CN104877020A - Plant nutrition storage protein (GmVSPB) gene - Google Patents

Abstract

A plant nutrition storage protein (GmVSPB) gene belongs to the technical field of genetic engineering and is characterized in that soybean Dongnong50 cotyledonary node is used as a material in suppression subtractive hybridization of differential gene when induced by cytokinin 6-BA so as to obtain a regeneration-associated gene and carry out gene cloning; a plant is transformed by agrobacterium-mediated transformation, changes of the transgenic plant are observed, gene functions are preliminarily analyzed by a quantitative RT-PCR method, and the influence of the cytokinin on regeneration is researched; starting from the influence of cotyledonary node organogenesis regeneration binding hormone on expression of soybean regeneration pathway associated transcription factor gene, effects of regenerating gene in a regeneration system are analyzed, and a soybean plant nutrition storage protein (GmVSPB) gene (Seq ID No:1) is found out.

Description

A kind of plant nutrition storage protein (GmVSPB) gene

Technical field

The present invention relates to a kind of plant nutrition storage protein (GmVSPB) gene, belong to gene engineering field.

Background technology

Soybean is the important grain of China and oil crops, but in the face of cultivated area reduces day by day, the situation that Food Security highlights day by day, break away from China's soybean supply nervous, solve the severe situation of soybean dependence on import, the paces of molecular breeding research must be accelerated, strive for increasing substantially the per unit area yield of China soybean and total product level in a short time.And biotechnology is the Main Means of molecular breeding, the critical support that biotechnology is applied in soybean breeder is exactly the regeneration system of efficient stable.Because soybean regeneration is by genotype effect, only has the regeneration system of minority soybean varieties more stable, therefore hinder the application of biotechnology in most soybean varieties.

Suppress ion subtractive hybridization (SSH, Suppression Subtractive Hybridization) be a kind of novel method of separating clone difference expression gene, proposed in 1996 by people such as Diatchenko, combine suppression PCR (Suppression PCR) technology and subtractive hybridization method is set up.Suppress ion subtractive hybridization (SSH) is a kind of method of the selective difference expressing gene in qualification, isolated cell tissue, principle is the cDNA Subtractive Hybridization Technique (Tang Jiangyun based on inhibition PCR, Zhang Tao, Zheng Jiakui, 2009), cDNA colony after suppressed subtractive hybridization is not only enriched difference expression gene, and between goal gene the difference of abundance through equalization effect basically eliminate, the cDNA colony obtained after abatement is the consistent goal gene colony of abundance (Wang Fang, 2011).SSH technology is widely used in animal and plant research field both at home and abroad.

The Study on tissue culture of soybean starts from the sixties in 20th century, but establishes the plant regeneration technique of tissue, cell, protoplastis level to the intermediary and later stages eighties, and soyabean tissue's training really enters developmental stage.Soyabean tissue cultivate explant except protoplastis and unicellular except, conventional also has embryo, cotyledon, cotyledonary node, true leaf and hypocotyl etc., there are two kinds of ways of regeneration: one is adventitious organogenesis, namely indefinite bud (or claiming Multiple Buds) is produced by the induction of explant, Buds formation adventive root, finally forms whole plant afterwards; Another kind of somatic embryo development ways, be that somatic embryos fetal hair is raw, embryo germination becomes regeneration plant.1993, Christianson etc. (1993) were that explant induction somatic embryo occurs with rataria, obtain regeneration plant first.Along with the development of research, the explant adopted afterwards mostly is immature embryo, hypocotyl and is widely used in now the cotyledonary node of conversion.Regeneration plant after induction produces indefinite bud on the substratum of phytokinin adding different sorts and concentration by the cultivation of these explants, substratum is MS or B5 minimum medium mainly, conventional plant hormone has 6-BA, NAA, IBA and IAA etc., concentrates the impacts on adventitious bud formation such as research genotype, type of culture medium, hormone concentration and explant kind.Up to now, successfully regenerable soybean plant is obtained using matured cotyledons, cotyledonary node and rataria axle etc. as the regeneration system of explant.Because the organogenetic explant of soybean has the features such as source is wide, the tissue culture time is short, therefore only regenerable soybean plant can be obtained with 3 months, the regeneration plant mosaic obtained like this is in the majority, screening difficulty is very large, makes qualification, screening is gone down to posterity and the workload of purifying regenerable soybean plant increases widely.

In the eighties in 20th century, it is found that a kind of special storage protein, extensively be present in vegetative organ, be different from seed storage protein, be called plant nutrition storage protein (vegetative storage proteins, VSP), first this storage protein finds in trees, is storage form as plant nitrogen source and is familiar with by people.The VSP of soybean identifies out from leaf, also studies the most deep with the Vegetative Storage Protein in Soybean Leaves.Soybean is the crop that the difficulty of generally acknowledging in the world transforms, and the High-efficient Genetic Transformation of soybean is also one of difficult point of plant genetic engineering field always.In succession report with soybean different tissues for explant both at home and abroad, to be occurred or embryo occurs and the regeneration plant that succeeds from Protoplast cuhnre by organ, but breakthrough progress is little, namely transformation efficiency does not also significantly improve.This situation have impact on the application of soybean transgene technology greatly, so the center of gravity of soybean transgene technical study should transfer to the foundation of soybean high-efficiency regeneration system and soybean regeneration associated genes genesis mechanism and regulatory factor aspect, by optimizing regeneration condition and analyzing the function of secondary gene and then improve the regenerative power of soybean, for setting up efficient, stable regeneration system and genetic conversion system lays the foundation.Regeneration associated genes can also carry out the selective marker such as substitute antibiotics, weedicide with the novel uncontested Biosafety marker gene of one, the regenerative power of recipient plant is improved while importing external source goal gene, significant to the security of plant transgene breeding efficiency and transgenosis new variety.At present, although less to the research of the regeneration associated genes of plant, in the plants such as model plant Arabidopis thaliana, paddy rice, more existing regulation and control regenerate research and the report of relevant transcription factor or gene, can be this research and establish certain theory guarantee.About plant regeneration genes involved to be cloned in report both at home and abroad very few, and the clone of soybean regeneration associated genes has no report especially, therefore, the regenerative power of soybean how is fundamentally improved by modern molecular biology technique, find the gene controlling soybean regeneration, solve soybean Regeneration System difficult, transform the difficult a great problem becoming urgent need and solve? so with soybean east agriculture 50 cotyledonary node for material, under phytokinin 6-BA induces, suppressed subtractive hybridization goes out differential gene, obtain regeneration associated genes and carry out gene clone, utilize agriculture bacillus mediated method conversion of plant, observe the change of transfer-gen plant, by the function of quantitative RT-PCR method initial analysis gene, research phytokinin is on the impact of regeneration, start with in conjunction with the expression impact of hormone on soybean Regeneration Ways correlated transcription factor gene from cotyledonary node adventitious organogenesis, analyze the effect of secondary gene in regeneration system, find secondary gene and gene cloned and transforms, from molecular level analyzing gene function and study its mechanism of action, be excavate soybean secondary gene, improve regeneration and the genetic transformation efficiency of soybean, it is necessary for inventing a kind of plant nutrition storage protein (GmVSPB) gene.

