CN104887717A - Immunity enhancing reagent - Google Patents
Immunity enhancing reagent Download PDFInfo
- Publication number
- CN104887717A CN104887717A CN201510298011.7A CN201510298011A CN104887717A CN 104887717 A CN104887717 A CN 104887717A CN 201510298011 A CN201510298011 A CN 201510298011A CN 104887717 A CN104887717 A CN 104887717A
- Authority
- CN
- China
- Prior art keywords
- antibody molecule
- seq
- encoding gene
- cell
- molecule encoding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an immunity enhancing reagent comprising AAVs carrying molecule encoding genes of antibodies at immunodetection points, wherein the immunodetection points are one or several from PD-1, PD-L1 and CTLA-4. The AAVs carrying the molecule encoding genes of the antibodies at different immunodetection points are combined with each other, T cells, natural killer cells, cytotoxic T lymphocytes or cell factor induced killer cells and other immune cells are infected in vitro, and the antibodies at the immunodetection points are expressed and secreted after the infected immune cells are fed back to bodies of patients suffering from tumors, so that the combination of receptors at the immunodetection points and ligands of the receptors is blocked, the transfer of an immunosuppression signal is effectively blocked, the immune tumor suppression microenviroment is destroyed, the immune cell killing capacity is improved, and furthermore the curative effect of adoptive immune therapy is improved.
Description
Technical field
The invention belongs to biomedical sector, be specifically related to a kind of immune enhancing agents, the activation of immunocyte, propagation and release of cytokines ability can be improved in vitro.
Background technology
By the adjustment of many surface molecular precisions in immune cell activation process, some Promote immunity cell-stimulatings; What have is then Inhibitory receptor molecule, is responsible for transmitting and suppresses signal, to prevent immune system overactivity.The molecule of these stimulations or Immunosuppression cell-stimulating, is commonly called immunologic test point, or immunologic test point molecule, immune switch molecule etc.
Immunologic test point comprises Cytotoxic T lymphocyte associated antigen-4 (cytotoxic T lymphocyte-associated antigen-4, and programmed death receptor 1 and part (programmed death 1, PD-1/PD-L1) signal path molecule thereof and PD-L2, IDO-1, IDO-2, KIR, OX40, CD70, LAG-3, TIM3 etc. CTLA-4).CTLA-4 is the important lower regulatory factor of T cell activation.In T cell activation process, CTLA-4 transcribing and the directly expression of some key components in T suppression cell cycle thus the activation of suppressor T cell and propagation by T suppression cell core IL-2 (interleukin-2, IL-2) gene.And PD-1/PD-L1 signal path also plays negative immune regulating action.Study proof, tumor cell surface extensive high expressed PD-L1 molecule.After PD-1 and the PD-L1 on T cell surface is coupled, the tyrosine residue phosphorylation of the immunity receptor Tyrosine Inhibitory Motifs domain of T cell cytoplasmic region can be caused, phosphatase protein tryrosinase 2 and protein-tyrosine enzyme 1 can be raised, not only can the activation of blocks cellular extracellular signal-regulated kinase, the also activation of phosphatidyl-inositol 3-kinase capable of blocking and serine-threonine protein kinase enzyme, the final secretion suppressing T lymphopoiesis and relevant cell factor.Meanwhile, cytokine interleukin 2(IL-2), interferon gamma secretion also reduce.
Because tumour patient vivo immuning system monitors that balance is destroyed, effectively tumor cell cannot be removed by the immune system of patient in health.Therefore by the autologous or alloimmune effector lymphocyte activated in vitro and increase is fed back in tumor patient body, its adoptive immunity cell therapy playing killing tumor cell effect is in vivo able in clinical prevailing, comprise conventional immune cell therapy method as: cytokine induced kill cell (CIK) therapy, DC combine the cancer target therapy etc. of CIK cell therapy, natural killer cell (NK) therapy, neoplasm invasiveness cell therapy (TIL), cytotoxic T lymphocyte (CTL).
But tumor cell has developed much mechanism to suppress the antineoplastic immune of body active.The immunosuppressant of tumor microenvironment suppresses signal to regulate and control mainly through premunition checkpoint between tumor cell and immunocyte.Due to the immunosuppressant microenvironment in tumor patient body, make the immunosuppressive action that still cannot overcome after in the immunocyte of these Activation In Vitros feedback body in body, therefore adoptive immunotherapy embodies the low-down limitation of its curative effect (Trajanoski Z in a large amount of clinical trials and application, Maccalli C, Mennonna D, Casorati G, Parmiani G, Dellabona P (2015) Somatically mutated tumor antigens in the quest for a more efficacious patient-oriented immunotherapy of cancer. Cancer immunology, immunotherapy: CII 64:99-104).
Therefore, a kind of effective immunoreagent of necessary research and development, close the immune negative regulation of immunologic test point mediation, blocking immunity suppresses signal transmission, improve and be separated in vitro from patient blood and the activation of the immunocyte increased, propagation and release of cytokines ability, and further killing tumor cell, to promote that adoptive immunotherapy obtains substantial effect.
Summary of the invention
The object of this invention is to provide a kind of immune enhancing agents improving immune cell activation killing tumor cells function, the coinhibitory signals path of one or more immunologic test points closed mediation can be combined, increase the activation of immunocyte, propagation and release of cytokines ability, effectively prevent the immunosuppressant of tumor cell, thus improve from blood samples of patients separate and the immunocyte increased to the ability of tumor-killing.
To achieve the above object of the invention, the technical solution used in the present invention is, a kind of immune enhancing agents, comprise the AAV virus of carrying immunologic test point antibody molecule encoding gene, describedly carry in the AAV virus of immunologic test point antibody molecule encoding gene, immunologic test point is one or several in PD-1, PD-L1, CTLA-4.The present invention utilizes the AAV virus combination mutually of carrying different immunologic test point antibody molecule encoding gene, by infecting the immunocytes such as T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell in vitro; Infected immunocyte is fed back in oncosis human body, and the antibody of expression-secretion immunologic test point, thus the combination of blocking immunity checkpoint receptor and part thereof, effective blocking immunity suppresses signal transmission, improve the ability of the activation of immunocyte, propagation and secrete cytokines, destroy immune tumor suppression microenvironment, improve the kill capability of immunocyte, thus improve the curative effect of adoptive immunotherapy.The tumor cell immunologic test point that the present invention is directed to be one in PD-1, PD-L1, CTLA-4, two kinds or three kinds, not interference mutually, the common effect improving immunoreagent, thus the effective kill capability improving immunocyte.
In technique scheme, the aminoacid sequence of described PD-1 antibody molecule variable region of heavy chain is SEQ ID NO:1 or SEQ ID NO:3, and the aminoacid sequence of variable region of light chain is SEQ ID NO:2 or SEQ ID NO:4; The aminoacid sequence of described PD-L1 antibody molecule variable region of heavy chain is SEQ ID NO:5, and the aminoacid sequence of variable region of light chain is SEQ ID NO:6; The aminoacid sequence of CTLA-4 antibody molecule variable region of heavy chain is SEQ ID NO:7 or SEQ ID NO:9, and the aminoacid sequence of variable region of light chain is SEQ ID NO:8 or SEQ ID NO:10.
In technique scheme, described in carry in the AAV virus of immunologic test point antibody molecule encoding gene, the DNA sequence of coding PD-1 antibody molecule weight chain variabl area sequence is SEQ ID NO:11 or SEQ ID NO:13; The DNA sequence of coding PD-1 antibody molecule light-chain variable sequence is SEQ ID NO:12 or SEQ ID NO:14; The DNA sequence of coding PD-L1 antibody molecule weight chain variabl area sequence is SEQ ID NO:15; The DNA sequence of coding PD-L1 antibody molecule light-chain variable sequence is SEQ ID NO:16; The DNA sequence of coding CTLA-4 antibody molecule weight chain variabl area sequence is SEQ ID NO:17 or SEQ ID NO:19; The DNA sequence of coding CTLA-4 antibody molecule light-chain variable sequence is SEQ ID NO:18 or SEQ ID NO:20.
In the present invention, carry in the AAV virus of immunologic test point antibody molecule encoding gene, also can there is various ways in the entrained DNA fragmentation corresponding immunologic test point antibody molecule obtained of encoding, be scFv fragment, Fab fragment or full length antibody.These molecular forms can be corresponding on binding immunoassay cell or tumor cell immunosuppressant signal path, the combination between blocking immunity checkpoint and its part, thus the transmission blocking that tumour immunity suppresses signal.
In technique scheme, immune enhancing agents also comprises the buffer of normal saline or PBS; Those skilled in the art can add as required.
