prepared

PBMC cell is separated from human peripheral using human lymphocyte separating liquid (Lymphoprep) reagent, and uses leaching Cell is resuspended in bar cell culture fluid, adds recombinanthumanifn-γ in the medium in 37 DEG C, 5% CO₂After culture 24 hours, Xiang Pei It supports and adds anti-CD3, IL-1 and IL-2 in base, continue culture 48-72 hours, carry out half amount and change liquid, and supplement IL-2, continuously Using brine cell 3 times, to remove original cell factor in culture medium, it is thin that suspension is collected by centrifugation in culture 14 days Born of the same parents, immunocyte obtained are cytokine induced kill cell, are thin as main effects using the T cell of CD3+CD56+ The foreign cell group of born of the same parents, while including the T lymphocyte of CD8+.Cultivated cell is divided into three groups:

First group of cell is directly as control group；The immune increasing of one kind obtained by case study on implementation one is added in second group of cell Strong reagent includes recombinant adeno-associated virus II-3 and recombinant adeno-associated virus III-4, ratio 2: 1；Third group is added in cell Add another immune enhancing agents obtained by case study on implementation one, includes recombinant adeno-associated virus I-1, II-3 and recombination gland phase Close virus III-5, ratio 2: 2: 1.It is known as in the cell culture system present invention for being added to immune enhancing agents immune Enhancing system, the present invention can obtain 25 kinds of Immune-enhancing effect systems for a kind of immunocyte.The present embodiment is directed to immunocyte Immune-enhancing effect system M and immune increasing are referred to as the system that cytokine induced kill cell is added to immune enhancing agents Strong system N.

The verifying of five mouse of embodiment

It selects NOD/SCID mouse (institute of lab animals Chinese medicine Ke Yuan), inoculates expressing luciferase tumour Cell, building mice-transplanted tumor model (method refers to Ito M, Hiramatsu H, Kobayashi K, Suzue K, Kawahata M, Hioki K et al. NOD/SCID/γ mouse: an excellent recipient mouse model for engraftment of human cells. Blood 2002;100:3175-82).There to be similar weight It is divided into four groups, every group 10 with the tumor-bearing mice of tumor size.Pair in the example IV of first group of mouse injection same volume According to group, but immune enhancing agents of the invention are not added；Second group of culture cell in second group of injection example IV, containing immune Contrast agent, i.e. Immune-enhancing effect system M；Third group injects the third group culture cell in example IV, contains immune enhancing agents, That is Immune-enhancing effect system N；4th group of mouse passes through tail vein injection saline；It is continuous observation 30 days, primary every 5 days, it takes out Mouse peripheral blood is taken, antibody-secreting expression is detected, while living imaging experiment is carried out by luciferase, records tumour body Long-pending change situation.

The result shows that can be detected in the peripheral blood of survival mice in addition to individual mice is dead in second group and third group The expression of immunologic test point antibody molecule, the mouse of injecting immune Contrast agent carry gross tumor volume and are obviously reduced, mouse Food-intake and weight increase；In contrast, first, the 4th group of mouse (injecting normal saline or control T cell group) exists In the continuous observation phase, tumour growth is obviously accelerated, and the food-intake of mouse gradually decreases, and individual mice occurs dead；Control group With experimental mice The dead quantity without significant difference.Inject I-1 II-3 the mouse tumor average external volume of III-5 be about 0.0563 ±0.0169cm³, injection II-3 the mouse tumor average external volume of III-4 be about 0.069 ± 0.0102cm³, injection control T cell The mouse tumor average external volume of group is about 0.087 ± 0.0102cm³, the tumor average volume of injecting normal saline mouse is about 0.12±0.0202cm³, the mouse of injecting immune reinforcing agent, gross tumor volume injects significantly less than control group (p < 0.05) Containing I-1 II-3 III-5 virus group Contrast agent, gross tumor volume further decreases, but does not generate significant difference.It sees After the survey phase, tumor tissues are removed and weighed out of Mice Body, as a result injecting normal saline control mice group is swollen Tumor tissue weight average be 2.87 ± 1.11g, injection control T cell group mouse tumor 2.35 ± 0.51g, II-3 III-4 it is small The tumor tissues average weight of mouse be 1.614 ± 0.35g, I-1 II-3 III-5 mouse tumor tissues average out to 1.59 ± 0.43g, the tumor weight of experimental group is significantly less than control group.