Summary of the invention

In order to be attempted the regenerative power fundamentally improving soybean by modern molecular biology technique, solve soybean Regeneration System difficult, transform a difficult difficult problem, the invention provides a kind of plant nutrition storage protein (GmVSPB) gene, this invention with soybean east agriculture 50 cotyledonary node for material, under phytokinin 6-BA induces, suppressed subtractive hybridization goes out differential gene, to obtaining regeneration associated genes and carrying out gene clone, utilize agriculture bacillus mediated method conversion of plant, observe the change of transfer-gen plant, by the function of quantitative RT-PCR method initial analysis gene, research phytokinin is on the impact of regeneration, start with from cotyledonary node adventitious organogenesis in conjunction with the expression impact of hormone on soybean Regeneration Ways correlated transcription factor gene, analyze the effect of secondary gene in regeneration system, search out soybean plants nutrition storage protein (GmVSPB) gene (Seq ID No:1).

the technical solution adopted for the present invention to solve the technical problems is:

A kind of plant nutrition storage protein (GmVSPB) of one of the present invention gene, is characterized in that adopting suppression subtractive hybridization to obtain GmVSPB gene (Seq ID No:1).Concrete steps are as follows:

A kind of plant nutrition storage protein (GmVSPB) gene of the present invention, is characterized in that adopting suppression subtractive hybridization to obtain GmVSPB gene (Seq ID No:1).Concrete steps are as follows: 1. suppression subtractive hybridization: first, obtain soybean cotyledon node and with 6-BA process; Then, extract the total serum IgE of soybean cotyledon node by the method for RNAiso Plus, adopt the synthesis of SMART (Switching Mechanism At 5 end of the RNA Transcript) technology cDNA, purifying double-strand cDNA, purifying RsaI enzyme is cut and product, joint connects, hybridization, the result that after analyzing subtractive hybridization, twice PCR increases, purified pcr product, build suppressed subtractive hybridization library, finally, clone gmVSPBgene (Seq ID No:1) to its sequential analysis.2. the bioinformatic analysis (Seq ID No:2) of GmVSPB gene.3. the plant expression vector construction of GmVSPB gene.4. the structure of intermediate carrier.5. GmVSPB plant expression vector transformation Agrobacterium: utilize freeze-thaw method that thing expression vector plasmid is proceeded to agrobacterium strains.After transforming, picking list bacterium colony shakes bacterium, extracts plasmid.Obtaining stripe size by pcr amplification is 977bp, shows successfully to be transformed in Agrobacterium by expression vector.I. the preparation of Agrobacterium and conversion: the competent preparation of i. Agrobacterium; Ii. the qualification of Agrobacterium-mediated Transformation.6. cotyledonary node method soybean transformation: by goal gene GmVSPB gene transferred plant body.II. the substratum used in cotyledonary node method soybean transformation: i. conversion; Ii. the acquisition of soybean seeds disinfectant cotyledonary node explant: 1. infect and Dual culture; 2. the induction of Multiple Buds and screening; 3. resistant buds elongation and take root; 4. the domestication of resistant plant. 7.the detection of transfer-gen plant: the extraction of I. transgenic soybean DNA: SDS in a small amount method extracts plant genomic DNA; II. the PCR qualification of transfer-gen plant; III. the detection of process LAN soybean.8. the tissue specific expression of GmVSPB gene: result shows gmVSPBgene expression amount in cotyledon is the highest, is secondly stem, root, can infer that this gene is in regeneration of cotyledons, plays certain effect in the elongation of stem.

beneficial effect of the present invention is: a kind of plant nutrition storage protein (GmVSPB) gene discovery:. 1. utilize the method for suppressed subtractive hybridization, with the cotyledonary node of soybean DN50 for material, using phytokinin 6-BA as inductive condition, construct the cDNA subtractive library of soybean regeneration associated genes.2. clone obtains GmVSPB gene, and successfully constructs the plant expression vector of GmVSPB gene.Encode 254 aminoacid sequences (Seq ID No:2) altogether in the CDS district of the 765bp of GmVSPB gene (Seq ID No:1), its molecular weight is 29.28041kDa, and theoretical iso-electric point is 6.72.3. utilize the mediation of Agrobacterium, adopt cotyledonary node method the plant expression vector of GmVSPB gene to be carried out the genetic transformation of soybean.4. Real-time RT-PCR analyze show, GmVSPB Soybean Root, true leaf, ternately compound leaf, stem, bud, in all have expression, but express there is tissue specificity, to soybean cotyledon regeneration and stem extend performance the most obvious.5. Real-time RT-PCR analyzes and shows, the expression of GmVSPB is induced by the regulation and control of 6-BA, and after 6-BA process 2h, expression amount starts to continue to rise, and reaches peak value, then decline gradually again when 8h.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the present invention is further described.

Fig. 1 is a kind of extraction figure of total serum IgE of soybean cotyledon node of plant nutrition storage protein (GmVSPB) gene.1-6:1 h in figure, 2 h, 3 h, 4 h, 5 h soybean cotyledon node total serum IgE.

Fig. 2 is the cDNA pcr amplification result figure of a kind of Tester and Driver of plant nutrition storage protein (GmVSPB) gene.M:DL15000 molecular weight standard in figure; 1-7: soybean Tester cDNA 15,18,21,24,27, the amplification of 30,33 circulation times; 8-14: soybean Driver cDNA 15,18,21,24,27, the amplification of 30,33 circulation times.

Fig. 3 is that the Rsa I enzyme enzyme of a kind of double-strand cDNA of plant nutrition storage protein (GmVSPB) gene cuts result figure.M:DL8000 DNA molecular amount standard in figure; Before 1:Tester enzyme is cut; 2:Tester enzyme cuts rear result; Before 3:Driver enzyme is cut; 4:Driver enzyme cuts rear result.

Fig. 4 is the result figure of twice PCR amplification after a kind of hybridization of plant nutrition storage protein (GmVSPB) gene.M:DL2000 DNA molecular amount standard in figure; 1: with Tester chain for twice PCR amplification after template hybridization; 2: with Driver chain for twice PCR amplification after template hybridization.

Fig. 5 is that in a kind of subtractive library of plant nutrition storage protein (GmVSPB) gene, Insert Fragment detects figure.M:DL2000 DNA molecular amount standard in figure; 1-20: Insert Fragment in subtractive library.

Fig. 6 is a kind of nucleotide sequence (Seq ID No:1) figure of plant nutrition storage protein (GmVSPB) gene.

Fig. 7 is that after a kind of object fragment PCR of plant nutrition storage protein (GmVSPB) gene, glue reclaims figure.

Fig. 8 is a kind of structure schematic diagram of intermediate carrier of plant nutrition storage protein (GmVSPB) gene.

Fig. 9 is a kind of structure schematic diagram of GmVSPB gene plant expression vector of plant nutrition storage protein (GmVSPB) gene.

Figure 10 is a kind of PCR primer figure of plant expression vector transformation Agrobacterium of plant nutrition storage protein (GmVSPB) gene.M:DL 15000 molecular weight standard in figure; 1-4: the PCR primer of vector Agrobacterium; 5: positive control: water; 6: negative control: plasmid.

Figure 11 is a kind of Genetic Transformation of Soybean figure of plant nutrition storage protein (GmVSPB) gene.(A) soybean east agriculture 50 seed in figure; (B) soybean seedling of 6d is sprouted; (C) cotyledonary node in Dual culture; (D) bud inducement; (E) elongation of explant; The growth of (F, G) root.

Figure 12 is a kind of PCR qualification figure turning GmVSPB transgenic soybean of plant nutrition storage protein (GmVSPB) gene.M:DL2000 molecular weight standard in figure; 1-21 transfer-gen plant to be detected; 22: positive control; 23: negative control; 24: the blank of water.

Embodiment

In the context of the present specification, unless specifically stated otherwise otherwise this specification sheets any term used has the implication that those skilled in the art understand in the art usually, and the experimental technique of unreceipted detailed conditions is conveniently test method or carry out according to the process specifications that supplier advises.

embodiment one

one. experiment material and reagent

1. vegetable material-soybean varieties: the eastern agriculture 50 that regeneration rate is high, from the little rosy clouds laboratory of force.