The invention also discloses a kind of immunostimulant system, infect T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell in vitro by above-mentioned AAV virus of carrying immunologic test point antibody molecule encoding gene to prepare, be specially and add above-mentioned AAV virus of carrying immunologic test point antibody molecule encoding gene in the culture medium containing T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell, just obtain immunostimulant system after cultivation, it can be fed back in patient body; In patient body, infected immunocyte, by secreting, expressing antibody molecule, is combined with immunologic test point, closes the coinhibitory signals path of immunologic test point mediation.In conjunction with antigen molecule can be the immunologic test point molecule on immunocyte surface, also can be the immunologic test point molecule that other of tumor cell or other cell surfaces participate in immunosuppressant or immune activation.
Present invention also offers a kind of method of external enhancing immune cells factor releasability, comprise the following steps, above-mentioned AAV virus of carrying immunologic test point antibody molecule encoding gene is added in the culture medium containing T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell, through infecting and cultivating, by feeding back the immunocyte of release of cytokines ability enhancing to human body, improve the ability of the activation of immunocyte, propagation and secrete cytokines, better can kill tumor cell.
Immune cell media contains cytokine and other nutritional labeling, can support the liquid of immune cell growth and amplification, can be used for the cultivation of all kinds of immunocyte such as T cell, CIK, NK.Such as CIK cell cultivates the PBMC cell adopting basal medium to be separated from blood as the process of RPMI1640 culture fluid, after in culture fluid, INF-γ stimulates, in addition CD3 monoclonal antibody, interleukin II are cultivated again afterwards, finally cultivate with the culture fluid containing IL-2 and can obtain CIK cell; NK cell culture medium adopts basal medium as RPMI1640 and adds the cellular immunization such as adhesion factor, IL-2, IL-4, the IL-12 factor etc., has stronger stimulation or maturing, can improve the killing activity of activating immune cell to the growth of NK cell; Human peripheral blood lymphocytes culture medium is primarily of compositions such as RPMI1640, potassium penicillin G, streptomycin sulfate, Ox blood serum, phytohemagglutinins (PHA).
Carry the AAV virus meeting infection immunity cell of immunologic test point antibody molecule encoding gene, and carry out expressing the immunologic test point antibody molecule carried, the virus infected into immunocyte can not oneself's packaging or the progeny virus producing and have infection ability that increases.
AAV virus of carrying immunologic test point antibody molecule encoding gene of the present invention is prepared by following steps:
(1) DNA sequence of composite coding immunologic test point antibody molecule heavy chain total length and light chain total length, after sequence verification is correct, obtains heavy chain DNA fragmentation, light chain DNA fragments by polymerase chain reaction (PCR) amplification;
(2) fragment for the purpose of the heavy chain DNA fragmentation of step (1), light chain DNA fragments, carrier for the purpose of pAAV-MCS-IRES, successively in cloned heavy chain DNA fragmentation and light chain DNA fragments to above-mentioned carrier, and final sequence verification correctly obtains the adeno-associated virus plasmid comprising total length heavy chain and full-length light chains DNA molecular afterwards;
(3) the adeno-associated virus plasmid to HEK293 transit cell dye step (2) cultivated carries out the amplification of virus packaging by conventional methods, afterwards after collecting cell lysate supernatant, carry out the AAV virus that column purification obtains carrying immunologic test point antibody molecule encoding gene;
(4) preparation of immune enhancing agents; Different immunologic test selects in the AAV virus of antibody molecule encoding gene that one or several add in normal saline or PBS buffer for carrying of step (3) being obtained, and obtains immune enhancing agents.
In immune enhancing agents of the present invention, the AAV virus that can comprise separately the AAV virus of carrying PD-1 antibody molecule encoding gene, the AAV virus of carrying PD-L1 antibody molecule encoding gene or carry CTLA-4 antibody molecule encoding gene; Also two kinds wherein or three kinds can be comprised.When the viral AAV virus for carrying PD-1 antibody molecule encoding gene of the AAV carrying immunologic test point antibody molecule encoding gene is viral with the AAV carrying CTLA-4 antibody molecule encoding gene, the virion number ratio of the AAV virus of carrying PD-1 antibody molecule encoding gene and the AAV virus of carrying CTLA-4 antibody molecule encoding gene is (6 ~ 3): 1; When the viral AAV virus for carrying PD-L1 antibody molecule encoding gene of the AAV carrying immunologic test point antibody molecule encoding gene is viral with the AAV carrying CTLA-4 antibody molecule encoding gene, the virion number ratio of the AAV virus of carrying PD-L1 antibody molecule encoding gene and the AAV virus of carrying CTLA-4 antibody molecule encoding gene is (6 ~ 3): 1; When the AAV virus of carrying immunologic test point antibody molecule encoding gene for carry PD-1 antibody molecule encoding gene AAV virus, carry PD-L1 antibody molecule encoding gene AAV virus with when carrying the AAV virus of CTLA-4 antibody molecule encoding gene, the virion quantity of the AAV virus of carrying PD-1 antibody molecule encoding gene and the AAV virus of carrying PD-L1 antibody molecule encoding gene with carry the virion number ratio of AAV virus of CTLA-4 antibody molecule encoding gene for (6 ~ 3): 1.If carry the virion excessive number of the AAV virus of CTLA-4 antibody molecule encoding gene, then easily produce stronger side reaction.
The present invention utilizes the method for chemical external total length synthesis, the heavy chain DNA molecular full length sequence of composite coding immunologic test point antibody molecule and light chain DNA molecular full length sequence.Immunologic test point antibody heavy chain molecules comprises signal peptide, variable region of heavy chain and CH, and light chain molecule comprises signal peptide, variable region of light chain and constant region of light chain; Corresponding coded sequence is respectively signal peptide DNA sequence, variable region of heavy chain DNA sequence, CH DNA sequence, variable region of light chain DNA sequence and constant region of light chain DNA sequence.See sequence table, variable region of heavy chain DNA sequence and variable region of light chain DNA sequence are SEQ ID NO:11-SEQ ID NO:20, amount to 10, signal peptide DNA sequence is SEQ ID NO:21, CH DNA sequence is SEQ ID NO:22, and constant region of light chain DNA sequence is SEQ ID NO:23.
Respectively according to signal peptide, variable region and amino acid constant region sequence, three segment DNA sequences of its aminoacid sequence of composite coding, and utilize overlapping PCR method, be spliced into heavy chain and the light chain DNA total length of total length.Every bar full length DNA sequence is cloned in pUC18-T carrier respectively, after sequence verification is correct, obtains recombinant cloning vector plasmid; Carry out polymerase chain reaction (PCR) amplification with above-mentioned recombinant cloning vector plasmid for template, reclaim PCR primer, obtain heavy chain and the light chain full length DNA fragment of encoding immune checkpoint antibody molecule respectively.
Get a heavy chain full length DNA fragment and a light chain full length DNA fragment of above-mentioned mutual pairing.Respectively XhoI-BglII double digestion is carried out to heavy chain full length DNA fragment, object carrier pAAV-MCS-IRES; Heavy chain DNA fragmentation after enzyme action and linear object carrier are prepared T4 coupled reaction system, and 16 DEG C of connections are spent the night; Then get 10 μ L coupled reaction product conversion in Stbl3 E. coli competent, after monoclonal bacterium colony grows, choose 3-5 monoclonal bacterium colony and carry out shaking bacterium amplification culture; Finally use the little extraction reagent kit of plasmid to extract plasmid and carry out sequence verification and correctly obtain the restructuring positive plasmid pAAV-Heavy carrying heavy chain DNA fragmentation afterwards;
Carry out BstBI-SalI double digestion respectively to above-mentioned light chain full length DNA fragment and above-mentioned restructuring positive plasmid pAAV-Heavy, recovery digestion products obtains the light chain DNA fragments after enzyme action and enzyme action carrier respectively; Light chain DNA fragments after enzyme action and enzyme action carrier are prepared T4 coupled reaction system, and 16 DEG C of connections are spent the night; Then get and connect product conversion in Stbl3 E. coli competent, after monoclonal bacterium colony grows, choose 3-5 monoclonal and carry out shaking bacterium amplification culture; Finally use the little extraction reagent kit of plasmid to extract plasmid and carry out sequence verification and correctly obtain the adeno-associated virus plasmid pAAV-IgG carrying heavy chain and light chain DNA molecular afterwards;
Repeat above-mentioned steps, thus obtain the adeno-associated virus plasmid that three groups are carried heavy chain and light chain DNA molecular, immunologic test point molecules corresponding different respectively.