The anxious poison experiment of six animal of embodiment

The mouse (half male and half female, weight 18-22g, difference are no more than 2g) for choosing 6-8 week old, is divided into five groups for mouse, often 10 mouse of group, wherein control group is through 500 uL physiological saline of tail vein injection, take one group through tail vein injection 500uL zero load gland Associated viral particle, all 5 kind recombinant adeno-associated virus of the excess-three group experimental group through 500 uL embodiment one of tail vein injection (the viral mixed in equal amounts agent comprising I-1, I-2, II-3, III-4, III-5) is respectively that 5 kinds of viruses are mixed with basic, normal, high dosage Close accumulated dose 5x10⁹Vg/g weight, 5x10¹⁰Vg/g weight, 2.5x10¹¹Vg/g weight is injected.

Before and after injection, the situation of mouse weight, feed, water inlet is observed and recorded daily, pays close attention to undue toxicity disease Shape, is observed continuously day, including action (unstability, how dynamic), nervous system reaction (lift tail, tremble, spasm, posture are abnormal etc.), Autonomic nerves system reaction (shed tears, urinate, hair is upright, breathing is abnormal) and death.After dead mouse and anxious poison is real After testing, dissection is carried out to mouse and histological observation is carried out to each system and organ.Using bliss method calculate LD50 and Maximum tolerated dose.

The anxious malicious experimental result of animal, injects adeno-associated virus group and saline control group is dying or dead without animal； One mouse of two mouse of low dose group and high dose group is short of breath after observing administration, limbs fatigue phenomenon, but 2 Restore in minute；Other animals do not observe that overt toxicity reacts during test.The the 2nd, 4,7 after and administration preceding to administration, The weight of animals is weighed within 14 days, and the middle and high dosage group male of recombined adhenovirus upon administration slightly delay in negative control by body weight increase Group, but it is showed no statistical difference, other show no obvious abnormalities, and summarize data and are shown in Table 2 (compared with the control group, * p < 0.05). Administration group animal ingestion amount is almost the same with control group, shows no obvious abnormalities, see Table 3 for details for individual data items (1 cage of every 5 animals, often Secondary detection is ingested for 2 days, average food ration=(additive amount-surplus)/2/5).Animal administration after observe 14 days, in the 15th day into Row pathological anatomy, administration group and each major organs gross examination of control group do not find apparent morphological abnormalities, and it is right to be detailed in attached drawing 9 Comparison diagram is sliced according to the liver and renal tissues pathology of mouse and high dose group mouse.

2 animal of table administration front and back weight statistic summary table (x ± s, n=10)

3 recombined adhenovirus mouse single intravenous injection of table administration toxicity test animal is averaged food ration individual data items table

SEQUENCE LISTING

<110>Ai Kang get biomedical technology (Suzhou) Co., Ltd

<120>a kind of immune enhancing agents

<160> 27

<170> PatentIn version 3.3

<210> 1

<211> 113

<212> PRT

<213>artificial sequence

<400> 1

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Tyr Ser Phe Ser Asn Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Trp Ser Asp Gly Ser Gly Arg Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

100 105 110

Ser

<210> 2

<211> 96

<212> PRT

<213>artificial sequence

<400> 2

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Gly Ser Gln Ser Val Val Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Arg Ala Thr Gly Val Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg

85 90 95

<210> 3

<211> 113

<212> PRT

<213>artificial sequence

<400> 3

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Ser Ser

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Trp Gly Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe

65 70 75 80

Leu Gln Met Ser Ser Val Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Thr Gln Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

100 105 110

Ser

<210> 4

<211> 96

<212> PRT

<213>artificial sequence

<400> 4

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ile Ser Tyr

20 25 30

Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asp Asn Trp Pro Arg

85 90 95

<210> 5

<211> 122

<212> PRT

<213>artificial sequence

<400> 5

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Phe Ser Phe Ser Thr Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ser Ile Phe Gly Lys Ala His Tyr Ala Gln Lys Phe Gln

50 55 60

Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met

65 70 75 80

Glu Leu Asn Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Phe Cys Ala

85 90 95

Arg Lys Phe His Phe Val Ser Phe Tyr Tyr Phe Gly Met Asp Val Trp

100 105 110

Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120

<210> 6

<211> 95

<212> PRT

<213>artificial sequence

<400> 6

Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Ser Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Asn Leu Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Trp Ser Asn Trp Pro

85 90 95

<210> 7

<211> 118

<212> PRT

<213>artificial sequence

<400> 7

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr

20 25 30

Trp Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Thr Phe Ile Ser Pro Asp Gly Asn Asn Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Thr Gly Trp Leu Gly Pro Gly Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 8

<211> 108

<212> PRT

<213>artificial sequence

<400> 8

Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Gly Ser Ser Ser Val Gly His Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Asp Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Trp Tyr Ser Ser Pro

85 90 95

Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210> 9

<211> 118

<212> PRT

<213>artificial sequence

<400> 9

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Thr Phe Ile Asn Gly Ser Ser Asn Asn Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Thr Gly Trp Leu Gly Pro Tyr Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 10

<211> 108

<212> PRT

<213>artificial sequence

<400> 10

Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Gly His Ser

20 25 30

Tyr Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Gly Ala Phe Ser Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro

85 90 95

Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210> 11

<211> 339

<212> DNA

<213>artificial sequence

<400> 11

caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60

gattgcaaag cgagcggcta tagctttagc aactatggca tgcattgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcggtg atttggagcg atggcagcgg ccgctattat 180

gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgttt 240

ctgcagatga acagcctgcg cgcggaagat accgcggtgt attattgcgc gaccaacgat 300

gattattggg gccagggcac cctggtgacc gtgagcagc 339

<210> 12

<211> 288

<212> DNA

<213>artificial sequence

<400> 12

gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60

ctgagctgcc gcggcagcca gagcgtggtg agctatctgg cgtggtatca gcagaaaccg 120

ggccaggcgc cgcgcctgct gatttatggc gcgagcaccc gcgcgaccgg cgtgccggcg 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240

gaagattttg cggtgtatta ttgccagcag agcagcaact ggccgcgc 288

<210> 13

<211> 339

<212> DNA

<213>artificial sequence

<400> 13

caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60

gattgcaaag cgagcggcat tacctttagc agcagcggca tgcattgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcggtg atttggggcg atggcagcaa acgctattat 180

gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgttt 240

ctgcagatga gcagcgtgcg cgcggaagat accgcggtgt attattgcgc gacccaggat 300

gattattggg gccagggcac cctggtgacc gtgagcagc 339

<210> 14

<211> 288

<212> DNA

<213>artificial sequence

<400> 14

gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60

ctgagctgcc gcgcgagcca gagcgtgatt agctatctgc attggtatca gcagaaaccg 120

ggccaggcgc cgcgcctgct gatttatggc gcgagcaacc gcgcgaccgg cattccggcg 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240