2. bacterial classification and carrier: E. coli DH5 α; Agrobacterium (Agrobacterium tumefacieus) LBA4404; Carrier pCAMBIA3300, pBI121; PMD18-T carrier is purchased from TaKaRa company.

two. major experimental reagent

CLONTECH SMARTer ^tMpCR cDNA Synthesis Kit and CLONTECH PCR-Select ^tMcDNA Subtraction Kit buys from CLONTECH company; RNAiso Plus, pMD18-T, LA Taq DNA polysaccharase DL2000, DL8000, DL15000 buy from TaKaRa company; Restriction enzyme EcoRI, HindIII, SacI, SmaI buy from Fermantas company; SYBY Green I fluorescent quantitation test kit buys the precious biotech firm from Dalian; Primer synthesis and order-checking are completed by Beijing Hua Da gene.

three. experimental technique

(1) suppression subtractive hybridization

1. the acquisition of soybean cotyledon node and 6-BA process

Choose the smooth surface gathered in the crops then anosis, healthy full eastern agriculture 50 seed, utilize the sterilizing of disinfection by chlorine method: be placed on by seed in culture dish, the clorox weighing 96 mL is put in wide-necked bottle, itself and the culture dish putting seed are placed in container airtight in stink cupboard stably, the concentrated hydrochloric acid taking 4 mL is poured into and is filled in the wide-necked bottle of clorox, rapid sealed vessel, after sterilizing 12-16h, seed is inoculated in MS(MS powder 4.43g, sucrose 20g, agar 0.8%, pH=5.8) on substratum, at 24 DEG C, 6 d are cultivated under long day (16 h illumination/8 h are dark) condition, aseptic seedling is taken out in super clean bench, peel off seed coat, cut away most of hypocotyl, only leave the 3-5 mm hypocotyl near cotyledon, 2 cotyledons are cut from hypocotyl midline, removing terminal bud and axillalry bud, scuffing mouth is pointed out in nearly growth, obtain cotyledonary node explant.A part of cotyledonary node explant is inoculated into liquid nutrient medium (the 4.43 MS+2 mg L adding 6-BA ^-16-BA, 2% sucrose, pH=5.8) middle shaking culture, to process 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h samplings as SSH tester; Another part cotyledonary node explant is seeded in liquid nutrient medium (the 4.43 MS+2 mg L not adding 6-BA ^-16-BA, 2% sucrose, pH=5.8) in, equally to process 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h samplings as SSH driver, each time point gets three parts of materials for later use, liquid nitrogen flash freezer ,-80 DEG C of preservations.

the extraction of soybean cotyledon node RNA

Preparation work: prepare 0.1% DEPC water; By the tinfoil parcel such as mortar, tweezers, spoon, put into oven, 180 DEG C of dry sterilizations spend the night; By 0.1% DEPC water preparation TAE electrophoresis liquid.The total serum IgE of soybean cotyledon node is extracted: (1) takes out-80 DEG C of cotyledonary nodes preserved with liquid nitrogen, and be placed in the mortar that liquid nitrogen is housed, grinding powder in liquid nitrogen, constantly adds liquid nitrogen in grinding, is transferred in 1.5 mL centrifuge tubes by the method for RNAiso Plus; (2) 1 mL RNAiso Plus extracting solution is added, vibration mixing, in left at room temperature 5min, 4 DEG C, 12000rpm, centrifugal 5min; (3) get supernatant liquor to proceed in new 1.5 mL centrifuge tubes, be transferred to 0.2 mL chloroform, thermal agitation 15 s mixes, and room temperature leaves standstill 5 min, 4 DEG C, 12000rpm, centrifugal 15min; (4) get supernatant liquor to proceed in new 1.5 mL centrifuge tubes, add the mixing of isopyknic Virahol, room temperature leaves standstill 10min, 4 DEG C, 12000rpm, centrifugal 10min visible white precipitation; (5) abandon supernatant liquor, add 1mL 75% ethanolic soln, piping and druming washing RNA precipitation, 4 DEG C, 12000rpm, centrifugal 5min; (6) abandon supernatant liquor, in super clean bench, dry RNA precipitates about 15min, adds 50 μ LDEPC water dissolution precipitations, after RNA fully dissolves, and-80 DEG C of preservations; (7) integrity of RNA is detected with 2% agarose gel electrophoresis.Its result is: the extraction soybean cotyledon node of experimental group and control group 1-10h being carried out to total serum IgE, detects, the clear RNA of 28S, 18S and 5S tri-band band through 2% agarose gel electrophoresis.

synthesis

The synthesis of (1) first chain cDNA

1) in a little centrifuge tube, following composition is added:

RNA 3.5 μL

3’SMART CDS Primer IIA 1 μL

2) up and down pressure-vaccum mixing, micro-from, 72 DEG C of incubation 3 min in PCR instrument, 42 DEG C of incubation 2 min;

3) in the centrifuge tube of step 1, following composition is added:

5×First-Strand Buffer 2 μL

DTT 0.25 μL

dNTP Mix 1 μL

SMARTer IIA oligonucleotide 1 μL

RNase Inhibitor 0.25 μL

SMART Scribe Reverse Transcriptase 1 μL

Total volum 5.5 μL

4) vortex mixing, centrifugal fast, 42 DEG C of incubation 90 min on temperature control shaking table;

5) in PCR instrument 70 DEG C of incubation 10min with termination reaction;

6) add 40 μ L TE buffer, dilute the first chain reaction product;

7)-20 DEG C of preservations.

(2) LD pcr amplification cDNA

1) cDNA getting 1 μ L dilution, in 0.5 mL centrifuge tube of mark, adds 9 μ L without RNA water, final volume to 10 μ L, gets 1.5 μ L in another PCR pipe, mark;

2) following sample is added in order, preparation PCR Master mixture:

Without RNA water 74 μ L

10×LA PCR buffer 10 μL

50×dNTP Mix 2 μL

5’PCR Primer IIA 2 μL

LA enzyme 2 μ L

Total volume 90 μL

3) mix, micro-from, by Master mixture packing 9 tubules, each 10 μ L, by 1-9 serial number;

4) PCR is carried out immediately:

Preheating 95 DEG C of 95 DEG C of 1 min

95℃ 15 s

65℃ 30 s

68℃ 5 min

2-39 circulation

5) at 15 circulation time take-off pipe samples, put 4 DEG C of preservations, and selection pipe respectively taken out a pipe at 18,21,24,27,30,33,36,39 circulation times respectively:

6) take out 5 μ L respectively and carry out 1.2% agarose gel electrophoresis, determine optimum cycle number.

Its result is: SMART (Switching Mechanism At 5 end of the RNA Transcript) technology utilizes eukaryotic mrna distinctive " cap sequence " to increase to obtain the cDNA of total length, and the double-strand cDNA of the amplification situation the best being in the logarithmic phase amplification stage is obtained through PCR method, neither lose too much low copy number genes because cycle index is very few, nonspecific product can not be produced because cycle index is too many again.Choose the cDNA sample of the abundance of the mRNA that can represent in original sample.In experiment, Tester reduces at the 30th circulation time display amplification efficiency, therefore adopts 27 circulations to carry out cDNA amplification; And Driver shows low amplification efficiency at the 27th circulation time, so have employed 24 circulations to carry out cDNA amplification.

double stranded cDNA purification:(1) in PCR primer, isopyknic phenol is added: chloroform: primary isoamyl alcohol (25:24:1), thorough vortex mixing, room temperature, 14000rpm, centrifugal 10min; (2) shift supernatant liquor in new centrifuge tube, add 700 μ L propyl carbinols, thorough vortex mixing, room temperature, 14000rpm, centrifugal 1 min; (3) repeating step 2, makes liquid final volume reach 40-70 μ L; (4) turn upside down CHROMA SPIN+TE-1000 post abundant resuspended gel matrix several times, remove pillar upper cover, remove pillar lower cover again, pillar is put in 1.5 mL centrifuge tubes, 1.5 mL 1 × TNE damping fluids are added after the liquid in pillar flows to end, after when liquid, flows by action of gravity is use up again, the damping fluid discarding collection carries out purifying (pillar colloid height 0.75 mL about again); (5) careful slowly by sample drop in glue planar central, avoid sample to flow down along wall; (6) adding 25 μ L 1 × TNE damping fluids makes liquid flow out completely; (7) adding 150 μ L 1 × TNE damping fluids makes liquid flow out completely; (8) shift in pillar to new 1.5 mL centrifuge tubes, add 320 μ L 1 × TNE damping fluids, collecting effluent liquid is the dscDNA of purifying, gets 10 μ L and in new centrifuge tube, is labeled as " sample B " detects for agarose gel electrophoresis; (9) add 75 μ L 1 × TNE damping fluids, collect effluent liquid in another centrifuge tube, take out 7 μ L in new centrifuge tube, be labeled as " sample C ", detect for 1% agarose gel electrophoresis and collect result.