In the Freestyle293 culture medium of serum-free, cultivate HEK293 suspension cell, maintenance cell density is 4x10
5~ 3x10
6individual cell/mL; First 1 day of transfection, adjustment cell density is 1x10
6cell/mL; Then centrifugal treating collecting cell precipitation, by culture medium re-suspended cell precipitation, adjustment cell density is 3x10
6individual cell/mL; The amount being 3 μ g/mL according to final concentration adds the above-mentioned adeno-associated virus plasmid carrying heavy chain and light chain DNA molecular, and shaking table vibrates; Then the amount being 9 μ g/mL according to final concentration adds PEI, and on shaking table, shaken cultivation is spent the night; Then add culture medium diluting cells, continue cultivation 3 days; Centrifugal cultivating system, after collecting cell precipitation, by PBS re-suspended cell precipitation, adds the all-round nuclease (Benzonase Nuclease) of final concentration to 5U/mL, hatches 1h for 37 DEG C after three freeze thawing; Last centrifugal treating, draws supernatant, carries out the AAV virus that column purification obtains carrying immunologic test point antibody molecule encoding gene.
Adeno-associated virus (Adreno-Associated Virus, AAV) involved in the present invention is one of member of Parvoviridae (Parvoviridae) family.This family member be a class small, without tunicle and the virus with icosahedral structure of virus.The diameter of virion between 20 ~ 26nm, containing the wire single stranded DNA genome of size at about 4.7kb.AAV is a kind of defective virus, it copy and breed the existence depending on helper virus.AAV can not be independently duplicated, only when helper virus (as adenovirus, herpes simplex virus, vaccinia virus) exists, just can carry out copying and infect with cytolytic, otherwise can only set up lysogeny latent infection.When not polluting containing helper virus, it is I level (the safest) that AAV serotype I-IV and replication defect type restructuring AAV is assessed as biological safety level by NIH and FDA.
Immune enhancing agents of the present invention is through infecting in T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell, improve the ability of the activation of immunocyte, propagation and secrete cytokines, namely strengthen the killing ability of immunocyte.The immunocyte that killing ability strengthens is fed back to human body, can express the antibody that blocking immunity suppresses signal transmission, can improve immunological effect further, make immunocyte to identify better and to kill tumor cell.
Immune enhancing agents of the present invention, immunostimulant system are applied in the adoptive immunity oncotherapy of external autologous or allosome, and the tumor type for the treatment of comprises neoplastic hematologic disorder (such as leukemia, lymphoid malignancy) and optimum and malignant solid tumor; The example of solid tumor such as sarcoma and cancer comprises liposarcoma, mesothelioma, outstanding Yin Shi tumor, colon cancer, lymphoid malignancy, cancer of pancreas, breast carcinoma, pulmonary carcinoma, ovarian cancer, carcinoma of prostate, hepatocarcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, syringocarcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cancer of biliary duct, cervical cancer, tumor of testis, spermocytoma, bladder cancer, melanoma and CNS tumor.
Because technique scheme is used, the present invention compared with prior art has the following advantages:
(1) the present invention prepares the recombinant adeno-associated virus carrying immunologic test point antibody molecule encoding gene first, the immunocyte of cultured and amplified in vitro is infected with it, it is made to express immunologic test point antibody molecule, thus close the immune negative regulation of one or more immunologic test point mediation, improve the ability of the activation of immunocyte, propagation and secrete cytokines, realize the sustained activation of immunocyte.
(2) the present invention utilizes AAV that the encoding gene of antibody is transported to immunocyte, be fed back to again in patient body, long-term expression antibody is carried out by immunocyte, what can realize that antibody enters after in body is long-lasting, overcome and directly adopt biological engineering means to obtain the recombinant antibodies problem that the half-life is shorter in vivo, substantially prolongs the effect that its closed immunologic test point is combined with respective ligand, thus improve the immunologic function of immunocyte, add the curative effect to tumor.
(3) the present invention removes the gene of wild type AAV virus, only retain two ends ITR sequence, remove the characteristic that AAV is integrated into human body chromosome, build restructuring AAV, the antioncogene inactivation that random integration can be avoided to bring and the potentially danger of protooncogene activation, thus substantially increase its safety further.
(4) the open immune enhancing agents of the present invention is motivated, and means are efficient, and raw material sources are extensive, and cost is low, and is convenient to storage and transport, is convenient to industrialization production and quality control; Use adopting in therapeutic process, externally can to complete, easy and simple to handle, provide safeguard for adoptive immunotherapy obtains substantial clinical therapeutic effect.
Accompanying drawing explanation
Fig. 1 is adeno-associated virus plasmid construct schematic diagram;
Fig. 2 is cytokine secretion expression figure;
Fig. 3 is cytokine secretion expression figure;
Fig. 4 is cytokine secretion expression figure;
Fig. 5 is cytokine secretion expression figure;
Fig. 6 is cell cycle distribution figure;
Fig. 7 is cell genomic dna agarose gel electrophoresis figure;
Fig. 8 is Hoechst nuclei dyeing chromatic graph;
Fig. 9 is before and after intravenous injection adeno-associated virus of the present invention, mouse liver and renal tissues pathology slice map.
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the invention will be further described
Immune enhancing agents of the present invention, namely by the gene order of encoding immune checkpoint monoclonal antibody is recombinated on adeno-associated virus, after infection immunity cell, the antibody of expressing can close the suppression signal path of immunologic test point mediation, thus directly can block the immune negative regulation mechanism that these immunologic test points cause, the activation of effective raising immunocyte, improve immunocyte to the kill capability of tumor cell, concrete preparation process is as follows.
The structure of embodiment one immune enhancing agents and preparation
(1) according to the corresponding relation of table 1, the heavy chain of 10 codified immunologic test point monoclonal antibodies and the full length DNA sequence of light chain is synthesized.Heavy chain DNA full length sequence is by signal peptide DNA sequence, variable region of heavy chain DNA sequence, and CH DNA sequence forms; The DNA full length sequence of light chain is made up of signal peptide DNA sequence, variable region of light chain DNA sequence, constant region of light chain DNA sequence, and concrete sequence is see sequence table.
The viral code name built in aminoacid sequence corresponding to antibody molecule variable region, table 1 encoding immune checkpoint, nucleotide base sequence and the present invention
Comprise 5 heavy chain full length DNA sequences and 5 light chain full length DNA sequences altogether; Article 10, the signal peptide region sequence of DNA sequence is all unanimously SEQ ID NO:21, and corresponding encoding amino acid sequence is consistent; Article 5, the light chain constant region sequence of heavy chain is homogeneous causes as SEQ ID NO:22, and corresponding encoding amino acid sequence is consistent; Article 5, the constant light chain sequences of light chain is all unanimously SEQ ID NO:23, and corresponding encoding amino acid sequence is consistent.The aminoacid sequence of signal peptide district, constant region is prior art.
By every bar full length DNA sequence respectively by multiple single strain oligonucleotide (Oligo) fragment having forward and reverse complementation of overlay region of synthesis, be spliced to form the PCR primer fragment of double-stranded DNA through archaeal dna polymerase chain reaction (PCR); PCR reaction condition: Oligo fragment mixture 10 μ l, 5x buffer 10 μ l, 10mmol dNTP 1 μ l, Taq archaeal dna polymerase 1ul, adds ultra-pure water to 50ul; PCR response procedures, denaturation 98 DEG C, 1 minute, 30 circulations (98 DEG C 10 seconds, 52 DEG C 30 seconds, 72 DEG C 45 seconds), 72 DEG C extend 5 minutes after, be cooled to 4 DEG C; After fragment utilizes gel PCR primer Purification Kit after gel electrophoresis, being connected by T4 DNA is cloned in pUC18-T carrier, after sequence verification is correct, obtains the recombinant cloning vector plasmid carrying correct target DNA fragment, 10 recombinant cloning vector plasmids can be obtained;
With above-mentioned recombinant cloning vector plasmid for template, pcr amplification is carried out respectively under primer (SEQ ID NO:24-SEQ ID NO:27) exists, according to such as lower volume preparation PCR reaction system: 5x PCR buffer 10 μ L, dNTP mix 4 μ L, the each 1 μ L of forward and reverse primer of 10 μMs, recombinant cloning vector plasmid template 50ng, Taq enzyme 1 μ L, finally supplies volume to 50 μ L with ultra-pure water; Be set as follows PCR response procedures, denaturation 98 DEG C, 1 minute, 30 circulations (98 DEG C 10 seconds, 52 DEG C 30 seconds, 72 DEG C 45 seconds), 72 DEG C extend 5 minutes after, be cooled to 4 DEG C.Compound concentration is 1% agarose, and PCR product is carried out agarose gel electrophoresis, 120V electrophoresis 20 minutes, according to molecular weight standard, heavy chain or band corresponding to light chain is cut down, and uses DNA gel to reclaim test kit and reclaims.Reclaim PCR primer, obtain DNA fragmentation; Totally 10 DNA fragmentations can be obtained, wherein 5 heavy chain full length DNA fragments, 5 light chain full length DNA fragments;
Described primer sequence is:
Primer (SEQ ID NO:24): CCTCGAGATGGGATGGTCCTGTATTATCCTGT before heavy chain
Primer (SEQ ID NO:25): TAGATCTTCACTTGCCCAGGGACAGGGACAGG after heavy chain
Primer (SEQ ID NO:26): GATTCGAAGCCGCCACCATGGGATGGTCCTGTATTATCC before light chain
Primer (SEQ ID NO:27): CGGTCGACCTTATCAGCATTCGCCTCTATTGAAA after light chain
Heavy chain, light chain primer is selected respectively for heavy chain DNA and light chain DNA.