gaagattttg cggtgtatta ttgccagcag tatgataact ggccgcgc 288

<210> 15

<211> 366

<212> DNA

<213>artificial sequence

<400> 15

caggtgcagc tggtgcagag cggcgcggaa gtgaaaaaac cgggcagcag cgtgaaagtg 60

agctgcaaaa ccagcggctt tagctttagc acctatgcga ttagctgggt gcgccaggcg 120

ccgggccagg gcctggaatg gatgggcggc attagcattt ttggcaaagc gcattatgcg 180

cagaaatttc agggccgcgt gaccattacc gcggatgaaa gcaccagcac cgcgtatatg 240

gaactgaaca gcctgcgcag cgaagatacc gcggtgtatt tttgcgcgcg caaatttcat 300

tttgtgagct tttattattt tggcatggat gtgtggggcc agggcaccac cgtgaccgtg 360

agcagc 366

<210> 16

<211> 285

<212> DNA

<213>artificial sequence

<400> 16

gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60

ctgagctgcc gcgcgagcca gagcattagc aactatctgg cgtggtatca gcagaaaccg 120

ggccaggcgc cgcgcctgct gatttatggc gcgagcaacc tggcgaccgg cattccggcg 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240

gaagattttg cggtgtatta ttgccagcag tggagcaact ggccg 285

<210> 17

<211> 354

<212> DNA

<213>artificial sequence

<400> 17

caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60

agctgcgcgg cgagcggctt tacctttacc agctattgga ttagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtgaccttt attagcccgg atggcaacaa caaatattat 180

gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgtat 240

ctgcagatga gcagcctgcg cgcggaagat accgcgattt attattgcgc gcgcaccggc 300

tggctgggcc cgggcgatta ttggggccag ggcaccctgg tgaccgtgag cagc 354

<210> 18

<211> 324

<212> DNA

<213>artificial sequence

<400> 18

gaaattgtgc tgacccagag cccgggcacc ctgagcctga gcccgggcga acgcgcgacc 60

ctgagctgcc gcggcagcag cagcgtgggc catagctatc tggcgtggta tcagcagaaa 120

ccgggccagg cgccgcgcct gctgatttat gatgcgagca gccgcgcgac cggcattccg 180

gatcgcttta gcggcagcgg cagcggcacc gattttaccc tgaccattag ccgcctggaa 240

ccggaagatt ttgcggtgta ttattgccag cagtggtata gcagcccgtg gacctttggc 300

cagggcacca aagtggaaat taaa 324

<210> 19

<211> 354

<212> DNA

<213>artificial sequence

<400> 19

caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60

agctgcgcgg cgagcggctt tacctttagc agctatgcga tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtgaccttt attaacggca gcagcaacaa caaatattat 180

gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgtat 240

ctgcagatga acagcctgcg cgcggaagat accgcgattt attattgcgc gcgcaccggc 300

tggctgggcc cgtatgatgt gtggggccag ggcaccctgg tgaccgtgag cagc 354

<210> 20

<211> 324

<212> DNA

<213>artificial sequence

<400> 20

gaaattgtgc tgacccagag cccgggcacc ctgagcctga gcccgggcga acgcgcgacc 60

ctgagctgcc gcgcgagcca gagcgtgggc catagctatg tggcgtggta tcagcagaaa 120

ccgggccagg cgccgcgcct gctgatttat ggcgcgttta gccgcccgag cggcattccg 180

gatcgcttta gcggcagcgg cagcggcacc gattttaccc tgaccattag ccgcctggaa 240

ccggaagatt ttgcggtgta ttattgccag cagtatggca gcagcccgta tacctttggc 300

cagggcacca aagtggaaat taaa 324

<210> 21

<211> 57

<212> DNA

<213>artificial sequence

<400> 21

atgggatggt cctgtattat cctgttcctg gtcgctaccg ctactggggt gcatagt 57

<210> 22

<211> 981

<212> DNA

<213>artificial sequence

<400> 22

gccagcacaa agggcccctc cgtgttccca ctggctccct gcagcaggtc tacatccgag 60

agcaccgccg ctctgggctg tctggtgaag gattatttcc ctgagccagt gaccgtgagc 120

tggaactccg gcgccctgac atccggcgtg cacacctttc ctgctgtgct gcagtcttcc 180

ggcctgtaca gcctgagctc tgtggtgaca gtgccctcca gctctctggg caccaagaca 240

tatacctgca acgtggacca taagcctagc aataccaagg tggataagag ggtggagtct 300

aagtacggac ctccttgccc accttgtcct gctcctgagt tcctgggagg accttccgtg 360

ttcctgtttc ctccaaagcc taaggacaca ctgatgatct ctcggacacc tgaggtgacc 420

tgcgtggtgg tggacgtgtc ccaggaggat ccagaggtgc agttcaactg gtatgtggat 480

ggcgtggagg tgcacaatgc taagaccaag cctagggagg agcagtttaa ctccacatac 540

cgggtggtga gcgtgctgac cgtgctgcat caggactggc tgaacggcaa ggagtataag 600

tgcaaggtga gcaataaggg cctgccatcc agcatcgaga agacaatctc taaggccaag 660

ggccagccta gggagccaca ggtgtacacc ctgccccctt cccaggagga gatgacaaag 720

aaccaggtga gcctgacctg tctggtgaag ggcttctatc catctgacat cgctgtggag 780

tgggagtcca atggccagcc cgagaacaat tacaagacca caccacccgt gctggactcc 840

gatggcagct tctttctgta tagccggctg accgtggata agtctagatg gcaggagggc 900

aacgtgttct cctgctccgt gatgcacgaa gcactgcaca accattatac tcagaaaagc 960

ctgtccctgt ccctgggcaa g 981

<210> 23

<211> 354

<212> DNA

<213>artificial sequence

<400> 23

acctttggcc aaggcacaaa ggtggagatc aagcgaaccg tggccgctcc ttctgtcttc 60

atttttcccc ctagtgacga acagctgaaa agcgggacag cttccgtggt ctgtctgctg 120

aacaatttct atcccagaga ggccaaggtg cagtggaaag tcgataacgc tctgcagtca 180

ggcaatagcc aggagtccgt gactgaacag gactctaagg atagtaccta ctcactgtct 240

agtactctga ccctgtctaa agcagactat gaaaagcaca aagtctacgc ctgtgaagtg 300

acacaccagg ggctgagcag tccagtgacc aagagtttca atagaggcga atgc 354

<210> 24

<211> 32

<212> DNA

<213>artificial sequence

<400> 24

cctcgagatg ggatggtcct gtattatcct gt 32

<210> 25

<211> 32

<212> DNA

<213>artificial sequence

<400> 25

tagatcttca cttgcccagg gacagggaca gg 32

<210> 26

<211> 39

<212> DNA

<213>artificial sequence

<400> 26

gattcgaagc cgccaccatg ggatggtcct gtattatcc 39

<210> 27

<211> 34

<212> DNA

<213>artificial sequence

<400> 27

cggtcgacct tatcagcatt cgcctctatt gaaa 34

Claims

1. a kind of immune enhancing agents, it is characterised in that: the immune enhancing agents include carrying immunologic test point antibody molecule The AAV virus of encoding gene；The immunologic test point be PD-1, PD-L1 and CTLA-4 perhaps PD-L1 and CTLA-4 or PD-1 and CTLA-4；The amino acid sequence of the PD-1 antibody molecule heavy chain variable region is SEQ ID NO:1, light chain variable region Amino acid sequence is SEQ ID NO:2 or the amino acid sequence of the PD-1 antibody molecule heavy chain variable region is SEQ ID NO: 3, the amino acid sequence of light chain variable region is SEQ ID NO:4；The amino acid sequence of the PD-L1 antibody molecule heavy chain variable region For SEQ ID NO:5, the amino acid sequence of light chain variable region is SEQ ID NO:6；The CTLA-4 antibody molecule weight chain variable The amino acid sequence in area is SEQ ID NO:7, the amino acid sequence of light chain variable region is SEQ ID NO:8 or the CTLA-4 The amino acid sequence of antibody molecule heavy chain variable region is SEQ ID NO:9, the amino acid sequence of light chain variable region is SEQ ID NO:10。