enzyme is cut and the purifying of product:(1) from the dscDNA sample of purifying, take out 10 μ L to be labeled as " sample D ", for electrophoretic analysis dscDNA clip size; (2) add 36 μ L 10 × RsaI damping fluids and 1.5 μ L RsaI in the dscDNA of repurity, vortex mixes, centrifugal fast, incubation 3 h in (constant incubator) 37 DEG C; (3) get 10 μ L enzymes to cut after product and " sample D " and carry out 1.2% agarose gel electrophoresis and detect enzyme and cut whether success; (4) get 10 μ L digestion products to be labeled as " sample E ", preserve the digestion products result being used for comparative analysis purifying for-20 DEG C; (5) add equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1), vortex mixes, room temperature, the centrifugal 10min of 14000rpm; (6) shift in supernatant liquor to new centrifuge tube, add isopyknic chloroform: primary isoamyl alcohol (24:1), vortex mixes, room temperature, the centrifugal 10min of 14000rpm; (7) shift in supernatant liquor to new centrifuge tube, add appropriate 4M NH ₄95% ethanol of OAC and 2.5 times volume, the centrifugal 20min of room temperature 14000rpm; (8) supernatant is abandoned, by 200 μ L 80% washing with alcohol precipitations, room temperature, the centrifugal 5min of 14000rpm; (9) abandon supernatant, air drying 5-10 min, dissolution precipitation in 5.5 μ L without RNA water ,-20 DEG C of preservations.

joint connects

(1) 1 μ L RsaI digestion products is diluted with 5 μ L without RNA water, mixing.

(2) Master mixture is prepared: without RNA water (3 μ L); 5 × connect damping fluid (2 μ L); T4 DNA ligase (1 μ L).

(3) add following reagent in order, upper and lower pressure-vaccum thoroughly mixes:

Tester 1-1 (μL) Tester 1-1 (μL)

Dilution digestion products 22

Adaptor1 2 -

Adaptor2 - 2

Master mixture 66

Driver 1-1 (μL) Driver 1-1 (μL)

Dilution digestion products 22

Adaptor1 2 -

Adaptor2 - 2

Master mixture 66

(4) separately get a pipe and mix 2 μ L Tester 1-1 and 2 μ L Tester 1-2.

(5) 16 DEG C are incubated overnight.

hybridization

(1) first time hybridization

1) 4 × hybridization buffer is placed in room temperature at least 15-20 min, does not precipitate necessity before confirming use and make, 37 DEG C of heating 10min;

2) add following reagent in order, upper and lower pressure-vaccum, thoroughly mix:

Just hybridize sample 1 (μ L) and just hybridize sample 2 (μ L)

RsaI enzyme cuts driver cDNA 1.5 1.5

The Tester 1 1.5 that Adaptor1 connects-

The Tester 2-1.5 that Adaptor2 connects

4 × hybridization buffer 11

Cumulative volume 44

Anti-hybridization sample 1 (μ L) is hybridization sample 2 (μ L) instead

RsaI enzyme cuts tester cDNA 1.5 1.5

The Driver 1 1.5 that Adaptor1 connects-

The Driver 2-1.5 that Adaptor2 connects

4 × hybridization buffer 11

Cumulative volume 44

3) in each pipe, add a dropstone wax, centrifugal fast, 98 DEG C of incubation 5min in PCR instrument, 68 DEG C of incubation 8-9h in PCR instrument, carry out second time hybridization immediately.

(2) second time hybridization

1) in a centrifuge tube, the mixing of following reagent is added: Driver cDNA(1 μ L); 4 × Hybridization Buffer (1 μ L); Without RNA water (2 μ L).

2) get above mixture 1 μ L to be put in another centrifuge tube, and cover a dropstone wax, in PCR instrument, 98 DEG C of incubation 5min, are sex change driver.

3) take off Fresh denatured driver from PCR instrument, mix driver, hybridization sample 1 and hybridization sample 2 according to program below simultaneously: pipettor is adjusted to 15 μ L; soft extends hybridization sample 2 and paraffin interface place by rifle head; the whole sample of careful absorption, does not worry that a small amount of paraffin is also inhaled into; from pipe, remove a small amount of air of rifle head inspiration below sample droplets, produce little air insulated section; repeat - draw the driver of fresh thermally denature; whole mixture is joined in the pipe of hybridization sample 1; upper and lower pressure-vaccum mixing.

4) centrifugal fast, in PCR instrument, 68 DEG C are incubated overnight, and Xiang Guanzhong adds 200 μ L dilution buffers and blows and beats mixing, 68 DEG C of incubation 7 min in PCR instrument ,-20 DEG C of preservations.

RsaI enzyme is a kind of four base restriction endonucleases, about 256bp, there is an enzyme point of contact, double-strand cDNA enzyme can be cut into less cDNA fragment, small segment can reduce the complicated secondary facility that formed in the crossover process inhibition to hybridization, this had both improved heterogeneic recall rate, prevented again long cDNA fragment to the interference of subtractive hybridization.

the interpretation of result of twice PCR amplification after subtractive hybridization

(1) first time PCR reaction amplification: 1) prepare pcr template, get 1 μ L dilute Hybridization samples cDNA and 1 μ L do not cut down tester contrast be put in centrifuge tube; 2) add following reagent in order and prepare PCR Master mixture: sterilized water (19.5 μ L); 10 × PCR damping fluid (2.5 μ L); DNTP Mix(0.5 μ L); PCR Primer I(1.0 μ L); LA enzyme (0.5 μ L); Cumulative volume (24 μ L).3) vortex mixing is also centrifugal fast, adds 24 μ L PCR Master in each sample; 4) often a dropstone wax is added in pipe, centrifugal fast; 5) 75 DEG C of incubation 5 min extension subs in PCR instrument; 6) start immediately PCR:94 DEG C (25s); 94 DEG C (10s); 68 DEG C (30s); 72 DEG C (1.5min); 2-33 circulation; A pipe is respectively taken out at 24,27,30,33 circulation times; 7) each sample is respectively got 5 μ L and is carried out 2.0% agarose gel electrophoresis analytical results ,-20 DEG C of preservations.

(2) second time PCR reaction amplification: 1) get the first PCR better product that circulates and get 3 μ L, 27 μ L sterilized waters and dilute, take out 1 μ L and add in the centrifuge tube marked; 2) add following reagent in order and prepare PCR Master mixture: without RNA water (18.5 μ L); 10 × PCR buffer(2.5 μ L); Nested PCR Primer 1(1.0 μ L); Nested PCR Primer 2R(1.0 μ L); DNTP Mix(0.5 μ L); LA enzyme (0.5 μ L); Cumulative volume (24 μ L).3) add 24 μ LMaster mixtures in each centrifuge tube marked to step 1, each sample does 2 pipes.4) often a dropstone wax is added in pipe, centrifugal fast, start PCR circulation immediately: 94 DEG C (10s); 68 DEG C (30s); 72 DEG C (1.5min); 1-18 circulation; A pipe is taken out respectively at 12,15,18 circulation times; 5) each sample is got 5 μ L and is carried out 2.0% agarose gel electrophoresis analytical results ,-20 DEG C of preservations.

product purification:(1) add following reagent in order and prepare PCR Master mixture: without RNA water (18.5 μ L); 10 × PCR buffer(2.5 μ L); Nested PCR Primer 1(1.0 μ L); Nested PCR Primer 2R(1.0 μ L); DNTP Mix(0.5 μ L); LA enzyme (0.5 μ L); Cumulative volume (24 μ L).(2) get second time PCR cycle number better amplified production tester 15 μ L and add PCR Master mixture, mixing, is dispensed into 10 centrifuge tubes, marks by t 1-10.(3) will second time pcr amplification driver packing by step 1-2.(4) centrifugal fast, start immediately PCR:94 DEG C (10s); 68 DEG C (30s); 72 DEG C (1.5min); 1-15 circulation.(5) PCR terminates, and by 10 pipe mixing, gets 5 μ L and carries out 2% agarose gel electrophoresis.(6) the 3M NaAC(pH=5.2 of 1/10 volume is added), vortex mixes.(7) add equal-volume chloroform: primary isoamyl alcohol (24:1) extracting, vortex mixes, room temperature, the centrifugal 10min of 14000rpm.(8) get supernatant, add 2.5 times of volume dehydrated alcohol vortex mixed evenly rear left at room temperature 30min, 14000rpm, centrifugal 10min.(9) abandon supernatant, add appropriate 80% washing with alcohol precipitation, 14000rp0m, centrifugal 5min.(10) abandon supernatant, dry air precipitates, and adds 20 μ L and precipitates without RNA water dissolution.(11) get 3 μ L samples and carry out 2.0 % agarose gel electrophoresis ,-20 DEG C of preservations.