(2) preparation of adeno-associated virus plasmid;
Get in the DNA fragmentation of step (1), the heavy chain full length DNA fragment that PD-1 is corresponding and the light chain full length DNA fragment with its pairing, to heavy chain full length DNA fragment, object carrier pAAV-MCS-IRES(purchased from Cell Biolabs Inc) carry out XhoI-BglII double digestion respectively, double digestion system is DNA fragmentation 30 μ L, enzyme respectively gets 1 μ L, NEB cutsmart buffer 5 μ L, supplies volume to 50 μ L with ultra-pure water, double digestion condition is 37 DEG C of enzyme action 2 hours, by the heavy chain DNA fragmentation after enzyme action and linear object carrier according to heavy chain DNA fragmentation: object carrier mol ratio is the ratio of 3: 1, preparation T4 coupled reaction system, 16 DEG C of connections are spent the night, then 10 μ L coupled reaction product conversion are got in Stbl3 E. coli competent, concrete Transformation Program is 10 μ L are connected product be added in the Stbl3 competence of thawing on ice, be placed in ice 30 minutes, then 42 DEG C of 40 seconds thermal shocks are carried out, again ice is placed in 1 minute, add the LB fluid medium of 1mL37 DEG C of preheating, after incubator cultivates 1 hour, get 40 μ L antibacterials even spread on the LB agar plate containing ammonia benzyl resistance, LB flat board is placed in 37 DEG C of incubator incubated overnight, after monoclonal bacterium colony grows, choose 3-5 monoclonal to carry out shaking bacterium amplification culture, finally use the little extraction reagent kit of plasmid to extract plasmid and carry out sequence verification and correctly obtain the restructuring positive plasmid pAAV-Heavy carrying heavy chain DNA fragmentation afterwards,
Respectively BstBI-SalI double digestion is carried out to light chain full length DNA fragment and above-mentioned restructuring positive plasmid pAAV-Heavy, double digestion system is DNA fragmentation 30 μ L, enzyme respectively gets 1 μ L, NEB cutsmart buffer 5 μ L, supply volume to 50 μ L with ultra-pure water; Double digestion condition is 37 DEG C of enzyme action 2 hours; Recovery digestion products obtains the light chain DNA fragments after enzyme action and enzyme action carrier; By the light chain DNA fragments after enzyme action and enzyme action carrier according to light chain DNA fragments: enzyme action carrier mol ratio be 3: 1 ratio arrange, preparation T4 coupled reaction system, 18 DEG C of connections are spent the night; Then get and connect product conversion in Stbl3 E. coli competent, concrete Transformation Program is 10 μ L are connected product be added in the Stbl3 competence of thawing on ice, be placed in ice 30 minutes, then 42 DEG C of 40 seconds thermal shocks are carried out, again ice is placed in 1 minute, add the LB fluid medium of 1mL37 DEG C of preheating, after incubator cultivates 1 hour, get 40 μ L antibacterials even spread on the LB agar plate containing ammonia benzyl resistance, LB flat board is placed in 37 DEG C of incubator incubated overnight, after monoclonal bacterium colony grows, choose 3-5 monoclonal and carry out shaking bacterium amplification culture; Finally use the little extraction reagent kit of plasmid to extract plasmid and carry out sequence verification and correctly obtain the adeno-associated virus plasmid pAAV-IgG carrying heavy chain and light chain molecule afterwards; Accompanying drawing 1 is its structural representation, and the light chain of antibody molecule and heavy chain DNA fragmentation sub-clone are in pAAV-IRES-MCS carrier, and wherein light chain DNA fragments is placed between CMV promoter and IRES, after heavy chain DNA fragmentation is placed in IRES sequence.
To a heavy chain DNA fragmentation and a light chain DNA fragments of pairing mutually in other DNA fragmentation; Repeat above-mentioned steps, thus obtain 5 the adeno-associated virus plasmids carrying heavy chain and light chain molecule, corresponding three immunologic test point antibody molecules.
(3) in the Freestyle293 culture medium of serum-free, cultivate HEK293 suspension cell, maintenance cell density is 2x10
6individual cell/mL; First 1 day of transfection process, adjustment cell density is 1x10
6cell/mL, incubated overnight; Then centrifugal treating collecting cell precipitation, by culture medium re-suspended cell precipitation, adjustment cell density is 3x10
6individual cell/mL; The amount being 3 μ g/mL according to final concentration adds the adeno-associated virus plasmid carrying heavy chain and light chain molecule of step (2), and shaking table vibrates; The amount being so 9 μ g/mL according to final concentration adds PEI, and on shaking table, shaken cultivation is spent the night; Then add isopyknic culture medium diluting cells with cell culture fluid, continue cultivation 3 days; Centrifugal cultivating system, after collecting cell precipitation, by PBS re-suspended cell precipitation, adds the all-round nuclease of final concentration 5U/mL, hatches 1h for 37 DEG C after freeze thawing; Last centrifugal treating, draws supernatant, carries out column purification and obtain recombinant adeno-associated virus, for carrying the AAV virus of immunologic test point antibody molecule encoding gene; See table 1, this step obtains 5 kinds of recombinant adeno-associated virus, is divided into three groups, also corresponding with the DNA sequence of step (1).
(4) preparation of immune enhancing agents; One or several in the recombinant adeno-associated virus obtain step (3) add in the buffer of normal saline or PBS, and mixing, obtains immune enhancing agents.The present embodiment can obtain the immune enhancing agents that 25 classes combine for different immunologic test point.
The external release of cytokines experimental verification of embodiment two
Adopt human lymphocyte separating medium (Lymphoprep) reagent separating peripheral blood mononuclear cells (PBMC cell) from human peripheral, and use RPMI1640,10%FBS to cultivate, be divided into blank group, matched group, experimental group.
First group is added PHA in the medium and activates periphery blood T cell, be blank group; Second group be PHA activate T cell and tumor cell (lung carcinoma cell HCC829) Dual culture group, before carrying out Dual culture, first IFN-γ process tumor cell 24 hours are used, to improve the expression of immunologic test point molecule ligand (as PD-L1 molecule etc.) at tumor surface, then three times are washed with after removing the INF-γ in culture medium by PBS, the T cell adding activation carries out Dual culture, is matched group; Experimental group is on the basis of second group of co-culture system, adds the different immune enhancing agents obtained by case study on implementation one respectively and (with normal saline, virus titer is adjusted to same concentration 5 × 10
13vg/mL); Infect after 48 hours.Get the culture medium supernatant of above-mentioned each group of system respectively, adopt ELISA to check the secreting, expressing of cytokine IL2, IFN-γ etc.
In experimental group, virus combination that the first immune enhancing agents comprises is I-1:III-5=1:1; The second is combined as II-3:III-4=3:1; The third is combined as I-2:II-3:III-4=1:3:1; 4th kind is combined as I-1:II-3:III-5=3:3:1; 5th kind is combined as I-1:II-3=1:1; 6th kind is combined as I-1:II-3:III-5=1:2:1; 7th kind is I-2; 8th kind is II-3; 9th kind is III-4.Virus code name is see table 1, and ratio is virion number ratio.
Cytokine release assay result:
Accompanying drawing 2-5 is cytokine secretion expression figure, wherein the first combination of experimental group of accompanying drawing 2 correspondence; Experimental group the second combination of accompanying drawing 3 correspondence; The third combination of the experimental group of accompanying drawing 4 correspondence; Experimental group the 4th kind combination of accompanying drawing 5 correspondence.
Can find out, after PHA activated T cell, corresponding cytokine secretion expression all significantly raises, and after tumor cell Dual culture, the expression of cytokine all significantly reduces; Add in different immune enhancing agents to above-mentioned co-culture system, along with adding increasing of immune enhancing agents consumption, the ability being subject to the T cell secrete cytokines (IL-2 and IFN-γ) of inhibiting tumour cells progressively improves, and even returns to the level not having tumor cell to suppress.