2. immune enhancing agents according to claim 1, it is characterised in that: encode base when carrying immunologic test point antibody molecule The AAV virus of cause is to carry the AAV virus and carrying CTLA-4 antibody molecule encoding gene of PD-1 antibody molecule encoding gene When AAV virus, carries the AAV virus of PD-1 antibody molecule encoding gene and carry the AAV of CTLA-4 antibody molecule encoding gene The virion quantity ratio of virus is (6~3): 1；When the AAV virus for carrying immunologic test point antibody molecule encoding gene is to take When the AAV virus with PD-L1 antibody molecule encoding gene and the AAV virus of carrying CTLA-4 antibody molecule encoding gene, carry The virion of the AAV virus of the AAV virus and carrying CTLA-4 antibody molecule encoding gene of PD-L1 antibody molecule encoding gene Quantity ratio is (6~3): 1；When the AAV virus for carrying immunologic test point antibody molecule encoding gene is to carry PD-1 antibody molecule The AAV virus of encoding gene carries the AAV virus of PD-L1 antibody molecule encoding gene and carries CTLA-4 antibody molecule coding When the AAV virus of gene, carries the AAV virus of PD-1 antibody molecule encoding gene and carry PD-L1 antibody molecule encoding gene The sum of the virion quantity of AAV virus and the AAV virus for carrying CTLA-4 antibody molecule encoding gene virion subnumber Amount is than being (6~3): 1.

3. immune enhancing agents according to claim 1, it is characterised in that: the carrying immunologic test point antibody molecule coding In the AAV virus of gene, the DNA sequence dna of coding PD-1 antibody molecule weight chain variabl area sequence is SEQ ID NO:11 or SEQ ID NO:13；The DNA sequence dna for encoding PD-1 antibody molecule light-chain variable sequence is SEQ ID NO:12 or SEQ ID NO: 14；The DNA sequence dna for encoding PD-L1 antibody molecule weight chain variabl area sequence is SEQ ID NO:15；It is light to encode PD-L1 antibody molecule The DNA sequence dna of chain variable region sequence is SEQ ID NO:16；Encode the DNA sequence dna of CTLA-4 antibody molecule weight chain variabl area sequence For SEQ ID NO:17 or SEQ ID NO:19；The DNA sequence dna for encoding CTLA-4 antibody molecule light-chain variable sequence is SEQ ID NO:18 or SEQ ID NO:20.

4. immune enhancing agents according to claim 1, which is characterized in that the antibody molecule is scFv antibody molecule piece Section, Fab antibody molecule fragment or full length antibody.

5. immune enhancing agents according to claim 1, it is characterised in that: the immune enhancing agents further include physiological saline Or the buffer of PBS.

6. a kind of Immune-enhancing effect system, it is characterised in that: the Immune-enhancing effect system carries immune inspection by described in claim 1 The AAV virus for making an inventory of antibody molecule encoding gene infects T cell in vitro or cytokine induced kill cell is prepared into It arrives.

7. Immune-enhancing effect system according to claim 6, it is characterised in that: the Immune-enhancing effect system is prepared as to containing It is anti-that carrying immunologic test point described in claim 1 is added in the culture medium of T cell or cytokine induced kill cell The AAV virus of body molecule encoding gene, obtains Immune-enhancing effect system.

8. Immune-enhancing effect system according to claim 7, it is characterised in that: the culture medium contain cell factor and nutrition at Point.

9. a kind of method of external enhancing immune cells factor releasability, it is characterised in that: include the following steps, Xiang Han Carrying immunologic test point described in claim 1 is added in the culture medium for having T cell or cytokine induced kill cell The AAV virus of antibody molecule encoding gene, is infected and is cultivated, that is, enhance the cytokine release ability of immunocyte.