In hybridization solution, carry out first time hybridization, the strand Tester cDNA of the differential expression that four kinds of hybrid product: a have been homogenizations after hybridization terminates, can be formed; B is the Tester cDNA double-strand of self-annealing; That c allos is annealed is Tester and Driver cDNA; D is driver cDNA.By two parts first time Hybridization samples mix, add fresh thermally denature driver cDNA again in damping fluid, carry out second time hybridization, further removing consensus sequence, the molecule e of the strand Tester cDNA specific type of the differential expression of the different joint of the connection by the homogenization formed in annealing when hybridizing for the first time, second time hybridization fills connector end.The part distinguished sequence adding adapter 1 and adapter 2R carries out pcr amplification, and during first time pcr amplification, a and d does not have primer binding site therefore can not increase; B two ends are connected with identical joint, joint have inverted repeats suppression PCR can not increase; And c is single joint, linear amplification can only be carried out; The double chain DNA molecule e only having two ends to be connected with different joint just can increase, amplified production namely for the purpose of fragment.Second time pcr amplification makes the Primer selection amplification object fragment inside joint, have passed through twice hybridization and twice Nested PCR, object fragment is namely by abatement also enrichment, and obtain length greatly about the uniform disperse shape fragment of 200 bp-1400 bp, mean size is about 400-700 about bp.

the structure in suppressed subtractive hybridization library

i. PCR primer connects carrier T: (1) in centrifuge tube, following reagent is added: purified pcr product (4 μ L); PMD 18-T vector 1(1 μ L); Solution I(5 μ L).(2) 16 DEG C connect 2h.

connect the conversion of product:(1) get 5 μ L and connect product in a 1.5mL centrifuge tube, be positioned on ice, add 50 μ L E. coli competent wherein, flick mixing, ice bath 30min; (2) be placed in immediately on ice after 42 DEG C of water-bath heat shock 90 s by mixture, period does not shake; (3) in mixture centrifuge tube, add 200 μ L LB solid mediums, 37 DEG C, 220rpm shaking culture 45min, is positioned over after taking-up on ice; (4) bacterium liquid is coated on respectively containing 50 μ L IPTG, 25 μ L X-Gal, 50 μ L AMP, is inverted incubated overnight 16h for 37 DEG C; (5) plate is placed in 4 DEG C and preserves 2h, make it fully develop the color; (6) picking list bacterium colony, be inoculated in the LB liquid nutrient medium that 5 mL contain 5 μ L AMP, 37 DEG C, 220rpm shaking culture is spent the night; (7) after substratum obviously becomes muddiness, get 0.5 mL bacterium liquid and preserve bacterial classification in 30% glycerine that 0.5 mL is aseptic, mark, preserve bacterial classification for-80 DEG C.

the object fragment that qualification is inserted:(1) add following reagent in order and prepare Master mixture: without RNA water (18.7 μ L); 10 × PCR buffer(2.5 μ L); Nested PCR Primer 1(0.5 μ L); Nested PCR Primer 2R(0.5 μ L); DNTP Mix(0.5 μ L); LA enzyme (0.3 μ L); Cumulative volume (23 μ L).(2) micro-from, start pcr amplification: 94 DEG C (5min); 94 DEG C (30s); 68 DEG C (30s); 72 DEG C (2min); 2-33 circulation; Extend, 72 DEG C (5min).(3), after PCR terminates, 1.0% agarose gel electrophoresis is carried out.The bacterium liquid being accredited as positive colony is added 30% glycerine by 1:1, in-80 DEG C, preserves bacterial classification.Through SSH abatement and the cDNA fragment that obtains of enrichment, transformation of E. coli DH5 α competent cell, screening blue day shift, random picking 917 clone, PCR detection shows that most of Insert Fragment length is between 100-750bp.

order-checking:random picking 917 clones deliver to Beijing Hua Da gene and check order, sequence is spliced after unloading body, host sequences tumor-necrosis factor glycoproteins, wherein high-quality EST 411, accounting for 44.8% of sum, obtained EST fragment utilized the BLAST(Basic Local Alignment Search Tool of NCBI and PHYTOZOME) comparison carries out sequence similarity analysis.

eSTs real-time fluorescence quantitative RT-PCR (Real-time RT-PCR) in library

EST fragment sequence comparison on PHYTOZOME that order-checking obtains is obtained full length gene, and utilize Primer 5 software to design primer in CDS district, the soybean house-keeping gene actin4(logged on GenBank is as internal reference) design primer respectively.According to SYBR (R) Ex Script ^tMthe program of RT-PCR Kit carries out quantitative fluorescent PCR reaction.Agriculture 50 seed in east is inoculated on MS substratum, at 24 DEG C, 6d is cultivated under long day (16 h illumination/8 h are dark) condition, cut cotyledonary node, on the liquid MS medium adding 6-BA and do not add 6-BA, concussion is cultivated respectively, samples by 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, 24 h, 48 h, and RNAiso Plus method extracts RNA, reverse transcription becomes cDNA ,-80 DEG C of preservations.RT-PCR reaction mixture: each sample carries out 3 times to be repeated, cDNA first chain (1.6 μ L); Upstream and downstream primer each (1.6 μ L); SYBR qPCR Mix(10 μ L); Deionized water (6.8 μ L); Cumulative volume (20 μ L).PCR reaction conditions: 95 DEG C of denaturations (30s); 40 circulations: 95 DEG C of sex change (5s); 60 DEG C of renaturation (20s); 72 DEG C of extensions (20s).Utilize Opticon Monitor 3.1 software to data analysis, calculate the relative expression quantity of gene.EST order-checking and homology search result: clone for 917 that obtain at random, wherein high-quality EST 411, account for 44.8% of sum.Sequencing result is carried out BLASTn and BLASTx comparison to GenBank, and gene function relates to signal transduction, glucose, protein macromolecule biosynthetic metabolism, and light, Leaf pattern occur; Apoptosis, cell self-defense, Cell wall differentiation; The signal path of various hormone and phytokinin mediation.

eSTs real-time fluorescence quantitative RT-PCR (Real-time RT-PCR) in library

Can obtain drawing a conclusion from fluorescent quantitation data: acid phosphatase gene 4h expression amount before 6-BA process is steady, 4h to 6h expression amount constantly raises, most high expression level amount is reached when 6h, after this start to reduce, tend to be steady gradually after 12h, show that gene is suppressed effect after 6-BA process, belong to negative regulator gene. vSPBgene is steady by 1-8h expression amount after 6-BA process, and start during 8h to raise, 12h declines again after reaching maximum gradually, and gene may work in cytokinin pathway downstream.16S ribosomal gene 1-11h after by phytokinin process tends to be steady, and is that expression amount reaches the highest, tentatively can determines that this gene may in cytokinin pathway downstream at 12h.Porphobilinogen deaminase gene after treatment 4h time expression amount raise suddenly and arrive peaking, after tend to balance again, gene may act on cytokinin pathway upstream.

gmVSPBthe Cloning and sequence analysis of gene

i. GmVSPB gene primer design:from library, select gene clone, recall in Phytozome soybean gene group gmVSPBthe sequence of gene, according to its CDS region sequence application Primer 5.0 software to its design primer add restriction enzyme site, add SacI restriction enzyme site at upstream region of gene primer 5 ' end, downstream primer 5 ' is held and is added SmaI restriction enzyme site.Primer sequence design is as follows:

Table 1 gmVSPBgene amplification the primer

Primer	Primer sequence (5 '-3 ')
		GmVSPB-F	CCCGGGAAGGTGCAAGAGTTTGTT （Seq ID No:2）
GmVSPB-R	CGAGCTCGAAGTAGGTACGTGGAGTGT（Seq ID No:3）

iI. the reverse transcription of RNA: (1) eastern agriculture 50 soybean seeds is cultivated and cultivate 5d on germination medium, gets its cotyledonary node and extracts RNA.(2) RNA after thermally denature 5min, is placed in cooled on ice immediately under 65 DEG C of conditions.(3) preparation of reaction solution: Nuclease-free water(5.5 μ L); 5 × RT buffer(2 μ L); RT-Enzyme Mix(0.5 μ L); Primer Mix(0.5 μ L); Thermally denature RNA(1.5 μ L); Cumulative volume (10 μ L).(4) reverse transcription reaction: under 37 DEG C of conditions, carries out the reverse transcription reaction of 15min; Under 98 DEG C of conditions, carry out the enzyme deactivation reaction of 5min.After reaction terminates, preserve under 4 DEG C or-20 DEG C of conditions.

amplification GmVSPB gene:(1) following reagent mix PCR reaction system is added successively: cDNA(1 μ L); 10 × LA buffer(2 μ L); DNTP Mix(0.3 μ L); GmVSPB-F(1 μ L); GmVSPB-R(1 μ L); Takara LA Taq(0.3 μ L); ddH ₂o(14.4 μ L); Total volume(20 μ L).(2) PCR reaction is carried out by following program: denaturation (94 DEG C, 5min); Sex change (94 DEG C, 0.5min); Annealing (58 DEG C, 0.5min); Extend (72 DEG C, 1.5min); 35 circulations; Extend (72 DEG C, 10min) eventually; Preserve (4 DEG C).(3) get 5 μ L PCR primer 1% agarose gel electrophoresis to detect.

product glue reclaims:(1) under ultraviolet lamp, object band is cut rapidly in 1.5 clean mL centrifuge tubes; (2) add 200 μ L Bing Buffer, 57 DEG C of water-bath 7min, treat that agarose dissolves completely, put upside down mixing for several times; (3) solution is transferred in adsorption column, the centrifugal 1min of 10000rpm, outwells the useless body of collection tube; (4) add 300 μ L Bing Buffer, the centrifugal 1min of 10000rpm, outwells the useless body of collection tube; (5) add 700 μ L Bing Buffer, the centrifugal 1min of 10000rpm, outwells the useless body of collection tube; (6) add 500 μ L Bing Buffer, the centrifugal 1min of 10000rpm, outwells the useless body of collection tube; Emptyly uncap place 3min in atmosphere from the centrifugal 2min of 10000rpm, alcohol is volatilized; (7) taken out by adsorption column, put into 1.5 new mL centrifuge tubes, add 30 μ L Elution Buffer in the central authorities of adsorption film, after static 2min, the centrifugal 2min of 10000rpm, reclaims product-20 DEG C preservation.

product connects carrier T:(1) the object segment reclaimed be connected with pMD18-T carrier, reaction system is as follows: Solution I(5 μ L); Glue reclaims product (1 μ L); PMD18-T carrier (1 μ L).(2) mix 16 DEG C and connect 2h.

connect product conversion intestinal bacteria:(1) getting 50 μ L competent cells is placed on ice, adds 5 μ L and connects product, mixing, ice bath 30min; (2) 2-3min is on ice positioned over fast after 42 DEG C of water-bath heat shock 30s after ice bath; (3) in mixture, 200 μ L LB liquid nutrient mediums are added, 37 DEG C, 220rpm shaking culture 1.5h; (4) bacterium liquid is coated on containing Kana(50 mg/mL) LB flat board on, be inverted incubated overnight 16h at 37 DEG C; (5) the single bacterium colony of picking white, is inoculated in the LB liquid nutrient medium that 5 mL contain 5 μ L Kan (50 mg/mL), 37 DEG C, 220rpm shaking culture 12-16 h; (6) get 0.5 mL bacterium liquid and add the aseptic 30 % glycerine of 0.5 mL, preserve bacterial classification for-80 DEG C.

bacterium liquid PCR identifies:(1) following reagent is added on ice, mixing PCR reaction system: Escherichia coli bacteria liquid (1 μ L); 10 × PCR Buffer(2 μ L); Taq archaeal dna polymerase (0.3 μ L); DNTP Mix(0.3 μ L); Upstream primer (1 μ L); Downstream primer (1 μ L); ddH ₂o(14.4 μ L); Total volume(20 μ L).(2) PCR reaction is carried out according to the following steps: denaturation (94 DEG C, 5min); Sex change (94 DEG C, 30s); Annealing (58 DEG C, 30s); Extend (72 DEG C, 30s); 38 circulations: extend (72 DEG C, 10min) eventually; Preserve (4 DEG C).(3) take out 5 μ L PCR primer, detect with 1% agarose gel electrophoresis.(4) positive colony identified, preserves bacterial classification with aseptic 30% glycerine in 1:1 ratio-80 DEG C, gets 700 μ L and delivers to the order-checking of order-checking company, obtains the sequence of GmVSPB gene for (Seq ID No:1).

(2) bioinformatic analysis of GmVSPB gene

Will gmVSPBthe CDS district aminoacid sequence of DNAMan software prediction sequence of gene, passes through NCBI(http: //www.ncbi.nlm.nih.gov) Protein Conservation Domain program pair gmVSPBamino acid number, the composition of full length cDNA sequence coding carry out structural analysis, recycling (http://web.expasy.org/compute) web analytics protein relative molecular mass (Mr), theoretical iso-electric point, finally use Protscale(http: //www.expasy.ch/tools/protscale.html/) instrument pair gmVSPBthe parameters such as the hydrophobicity of the protein of coding and wetting ability are analyzed.

gmVSPBencode 254 aminoacid sequences (Seq ID No:2) altogether in the CDS district of the 765bp of gene, its molecular weight is 29.28041kDa, theoretical iso-electric point is 6.72, gene encoding production belongs to HAD superfamily, subfamily IIIB (Acid phosphatase), this family comprises acid p'tase and part Vegetative Storage Protein.

Hydrophobicity/hydrophilic the result of aminoacid sequence shows, the α-amino-isovaleric acid (Val) that polypeptide chain is the 98th, 239, glycine (Gly) have minimum score value-2.389, the L-Ala Alanine(Ala of the 9th, 10) there is the highest score value 3.311.With reference to ProtScale software, stronger and the score value rule that more high hydrophobicity is stronger of the lower wetting ability of amino acid score value, can find out, the strongest in α-amino-isovaleric acid, glycine wetting ability, L-Ala hydrophobicity is the strongest, and just on the whole, hydrophilic amino acid is evenly distributed in whole peptide chain, more than hydrophobic amino acid.