Due to the part of tumor cell surface expression immunosuppressant checkpoint albumen, by the combination of receptor and part, deliver negative regulation signal to T cell, cause the cytokine secretion ability of T cell to reduce; When the recombinant adeno-associated virus of the immunologic test point albumen carrying combination is joined after in co-culture system, virion enters into T cell, great expression immunosuppressant checkpoint protein antibodies, the recombinant antibodies of expressing is with the immunosuppressant checkpoint protein binding on T cell surface or after being combined with the associated ligands of tumor cell surface, block the combination of this tumor cell surface part and T cell surface receptor, thus prevent tumor cell from transmitting negative regulation signal to immunocyte, realize the sustained activation of T cell and the lasting lethal effect to tumor cell.
The immunocyte of embodiment three secretory immune checkpoint antibody is to the apoptosis-induced effect of tumor cell
Adopt human lymphocyte separating medium (Lymphoprep) reagent separating peripheral blood mononuclear cells (peripheral blood mononuclear cell, PBMC) cell from human peripheral, and use RPMI1640,10%FBS to cultivate.Add PHA in the medium and activate periphery blood T cell action effect cell; Use IFN-γ process tumor cell 24 hours, to improve the immunologic test point ligand molecular of tumor cell surface, as PD-L1 molecule, at the expression of tumor surface, then three times are washed to remove the IFN-γ in culture medium by PBS, through the tumor cell (hepatocellular carcinoma H22) of IFN-γ process as target cell.The effector lymphocyte of activation is divided into two groups, get wherein one group of a kind of immune enhancing agents (immunologic test point adeno-associated virus combination I-2:II-3:III-4=1:3:1) added in embodiment one, pairing effect cell infects, can secreting, expressing immunologic test point antibody, at viral infection after 48 hours, the effector lymphocyte and target cell that express immunologic test point antibody are carried out Dual culture, as experimental group, another group effector lymphocyte directly and target cell Dual culture, and as controlled trial group; Target cell, after 48 hours, is divided into three parts by Dual culture, gets the change that a part of cell carries out flow cytometry cell cycle, another part of cell adopts genome to extract test kit, extract full cellular genome, row agarose gel electrophoresis of going forward side by side is tested, and detects the genome crack conditions of apoptotic cell; Remaining cell carries out Hoechst dyeing, the change of observation of cell caryogram.
Cell induction apoptosis result
Accompanying drawing 6 is cell cycle testing result.Matched group tumor cell G0/G1 phase cell proportion is that 45%, S phase cell proportion accounts for 22.8%, G2/M phase cell and is about 32.2%, and show that Growth of Cells is comparatively normal, the T cell of activation does not make a significant impact the cycle of tumor cell; Compared with matched group, after expressing the immunocyte process tumor cell of immunologic test point antibody in experimental group, there is obvious apoptosis in tumour cell cycle, and sub-G0/G1 phase cell is about 22.5%, G0/G1 phase cell proportion is 50%, and S phase and G2/M phase cell proportion are reduced to 10% and 17.5% respectively.
Accompanying drawing 7 is cellular genome agarose gel electrophoresis experimental result.Result shows, the genome of matched group tumor cell is comparatively complete (swimming lane 1,2), and in experimental group (swimming lane 3), due to tumor cell generation apoptosis, its genomic DNA is fractured into the small molecule DNA about a hundreds of base.
Accompanying drawing 8 is Hoechst nuclear targeting result.Fig. 8-A is cellular control unit core, and nucleus fluorescent color is even, and Fig. 8-B is experimental group group nuclear targeting result, nuclear collapse, in the graininess fluorescence that dense dye is fine and close, and fluorescence radiation intensity heterogeneity.
Embodiment four immunostimulant system is prepared
Adopt human lymphocyte separating medium (Lymphoprep) reagent from human peripheral, be separated PBMC cell, and use lymphocyte culture fluid re-suspended cell, add recombinanthumanifn-γ in the medium at 37 DEG C, 5% CO
2cultivate after 24 hours, in culture medium, add anti-CD3, IL-1 and IL-2, continue to cultivate 48-72 hour, carry out half amount and change liquid, and supplement IL-2, continuous culture 14 days, uses brine cell 3 times, to remove original cytokine in culture medium, collected by centrifugation suspension cell, the immunocyte obtained is cytokine induced kill cell, is the foreign cell group that is main effects cell with the T cell of CD3+CD56+, comprises the T lymphocyte of CD8+ simultaneously.Institute's cultured cell is divided into three groups:
First group of cell directly as a control group; Add a kind of immune enhancing agents obtained by case study on implementation one in second group of cell, comprise recombinant adeno-associated virus II-3 and recombinant adeno-associated virus III-4, ratio 2: 1; 3rd group is in cell, add another immune enhancing agents obtained by case study on implementation one, comprises recombinant adeno-associated virus I-1, II-3 and recombinant adeno-associated virus III-5, ratio 2: 2: 1.Described with the addition of in cell culture system the present invention of immune enhancing agents is called immunostimulant system, the present invention is directed to a kind of immunocyte and can obtain 25 kinds of immunostimulant systems.The present embodiment is that the system that cytokine induced kill cell with the addition of immune enhancing agents is called immunostimulant system M and immunostimulant system N for immunocyte.
Embodiment five mice is verified
Select NOD/SCID mice (Chinese medicine Ke Yuan institute of lab animals); subcutaneous vaccination expressing luciferase tumor cell; (method is with reference to Ito M to build mice-transplanted tumor model; Hiramatsu H; Kobayashi K; Suzue K, Kawahata M, Hioki K et al. NOD/SCID/ γ mouse:an excellent recipient mouse model for engraftment of human cells. Blood 2002; 100:3175-82).The tumor-bearing mice with similar body weight and tumor size is divided into four groups, often organizes 10.Matched group in the embodiment four of first group of injected in mice same volume, but do not add immune enhancing agents of the present invention; Second group of cultured cell in second group of injection embodiment four, containing immune enhancing agents, i.e. immunostimulant system M; The 3rd group of cultured cell in 3rd group of injection embodiment four, containing immune enhancing agents, i.e. immunostimulant system N; 4th group of mice passes through tail vein injection saline; Continuous Observation 30 days, every 5 days once, extracts mouse peripheral blood, detects antibody-secreting expression, carry out living imaging experiment simultaneously by luciferase, the change situation of record gross tumor volume.
Result shows second group and the 3rd group except individual mice death, the expression of immunologic test point antibody molecule all can be detected in the peripheral blood of survival mice, the mice of injecting immune Contrast agent, it carries gross tumor volume and all obviously reduces, and mice food-intake and body weight all increase; By contrast, the first, the 4th group of mice (injecting normal saline or contrast T cell group) within the Continuous Observation phase, obviously accelerate by tumor growth, and the food-intake of mice reduces gradually, and individual mice occurs dead; Matched group and the dead quantity of experimental mice are without significant difference.Injection I-1 II-3 the mouse tumor average external volume of III-5 be about 0.0563 ± 0.0169cm
3, injection II-3 the mouse tumor average external volume of III-4 be about 0.069 ± 0.0102cm
3, the mouse tumor average external volume of injection contrast T cell group is about 0.087 ± 0.0102cm
3, the tumor average volume of injecting normal saline mice is about 0.12 ± 0.0202cm
3, the mice of injecting immune reinforcing agent, its gross tumor volume is significantly less than matched group (p<0.05), and injection containing I-1 II-3 III-5 virus group Contrast agent, gross tumor volume reduces further, but does not produce significant difference.After the observation phase terminates, tumor tissues is peeled off in Mice Body and weighs, the tumor tissue weight average out to 2.87 ± 1.11g of result injecting normal saline control mice group, mouse tumor 2.35 ± the 0.51g of injection contrast T cell group, II-3 the tumor tissues average weight of III-4 mice be 1.614 ± 0.35g, I-1 II-3 the tumor tissues average out to 1.59 ± 0.43g of III-5 mice, the tumor weight of experimental group is significantly less than matched group.
The anxious poison experiment of embodiment six animal
Choose the mice (male and female half and half, body weight 18-22g, difference are no more than 2g) in 6-8 age in week, mice is divided into five groups, often organize 10 mices, wherein matched group is through tail vein injection 500 uL normal saline, get one group through the unloaded adeno-associated virus granule of tail vein injection 500uL, its excess-three group experimental group, through all 5 kinds of recombinant adeno-associated virus (comprising the viral mixed in equal amounts agent of I-1, I-2, II-3, III-4, III-5) of tail vein injection 500 uL embodiment one, is respectively 5 kinds of virus mixing accumulated dose 5x10 with basic, normal, high dosage
9vg/g body weight, 5x10
10vg/g body weight, 2.5x10
11vg/g body weight is injected.