(3) plant expression vector construction of GmVSPB gene

By the method for double digestion carrier PbI121 and pCAMBIA3300 cut at EcoRI and HindIII restriction enzyme site and build medial expression vector pCAMBIA3300-121, then through SacI with SmaI intermediate carrier is connected with goal gene and builds plant expression vector.1. the extraction of pCAMBIA3300, PbI121 and pMD18T-GmVSPB plasmid: the preservation strain inoculation of (1) pCAMBIA3300 and PbI121 in the LB substratum of Kan resistance, 28 DEG C, 100rpm shaking culture 24-36h; (2) the preservation strain inoculation of pMD18T-GmVSPB is in the LB substratum of Amp resistance, 37 DEG C, 220rpm shaking culture 12h; (3) get 2 mL sterile centrifugation tube, fill it up with bacterium liquid, 12000rpm, centrifugal 1min, abandons supernatant; (repeat this step, collect enough bacterium liquid); (4) with the resuspended bacterial sediment of 250 μ L solution P1; (5) add 250 μ L solution P2, gentleness is put upside down 4-7 time, and room temperature places 4min; (6) add 350 μ L solution P3, gentleness is put upside down 4-7 time, fully mixes, and adularescent flocks occurs, add standing 3-5min, 12000rpm on ice, room temperature, centrifugal 10min, carefully gets supernatant; (7) previous step supernatant liquor is added (dropping of being careful is on filter membrane) in adsorption column AC, 12000rpm, room temperature, centrifugal 10min, outwells the waste liquid in collection tube; (8) add 700 μ L rinsing liquid Washing Buffer, 12000rpm, room temperature, centrifugal 1min, abandons waste liquid; (9) add 500 μ L rinsing liquid Washing Buffer, 12000rpm, room temperature, centrifugal 1min, abandons waste liquid; (10) adsorption column AC is put back in sky collection tube, 12000rpm, room temperature, centrifugal 2min; (11) take out adsorption column AC and put into the clean centrifuge tube of a pipe, add 100 μ L elution buffer Elution Buffer(EB in advance in 65-70 DEG C of water-bath heats better), room temperature places 2min, 12000rpm, centrifugal 1min; (12) solution obtained is rejoined in centrifugal adsorbing column, centrifugal 1min; (13) take out 5 μ L and carry out 1% agarose gel electrophoresis detection ,-20 DEG C of preservations.2. the digestion with restriction enzyme of plasmid: (1) mixes enzyme and cuts system: SacI(2 μ L); SmaI(1 μ L); 10 × Buffer Tango(1 μ L); Plasmid (4 μ L); ddH ₂o(2 μ L); Total volume(10 μ L).(2) metal bath 37 DEG C of enzymes cut 12h.(3) 1% agarose gel electrophoresis detect digestion products.(4) digestion products glue reclaims.3. GmVSPB gene fragment and pCAMBIA3300-121 carrier enzyme cut back to close the connection of fragment: (1) ligation system: T4 DNA Ligase Buffer(2 μ L); T4 DNA Ligase(1 μ L); GmVSPB enzyme is cut rear glue and is reclaimed product (3 μ L); PCAMBIA3300-121 enzyme is cut rear glue and is reclaimed product (1 μ L); ddH ₂o(3 μ L); Total volume(10 μ L).(2) mix, metal bath 22 DEG C of incubation 5h, 16 DEG C of connections are spent the night.4. the amplification of object fragment: extract soybean east agriculture 50 total serum IgE by Trizol reagent method.Utilize the Auele Specific Primer of design to carry out PCR reaction, obtain the amplified fragments of 977bp.

(4) structure of intermediate carrier

By PbI121 and pCAMBIA3300 empty plasmid vector EcoR I and Hind III double digestion, wherein carrier PBI121 reclaims with CaMV35S promotor, and the GUS of no terminator starts original paper, and length is 3032bp; Carrier pCAMBIA 3300 reclaims the fragment with bar gene Selection mark, and length is 8377bp, after these two fragments connected restructuring obtain intermediate carrier pCAMBIA3300-121, length is 11409bp.

(5) GmVSPB plant expression vector transformation Agrobacterium

Utilize freeze-thaw method that thing expression vector plasmid is proceeded to agrobacterium strains.After transforming, picking list bacterium colony shakes bacterium, extracts plasmid.Obtaining stripe size by pcr amplification is 977bp, shows successfully to be transformed in Agrobacterium by expression vector.

the competent preparation of Agrobacterium:(1) Cacl ₂legal system is for agrobacterium tumefaciens competent cell: 1) from the fresh mono-colony inoculation of DHA105 of picking the YEP substratum containing microbiotic Rif and Str on the YEP substratum of new Rif and Str resistance, 28 DEG C, and 220 rpm shaking culture are spent the night 24-36h; 2) get the bacterium liquid of the logarithmic phase of activated overnight, be inoculated in YEP substratum, continue to be cultured to OD ₆₀₀about=0.4-0.6; 3) bacterium liquid is proceeded in the sterile centrifugation tube of ice precooling, ice bath 30min, 4 DEG C, the centrifugal 10min of 4000 rpm; 4) supernatant is abandoned, with 0.05 M CaCl of 10 mL ice precoolings ₂resuspended thalline, ice bath 30 min, 4 DEG C, centrifugal 10 min of 4000 rpm; 5) supernatant is abandoned, with 0.05 M CaCl of 2 mL ice precoolings ₂resuspended thalline; 6) the competent cell 4 DEG C preservation will prepared, 24-48h transformation efficiency is the highest, 100 μ L packing, 30% sterile glycerol ,-80 DEG C of preservations.(2) goal gene transformation Agrobacterium competent cell: 1) get 100 μ L Agrobacterium competent cells and be placed on ice, adds 2 μ L plasmids and flicks bottom pipe and mix, ice bath 30min; 2) liquid nitrogen flash freezer 2min after ice bath, is placed in rapidly 37 DEG C of water-bath heat shock 5min, rapider ice bath 5min; 3) 500 μ L YEP liquid nutrient mediums are added, 28 DEG C, 100rpm shaking culture 3-5h recovery thalline; 4) bacterium liquid is coated on the YEP solid medium containing Rif, Str and Kan, 28 DEG C, is inverted and cultivates 24-36 h.

the qualification of Agrobacterium-mediated Transformation:white list colony inoculation on picking YEP solid medium is in the YEP liquid nutrient medium containing Rif, Str and Kan, 28 DEG C, 100rpm shaking culture 24-36h, bacterium liquid PCR method and enzyme cut qualification, the positive colony obtained mixes in 1:1 ratio with 30% sterile glycerol ,-80 DEG C of preservations.By agriculture bacillus mediated, cotyledonary node method is utilized to carry out genetic transformation, by goal gene to soybean gmVSPBin gene transferred plant body.

(6) cotyledonary node method soybean transformation

1. the substratum used in transforming: (1) 1 L germination medium (GM): 3.21 g B5 powder, 2% sucrose, 1 mg/L 6-BA, 0.7 % agar, p H=5.8; (2) 1 L Dual culture substratum (CCM): 0.321 g B5 powder, 3% sucrose, 3.9g Mes, 1.67 mg/L 6-BA, 40 mg/L AS, 0.25 mg/L GA3,0.154 g/L DTT, 1 g/L L-cysteine, 0.248 g/L NaS2O3,0.5% agar, pH=5.4; (3) 1 L bud inducement substratum (SIM): 3.21 g B5 powder, 3% sucrose, 0.59 g Mes, 1.67 mg/L 6-BA, 250 mg/mL cef, 0.7% agar, pH=5.6; (4) 1 L screening culture medium (SIM ⁺): 3.21 g B ₅powder, 3% sucrose, 0.59 g Mes, 1.67 mg/L 6-BA, 500 mg/mL cef, 5 mg/L PPT, 0.75% agar, pH=5.6; (5) 1 L bud elongation medium (SEM): 4.43 g MS, 3% sucrose, 0.59 g Mes, 0.5 mg/L GA ₃, 0.1 mg/L IAA, 1 mg/L ZR, 50 mg/L L-Asp, 250 mg/mL cef, 0.8% agar, pH=5.6; (6) 1 L root medias (RM): 1.605 g B ₅powder, 2% sucrose, 0.59g Mes, 1 mg/L IAB, 0.7 % agar pH=5.6.

2. the acquisition of soybean seeds disinfectant cotyledonary node explant: 1. infect and Dual culture: the Agrobacterium thalline CCM substratum of enrichment is resuspended, row dry wound near cotyledonary node vegetative point, mixes with Agrobacterium re-suspension liquid, is placed on shaking table, 28 DEG C, 150rpm shaking culture 30min; Cotyledonary node explant is taken out, blots bacterium liquid with aseptic thieving paper, tip upside down on and be covered with on the CCM solid medium of one deck aseptic filter paper, light culture 3d.2. the induction of Multiple Buds and screening: by the sterile water wash twice of the cotyledonary node after Dual culture, and then clean twice with the SIM liquid nutrient medium being added with degerming agent, the moisture on cotyledonary node surface is blotted with aseptic thieving paper, be seeded on the SIM solid medium of interpolation degerming agent, carry out renewal cultivation.After bud inducement substratum cultivates 7d, being proceeded to containing PPT concentration is carry out screening 7d in the screening culture medium of 5 mgL-1.Culture condition is: temperature 24 ± 1 DEG C; Photoperiod is 16 h/8 h.3. resistant buds elongation and take root: by screening 7d after explant proceed in bud elongation medium, cut away the ageing tissues of cotyledon and hypocotyl base portion when proceeding to, every 7d subculture is once.When bud is stretched to 3-4 cm, is against root and cut, proceed in root media and carry out root culture.4. the domestication of resistant plant: after the enough prosperities of the rhizopodium of explant in elongation medium, open bottleneck and cultivate 3-5d, after aseptic seedling adapts to there is the external environment of bacterium, plant is taken out and cleans substratum, go to lucifuge moisturizing in vermiculite to cultivate, then reduce humidity gradually, strengthen illumination cultivation.Delay to transfer in normal soil after seedling survives until plantlet and cultivate, keep epidemic disaster and normal illumination to the maturation that bears pods.