Before the injection, observe every day and record the situation of Mouse Weight, feed, water inlet, pay close attention to undue toxicity's symptom, Continuous Observation day, comprise action (unease, move), nervous system reaction (lift tail, tremble, spasm, attitude are abnormal), autonomic nervous system reaction (shed tears, urinate, hair is upright, breathe abnormal) and dead more.After dead mouse and after suddenly poison experiment terminates, mice is dissected and histological observation is carried out to each organs and systems.Bliss method is adopted to calculate LD50 and maximum tolerated dose.
The anxious malicious experimental result of animal, injection adeno-associated virus group and saline control group all dying or dead without animal; Low dose group two mices and high dose group mice all observe rapid breathing, limbs fatigue phenomenon after administration, but all recover in 2 minutes; Other animals all do not observe overt toxicity reaction at duration of test.To before administration and after administration the 2nd, 4,7, within 14 days, the weight of animals weighs, the male body weight upon administration of recombinant adenovirus middle and high dosage group increases slightly to be delayed in negative control group, but is showed no significant difference, and other show no obvious abnormalities, cohersive and integrated data is in table 2 (comparing with matched group, * p < 0.05).Administration treated animal food ration and matched group basically identical, show no obvious abnormalities, individual data items refers to table 3 (every 5 animal 1 cages, each detect 2 days ingest, average food ration=(addition-surplus)/2/5).Observe 14 days after animals administer, carried out pathological anatomy in the 15th day, administration group and matched group each major organs gross examination do not find obvious morphological abnormalities, refer to liver and the renal tissues pathology section comparison diagram of accompanying drawing 9 control mice and high dose group mice.
Body weight statistic summary table (x ± s, n=10) before and after table 2 animals administer
[0056]table 3 recombinant adenovirus mice single intravenous injection administration toxicity test animal average food ration individual data items table
SEQUENCE LISTING
<110> Ai Kang get biomedical technology (Suzhou) company limited
<120> immune enhancing agents
<160> 27
<170> PatentIn version 3.3
<210> 1
<211> 113
<212> PRT
<213> artificial sequence
<400> 1
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Tyr Ser Phe Ser Asn Tyr
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Trp Ser Asp Gly Ser Gly Arg Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser
100 105 110
Ser
<210> 2
<211> 96
<212> PRT
<213> artificial sequence
<400> 2
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Gly Ser Gln Ser Val Val Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Thr Arg Ala Thr Gly Val Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg
85 90 95
<210> 3
<211> 113
<212> PRT
<213> artificial sequence
<400> 3
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Ser Ser
20 25 30
Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Val Ile Trp Gly Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe
65 70 75 80
Leu Gln Met Ser Ser Val Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Thr Gln Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser
100 105 110
Ser
<210> 4
<211> 96
<212> PRT
<213> artificial sequence
<400> 4
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ile Ser Tyr
20 25 30
Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Asp Asn Trp Pro Arg
85 90 95
<210> 5
<211> 122
<212> PRT
<213> artificial sequence
<400> 5
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Thr Ser Gly Phe Ser Phe Ser Thr Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ser Ile Phe Gly Lys Ala His Tyr Ala Gln Lys Phe Gln
50 55 60
Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met
65 70 75 80
Glu Leu Asn Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Phe Cys Ala
85 90 95
Arg Lys Phe His Phe Val Ser Phe Tyr Tyr Phe Gly Met Asp Val Trp
100 105 110
Gly Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210> 6
<211> 95
<212> PRT
<213> artificial sequence
<400> 6
Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Ser Asn Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Asn Leu Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro
65 70 75 80
Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Trp Ser Asn Trp Pro
85 90 95
<210> 7
<211> 118
<212> PRT
<213> artificial sequence
<400> 7
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr
20 25 30
Trp Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Thr Phe Ile Ser Pro Asp Gly Asn Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys
85 90 95
Ala Arg Thr Gly Trp Leu Gly Pro Gly Asp Tyr Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser
115
<210> 8
<211> 108
<212> PRT
<213> artificial sequence
<400> 8
Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Gly Ser Ser Ser Val Gly His Ser
20 25 30
Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu
35 40 45
Ile Tyr Asp Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu
65 70 75 80
Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Trp Tyr Ser Ser Pro
85 90 95
Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105
<210> 9
<211> 118
<212> PRT
<213> artificial sequence
<400> 9
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Thr Phe Ile Asn Gly Ser Ser Asn Asn Lys Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Ile Tyr Tyr Cys
85 90 95
Ala Arg Thr Gly Trp Leu Gly Pro Tyr Asp Val Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser
115
<210> 10
<211> 108
<212> PRT
<213> artificial sequence
<400> 10
Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Gly His Ser
20 25 30
Tyr Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu
35 40 45
Ile Tyr Gly Ala Phe Ser Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser
50 55 60
Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu
65 70 75 80
Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro
85 90 95
Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105
<210> 11
<211> 339
<212> DNA
<213> artificial sequence
<400> 11
caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60
gattgcaaag cgagcggcta tagctttagc aactatggca tgcattgggt gcgccaggcg 120
ccgggcaaag gcctggaatg ggtggcggtg atttggagcg atggcagcgg ccgctattat 180
gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgttt 240
ctgcagatga acagcctgcg cgcggaagat accgcggtgt attattgcgc gaccaacgat 300
gattattggg gccagggcac cctggtgacc gtgagcagc 339
<210> 12
<211> 288
<212> DNA
<213> artificial sequence
<400> 12
gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60
ctgagctgcc gcggcagcca gagcgtggtg agctatctgg cgtggtatca gcagaaaccg 120
ggccaggcgc cgcgcctgct gatttatggc gcgagcaccc gcgcgaccgg cgtgccggcg 180
cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240
gaagattttg cggtgtatta ttgccagcag agcagcaact ggccgcgc 288
<210> 13
<211> 339
<212> DNA
<213> artificial sequence
<400> 13
caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60
gattgcaaag cgagcggcat tacctttagc agcagcggca tgcattgggt gcgccaggcg 120
ccgggcaaag gcctggaatg ggtggcggtg atttggggcg atggcagcaa acgctattat 180
gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgttt 240
ctgcagatga gcagcgtgcg cgcggaagat accgcggtgt attattgcgc gacccaggat 300
gattattggg gccagggcac cctggtgacc gtgagcagc 339
<210> 14
<211> 288
<212> DNA
<213> artificial sequence
<400> 14
gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60
ctgagctgcc gcgcgagcca gagcgtgatt agctatctgc attggtatca gcagaaaccg 120
ggccaggcgc cgcgcctgct gatttatggc gcgagcaacc gcgcgaccgg cattccggcg 180
cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240
gaagattttg cggtgtatta ttgccagcag tatgataact ggccgcgc 288
<210> 15
<211> 366
<212> DNA
<213> artificial sequence
<400> 15
caggtgcagc tggtgcagag cggcgcggaa gtgaaaaaac cgggcagcag cgtgaaagtg 60
agctgcaaaa ccagcggctt tagctttagc acctatgcga ttagctgggt gcgccaggcg 120