(7) detection of transfer-gen plant

1. the extraction of transgenic soybean DNA: SDS method extraction plant genomic DNA in a small amount.(1) go appropriate plant leaf in the centrifuge tube of 1.5 mL, grind blade to powder with mill, add 400 μ L EB damping fluids, the SDS solution of 80 μ L 10%, mixing, 65 DEG C of water-bath 30 min, put upside down once every 10 min; (2) add 200 μ L 5M KAC solution after water-bath, put upside down mixing for several times, ice bath 30min; (3) add isopyknic chloroform after ice bath: primary isoamyl alcohol (24:1) solution, put upside down mixing, room temperature leaves standstill 5min, 12000rpm, centrifugal 15min; (4) get supernatant, add isopyknic chloroform with supernatant liquor: primary isoamyl alcohol (24:1) solution, room temperature leaves standstill 5min, 12000rpm, centrifugal 10min; (5) get supernatant, add the aqueous isopropanol of 1 mL precooling, put upside down and be no less than 15 times, occur flocks ,-20 DEG C of standing 0.5-1h, 12000rpm, centrifugal 10min; (6) abandon supernatant, add 1 mL 70% ethanolic soln piping and druming washing, 12000 rpm, centrifugal 5min; (7) abandon supernatant, after drying at room temperature, 50 μ L aseptic deionized waters dissolve; (8) take out 5 μ L 1% agarose gel electrophoresis to detect ,-20 DEG C of preservations.

2. the PCR qualification of transfer-gen plant

(1) get rotaring gene plant blade and extract DNA, carry out PCR detection, required primer is as follows:

Table 2 transfer-gen plant detects amplification the primer

(2) PCR system: plant DNA(1 μ L); 10 × PCR damping fluid (2 μ L); DNTP Mix (10mM) (0.3 μ L); Upstream primer (10 μMs) (1 μ L); Downstream primer (10 μMs) (1 μ L); Taq archaeal dna polymerase (5U/ μ L) (0.3 μ L); ddH ₂o(14.4 μ L).(3) PCR program: denaturation (94 DEG C, 5min); Sex change (94 DEG C, 0.5min); Annealing (58 DEG C, 0.5min); Extend (72 DEG C, 1.5min); Extend (72 DEG C, 10min) eventually; 38 circulations; Preserve (4 DEG C).

3. the detection of process LAN soybean

The genetically engineered soybean T obtained by cotyledonary node method ₀seed, sows in vermiculite, and every strain is numbered, and in time growing first ternately compound leaf, getting blade is material, with the SDS soybean leaves DNA that method extraction children is tender in a small amount, with bargene primer, comprise 35S and NOS primer for detecting primer, take non-transgenic tobacco as negative control, expression vector plasmid is positive control, and water is blank, carries out PCR qualification, detects 6 strain positive plants altogether.

(8) tissue specific expression of GmVSPB gene

By soybean east agriculture 50 seed culture in vermiculite, cultivate under long day (16 h illumination/8 h are dark) condition, after first ternately compound leaf launches completely (about 10 days), Soybean Root, stem, true leaf, cotyledon and first ternately compound leaf are drawn materials; Treat that Post flowering gets bud, flower tissue sampling; After bearing pods, rataria and beanpod are drawn materials, RNA, reverse transcription cDNA are extracted to each tissue part of soybean and is used for quantitative fluorescent PCR ,-80 DEG C of preservations.In order to understand gmVSPBthe expression pattern difference of gene in different tissues organ.With gmACTIN4house-keeping gene is as reference gene, and Real-time RT-PCR analyzes gmVSPBthe Plantago fengdouensis of gene mRNA transcript in soybean different tissues.Result shows gmVSPBgene expression amount in cotyledon is the highest, is secondly stem, root, can infer that this gene is in regeneration of cotyledons, plays certain effect in the elongation of stem.

More than show and describe ultimate principle of the present invention and principal character and advantage of the present invention.The technician of the industry should be appreciated that; the present invention is not restricted to the described embodiments; what describe in above-described embodiment and specification sheets just illustrates principle of the present invention; without departing from the spirit and scope of the present invention; the present invention also has various changes and modifications; these changes and improvements all fall in the claimed scope of the invention, and application claims protection domain is defined by its equivalent of appending claims.

<110> Northeast Agricultural University

<120> soybean plants nutrition storage protein (GmVSPB) gene

<160>7

<210>1

<211>765

<212>DNA

<213> artificial sequence

<400>1

ATGAAGTTGT TTGTTTTCTT TGTTGCTGCA GTAGTTTTGG TAGCATGGCC ATGCCATGGC 60

GCAGGCTACC AAAGGTTCCC TCTCCGAATG AAAACTGGCT ATGGTGAGCG TTCTTCGGAG 120

GTAAAATGCG CAAGTTTTAG GCTTGCTGTG GAAGCACACA ACATCCGAGC CTTTAAAACC 180

ATTCCTGAAG AGTGCGTTGA ACCAACAAAG GACTACATTA ATGGCGAACA ATTTAGATCA 240

GACTCTAAAA CAGTTAACCA ACAAGCTTTC TTTTATGCTA GTGAACGCGA AGTCCATCAC 300

AACGACATAT TTATATTCGG CATAGATAAC ACCGTACTCT CTAATATCCC ATACTATGAA 360

AAACATGGAT ATGGGGTGGA GGAATTTAAT GAAACCTTAT ATGATGAATG GGTTAACAAG 420

GGCGACGCAC CGGCATTGCC AGAGACTCTT AAAAATTACA ACAAGCTGTT GTCTCTTGGC 480

TTCAAGATTG TATTCTTGTC AGGAAGATAT CTTGACAAAA TGGCCGTAAC AGAAGCAAAC 540

CTAAAGAAGG CTGGCTTCCA CACATGGGAG CAGTTAATTC TCAAGGATCC ACATCTTATC 600

ACTCCAAATG CACTTTCATA CAAATCAGCA ATGAGAGAGA ATCTGTTGAG GCAGGGATAC 660

AGAATTGTTG GAATCATTGG AGACCAATGG AGCGATCTGC TTGGAGACCA CAGAGGCGAA 720

AGCAGGACCT TTAAGCTTCC TAATCCCATG TACTACATTG AGTAG 765

<210>2

<211>23

<212>DNA

<213> artificial sequence

<400>2

CCCGGGAAGG TGCAAGAGTT TGTT 24

<210>3

<211>27

<212>DNA

<213> artificial sequence

<400>3

CGAGCTCGAA GTAGGTACGT GGAGTGT 27

<210>4

<211>21

<212>DNA

<213> artificial sequence

<400>4

ATCTCGGTGA CGGGCAGGAC C 21

<210>5

<211>20

<212>DNA

<213> artificial sequence

<400>5

AGGCACGCAA CGCCTACGAC 20

<210>6

<211>22

<212>DNA

<213> artificial sequence

<400>6

AGGAAGGTGG CTCCTACAAA TG 22

<210>7

<211>25

<212>DNA

<213> artificial sequence

<400>7

AATGTATAAT TGCGGGACTC TAATC 25

 

Claims (1)

1. plant nutrition storage protein (GmVSPB) gene, is characterized in that adopting suppression subtractive hybridization to obtain GmVSPB gene (Seq ID No:1).