ccgggccagg gcctggaatg gatgggcggc attagcattt ttggcaaagc gcattatgcg 180
cagaaatttc agggccgcgt gaccattacc gcggatgaaa gcaccagcac cgcgtatatg 240
gaactgaaca gcctgcgcag cgaagatacc gcggtgtatt tttgcgcgcg caaatttcat 300
tttgtgagct tttattattt tggcatggat gtgtggggcc agggcaccac cgtgaccgtg 360
agcagc 366
<210> 16
<211> 285
<212> DNA
<213> artificial sequence
<400> 16
gaaattgtgc tgacccagag cccggcgacc ctgagcctga gcccgggcga acgcgcgacc 60
ctgagctgcc gcgcgagcca gagcattagc aactatctgg cgtggtatca gcagaaaccg 120
ggccaggcgc cgcgcctgct gatttatggc gcgagcaacc tggcgaccgg cattccggcg 180
cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctggaaccg 240
gaagattttg cggtgtatta ttgccagcag tggagcaact ggccg 285
<210> 17
<211> 354
<212> DNA
<213> artificial sequence
<400> 17
caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60
agctgcgcgg cgagcggctt tacctttacc agctattgga ttagctgggt gcgccaggcg 120
ccgggcaaag gcctggaatg ggtgaccttt attagcccgg atggcaacaa caaatattat 180
gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgtat 240
ctgcagatga gcagcctgcg cgcggaagat accgcgattt attattgcgc gcgcaccggc 300
tggctgggcc cgggcgatta ttggggccag ggcaccctgg tgaccgtgag cagc 354
<210> 18
<211> 324
<212> DNA
<213> artificial sequence
<400> 18
gaaattgtgc tgacccagag cccgggcacc ctgagcctga gcccgggcga acgcgcgacc 60
ctgagctgcc gcggcagcag cagcgtgggc catagctatc tggcgtggta tcagcagaaa 120
ccgggccagg cgccgcgcct gctgatttat gatgcgagca gccgcgcgac cggcattccg 180
gatcgcttta gcggcagcgg cagcggcacc gattttaccc tgaccattag ccgcctggaa 240
ccggaagatt ttgcggtgta ttattgccag cagtggtata gcagcccgtg gacctttggc 300
cagggcacca aagtggaaat taaa 324
<210> 19
<211> 354
<212> DNA
<213> artificial sequence
<400> 19
caggtgcagc tggtggaaag cggcggcggc gtggtgcagc cgggccgcag cctgcgcctg 60
agctgcgcgg cgagcggctt tacctttagc agctatgcga tgagctgggt gcgccaggcg 120
ccgggcaaag gcctggaatg ggtgaccttt attaacggca gcagcaacaa caaatattat 180
gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgtat 240
ctgcagatga acagcctgcg cgcggaagat accgcgattt attattgcgc gcgcaccggc 300
tggctgggcc cgtatgatgt gtggggccag ggcaccctgg tgaccgtgag cagc 354
<210> 20
<211> 324
<212> DNA
<213> artificial sequence
<400> 20
gaaattgtgc tgacccagag cccgggcacc ctgagcctga gcccgggcga acgcgcgacc 60
ctgagctgcc gcgcgagcca gagcgtgggc catagctatg tggcgtggta tcagcagaaa 120
ccgggccagg cgccgcgcct gctgatttat ggcgcgttta gccgcccgag cggcattccg 180
gatcgcttta gcggcagcgg cagcggcacc gattttaccc tgaccattag ccgcctggaa 240
ccggaagatt ttgcggtgta ttattgccag cagtatggca gcagcccgta tacctttggc 300
cagggcacca aagtggaaat taaa 324
<210> 21
<211> 57
<212> DNA
<213> artificial sequence
<400> 21
atgggatggt cctgtattat cctgttcctg gtcgctaccg ctactggggt gcatagt 57
<210> 22
<211> 981
<212> DNA
<213> artificial sequence
<400> 22
gccagcacaa agggcccctc cgtgttccca ctggctccct gcagcaggtc tacatccgag 60
agcaccgccg ctctgggctg tctggtgaag gattatttcc ctgagccagt gaccgtgagc 120
tggaactccg gcgccctgac atccggcgtg cacacctttc ctgctgtgct gcagtcttcc 180
ggcctgtaca gcctgagctc tgtggtgaca gtgccctcca gctctctggg caccaagaca 240
tatacctgca acgtggacca taagcctagc aataccaagg tggataagag ggtggagtct 300
aagtacggac ctccttgccc accttgtcct gctcctgagt tcctgggagg accttccgtg 360
ttcctgtttc ctccaaagcc taaggacaca ctgatgatct ctcggacacc tgaggtgacc 420
tgcgtggtgg tggacgtgtc ccaggaggat ccagaggtgc agttcaactg gtatgtggat 480
ggcgtggagg tgcacaatgc taagaccaag cctagggagg agcagtttaa ctccacatac 540
cgggtggtga gcgtgctgac cgtgctgcat caggactggc tgaacggcaa ggagtataag 600
tgcaaggtga gcaataaggg cctgccatcc agcatcgaga agacaatctc taaggccaag 660
ggccagccta gggagccaca ggtgtacacc ctgccccctt cccaggagga gatgacaaag 720
aaccaggtga gcctgacctg tctggtgaag ggcttctatc catctgacat cgctgtggag 780
tgggagtcca atggccagcc cgagaacaat tacaagacca caccacccgt gctggactcc 840
gatggcagct tctttctgta tagccggctg accgtggata agtctagatg gcaggagggc 900
aacgtgttct cctgctccgt gatgcacgaa gcactgcaca accattatac tcagaaaagc 960
ctgtccctgt ccctgggcaa g 981
<210> 23
<211> 354
<212> DNA
<213> artificial sequence
<400> 23
acctttggcc aaggcacaaa ggtggagatc aagcgaaccg tggccgctcc ttctgtcttc 60
atttttcccc ctagtgacga acagctgaaa agcgggacag cttccgtggt ctgtctgctg 120
aacaatttct atcccagaga ggccaaggtg cagtggaaag tcgataacgc tctgcagtca 180
ggcaatagcc aggagtccgt gactgaacag gactctaagg atagtaccta ctcactgtct 240
agtactctga ccctgtctaa agcagactat gaaaagcaca aagtctacgc ctgtgaagtg 300
acacaccagg ggctgagcag tccagtgacc aagagtttca atagaggcga atgc 354
<210> 24
<211> 32
<212> DNA
<213> artificial sequence
<400> 24
cctcgagatg ggatggtcct gtattatcct gt 32
<210> 25
<211> 32
<212> DNA
<213> artificial sequence
<400> 25
tagatcttca cttgcccagg gacagggaca gg 32
<210> 26
<211> 39
<212> DNA
<213> artificial sequence
<400> 26
gattcgaagc cgccaccatg ggatggtcct gtattatcc 39
<210> 27
<211> 34
<212> DNA
<213> artificial sequence
<400> 27
cggtcgacct tatcagcatt cgcctctatt gaaa 34
Claims (10)
1. an immune enhancing agents, is characterized in that: described immune enhancing agents comprises the AAV virus of carrying immunologic test point antibody molecule encoding gene; Described immunologic test point is one or several in PD-1, PD-L1, CTLA-4.
2. immune enhancing agents according to claim 1, it is characterized in that: when the viral AAV virus for carrying PD-1 antibody molecule encoding gene of the AAV carrying immunologic test point antibody molecule encoding gene is viral with the AAV carrying CTLA-4 antibody molecule encoding gene, the virion number ratio of the AAV virus of carrying PD-1 antibody molecule encoding gene and the AAV virus of carrying CTLA-4 antibody molecule encoding gene is (6 ~ 3): 1; When the viral AAV virus for carrying PD-L1 antibody molecule encoding gene of the AAV carrying immunologic test point antibody molecule encoding gene is viral with the AAV carrying CTLA-4 antibody molecule encoding gene, the virion number ratio of the AAV virus of carrying PD-L1 antibody molecule encoding gene and the AAV virus of carrying CTLA-4 antibody molecule encoding gene is (6 ~ 3): 1; When the AAV virus of carrying immunologic test point antibody molecule encoding gene for carry PD-1 antibody molecule encoding gene AAV virus, carry PD-L1 antibody molecule encoding gene AAV virus with when carrying the AAV virus of CTLA-4 antibody molecule encoding gene, the virion quantity sum of the AAV virus of carrying PD-1 antibody molecule encoding gene and the AAV virus of carrying PD-L1 antibody molecule encoding gene with carry the virion number ratio of AAV virus of CTLA-4 antibody molecule encoding gene for (6 ~ 3): 1.
3. immune enhancing agents according to claim 1, it is characterized in that: the aminoacid sequence of described PD-1 antibody molecule variable region of heavy chain is SEQ ID NO:1 or SEQ ID NO:3, the aminoacid sequence of variable region of light chain is SEQ ID NO:2 or SEQ ID NO:4; The aminoacid sequence of described PD-L1 antibody molecule variable region of heavy chain is SEQ ID NO:5, and the aminoacid sequence of variable region of light chain is SEQ ID NO:6; The aminoacid sequence of CTLA-4 antibody molecule variable region of heavy chain is SEQ ID NO:7 or SEQ ID NO:9, and the aminoacid sequence of variable region of light chain is SEQ ID NO:8 or SEQ ID NO:10.
4. immune enhancing agents according to claim 1, it is characterized in that: described in carry in the AAV virus of immunologic test point antibody molecule encoding gene, the DNA sequence of coding PD-1 antibody molecule weight chain variabl area sequence is SEQ ID NO:11 or SEQ ID NO:13; The DNA sequence of coding PD-1 antibody molecule light-chain variable sequence is SEQ ID NO:12 or SEQ ID NO:14; The DNA sequence of coding PD-L1 antibody molecule weight chain variabl area sequence is SEQ ID NO:15; The DNA sequence of coding PD-L1 antibody molecule light-chain variable sequence is SEQ ID NO:16; The DNA sequence of coding CTLA-4 antibody molecule weight chain variabl area sequence is SEQ ID NO:17 or SEQ ID NO:19; The DNA sequence of coding CTLA-4 antibody molecule light-chain variable sequence is SEQ ID NO:18 or SEQ ID NO:20.
5. immune enhancing agents according to claim 1, it is characterized in that, described antibody molecule is scFv Antibody molecule fragments, Fab antibody molecule fragment or full length antibody.
6. immune enhancing agents according to claim 1, is characterized in that: described immune enhancing agents also comprises the buffer of normal saline or PBS.
7. an immunostimulant system, is characterized in that: described immunostimulant system infects T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell in vitro by AAV virus of carrying immunologic test point antibody molecule encoding gene according to claim 1 and prepares.
8. immunostimulant system according to claim 7, it is characterized in that: being prepared as of described immunostimulant system adds AAV virus of carrying immunologic test point antibody molecule encoding gene according to claim 1 in the culture medium containing T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell, obtains immunostimulant system.
9. immunostimulant system according to claim 8, is characterized in that: described culture medium contains cytokine and nutritional labeling.
10. the method for an external enhancing immune cells factor releasability, it is characterized in that: comprise the following steps, AAV virus of carrying immunologic test point antibody molecule encoding gene according to claim 1 is added in the culture medium containing T cell, natural killer cell, cytotoxic T lymphocyte or cytokine induced kill cell, through infecting and cultivating, namely strengthen the release of cytokines ability of immunocyte.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510298011.7A CN104887717B (en) | 2015-06-04 | 2015-06-04 | A kind of immune enhancing agents |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510298011.7A CN104887717B (en) | 2015-06-04 | 2015-06-04 | A kind of immune enhancing agents |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104887717A true CN104887717A (en) | 2015-09-09 |
| CN104887717B CN104887717B (en) | 2019-05-31 |
Family
ID=54020960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510298011.7A Active CN104887717B (en) | 2015-06-04 | 2015-06-04 | A kind of immune enhancing agents |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104887717B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701691A (en) * | 2015-11-19 | 2017-05-24 | 爱康得生物医学技术（苏州）有限公司 | AAV virus capable of efficiently infecting immune cells and preparing method and application thereof |
| CN107012212A (en) * | 2017-03-24 | 2017-08-04 | 刘长胜 | Early diagnosis of cancer kit and its application based on Cell-free DNA |
| CN108670975A (en) * | 2018-04-28 | 2018-10-19 | 杭州星鳌生物科技有限公司 | Application of the endoplasmic reticulum receptor protein activator in preparing immunopotentiator drug |
| CN108700566A (en) * | 2016-02-19 | 2018-10-23 | 河谷控股Ip有限责任公司 | The method that immunogenicity is adjusted |
| CN111836896A (en) * | 2018-01-11 | 2020-10-27 | 变色龙生物科技股份有限公司 | Immune evasion vector and use thereof in gene therapy |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024054993A1 (en) * | 2022-09-09 | 2024-03-14 | Kriya Therapeutics, Inc. | Vector constructs for delivery of nucleic acids encoding therapeutic anti-ctla4 antibodies and methods of using the same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007123737A2 (en) * | 2006-03-30 | 2007-11-01 | University Of California | Methods and compositions for localized secretion of anti-ctla-4 antibodies |
| WO2008011344A2 (en) * | 2006-07-17 | 2008-01-24 | Nationwide Children's Hospital Inc. | Disruption of programmed death-1 (pd-1) ligands to adjuvant adeno-associated virus vector vaccines |
| CN104292334A (en) * | 2014-04-25 | 2015-01-21 | 河南省健康伟业生物医药研究股份有限公司 | Fully human anti-CTLA-4 monoclonal antibody, preparation method and application |
-
2015
- 2015-06-04 CN CN201510298011.7A patent/CN104887717B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007123737A2 (en) * | 2006-03-30 | 2007-11-01 | University Of California | Methods and compositions for localized secretion of anti-ctla-4 antibodies |
| WO2008011344A2 (en) * | 2006-07-17 | 2008-01-24 | Nationwide Children's Hospital Inc. | Disruption of programmed death-1 (pd-1) ligands to adjuvant adeno-associated virus vector vaccines |
| CN104292334A (en) * | 2014-04-25 | 2015-01-21 | 河南省健康伟业生物医药研究股份有限公司 | Fully human anti-CTLA-4 monoclonal antibody, preparation method and application |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701691A (en) * | 2015-11-19 | 2017-05-24 | 爱康得生物医学技术（苏州）有限公司 | AAV virus capable of efficiently infecting immune cells and preparing method and application thereof |
| CN106701691B (en) * | 2015-11-19 | 2020-02-14 | 爱康得生物医学技术（苏州）有限公司 | AAV capable of efficiently infecting immune cells, preparation method and application thereof |
| CN108700566A (en) * | 2016-02-19 | 2018-10-23 | 河谷控股Ip有限责任公司 | The method that immunogenicity is adjusted |
| US11585805B2 (en) | 2016-02-19 | 2023-02-21 | Nantcell, Inc. | Methods of immunogenic modulation |
| CN107012212A (en) * | 2017-03-24 | 2017-08-04 | 刘长胜 | Early diagnosis of cancer kit and its application based on Cell-free DNA |
| CN111836896A (en) * | 2018-01-11 | 2020-10-27 | 变色龙生物科技股份有限公司 | Immune evasion vector and use thereof in gene therapy |
| CN108670975A (en) * | 2018-04-28 | 2018-10-19 | 杭州星鳌生物科技有限公司 | Application of the endoplasmic reticulum receptor protein activator in preparing immunopotentiator drug |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104887717B (en) | 2019-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6899333B2 (en) | General-purpose killer T cells | |
| CN104887717B (en) | A kind of immune enhancing agents | |
| JP7546925B2 (en) | Therapeutic agents comprising nucleic acids and CAR-modified immune cells and uses thereof | |
| CN105949325B (en) | Chimeric antigen receptor, slow virus carrier and its application comprising CD27 intracellular domain | |
| CN107532174A (en) | Swivel base enzyme polypeptide and application thereof | |
| CN103502438A (en) | Method and compositions for cellular immunotherapy | |
| CN106535925A (en) | CAR based immunotherapy | |
| CN106659742A (en) | Genetically modified mesenchymal stem cells expressing an immune response-stimulating cytokine to attract and/or activate immune cells | |
| EA016168B1 (en) | Method for production of t cell population and use thereof | |
| CN105296431A (en) | Tumor binding specific gamma delta TCR gene modified alpha beta T cell and cancer suppression application thereof | |
| CN108070607A (en) | Target Chimeric antigen receptor of CD19-41BB-tEGFR and application thereof | |
| JP7239911B2 (en) | Therapeutic agents comprising oncolytic vaccinia virus and NK cells and their use for drugs for the treatment of tumors and/or cancers | |
| KR20090127973A (en) | A method for cultivating self activated lymphocyte | |
| CN111315402A (en) | T cell modification | |
| CN107793482A (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, CAR133 NKT cells and its preparation method and application | |
| CN106544365A (en) | A kind of preparation method and application of the CIK of the anti-CD19 Chimeric antigen receptors modification of people | |
| CN109776671A (en) | Cell, code nucleic acid, expression vector, preparation method, pharmaceutical composition and the application of isolated T cell receptor, its modification | |
| CN107557337A (en) | A kind of immunocyte of safety-type Chimeric antigen receptor modifications of anti-ROR1 and its application | |
| WO2024119686A1 (en) | Preparation method for and use of chimeric switch receptor gene modified nk cell | |
| CN111606999A (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signal pathway and blocking immune check point and application thereof | |
| CN108070608A (en) | Target Chimeric antigen receptor of CD19-CD28-tEGFR and application thereof | |
| WO2024119768A9 (en) | Method for preparing nk cells capable of reversing inhibitory signal from tumor microenvironment and application | |
| CN110352197A (en) | Chimeric catilan receptor | |
| CN111499766B (en) | Immune effector cell aiming at chronic lymphocytic leukemia, preparation method and application thereof | |
| CN107164412A (en) | A kind of safety-type anti-CEA Chimeric antigen receptors modify the preparation method and applications of T cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 215126 unit 210, A4 / F, bio nano Park, 218 Xinghu street, Suzhou Industrial Park, Suzhou City, Jiangsu Province Patentee after: Aikangde Biotechnology (Suzhou) Co.,Ltd. Address before: Room 205A, a7 / F, building 5, bio nano Park, 218 Xinghu street, Suzhou Industrial Park, Suzhou City, Jiangsu Province Patentee before: ICARTAB BIOMEDICAL Inc. |