CN104862237A - Trichoderma reesei recombinant strain containing artificial zinc finger transcription factor and application of Trichoderma reesei recombinant strain - Google Patents

Trichoderma reesei recombinant strain containing artificial zinc finger transcription factor and application of Trichoderma reesei recombinant strain Download PDF

Info

Publication number
CN104862237A
CN104862237A CN201510338523.1A CN201510338523A CN104862237A CN 104862237 A CN104862237 A CN 104862237A CN 201510338523 A CN201510338523 A CN 201510338523A CN 104862237 A CN104862237 A CN 104862237A
Authority
CN
China
Prior art keywords
trichoderma reesei
zinc finger
strain
recombinant strain
transcription factor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510338523.1A
Other languages
Chinese (zh)
Other versions
CN104862237B (en
Inventor
赵心清
张飞
白凤武
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dalian University of Technology
Original Assignee
Dalian University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dalian University of Technology filed Critical Dalian University of Technology
Priority to CN201510338523.1A priority Critical patent/CN104862237B/en
Publication of CN104862237A publication Critical patent/CN104862237A/en
Application granted granted Critical
Publication of CN104862237B publication Critical patent/CN104862237B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/59—Biological synthesis; Biological purification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)

Abstract

The invention discloses a Trichoderma reesei recombinant strain containing artificial zinc finger transcription factor and application of the Trichoderma reesei recombinant strain, and belongs to the field of microbial biotechnology. The Trichoderma reesei recombinant strain is stored in China General Microbiological Culture Collection Center on April 16, 2015, and the accession number is CGMCC No. 10649. The Trichoderma reesei recombinant strain is named Trichoderma reesei U5, which is a high-yield cellulose strain obtained by transferring an artificial zinc finger protein transcription factor into the starting strain of Trichoderma reesei C30, and then being subjected to cellulase activity screening. Under the condition of bran inducing, the cellulase activity of the high-yield cellulose strain is increased by about 35% as compared with that of a wild type Trichoderma reesei C30, reaching 8.4 enzyme-activity units per milliliter; beta-glucosidase of the Trichoderma reesei U5 is increased by 3.5 times as compared with that of the wild type Trichoderma reesei C30, reaching 8.8 enzyme-activity units per milliliter. The increase in cellulase secretion activity of the Trichoderma reesei U5 shows the potential application value of the Trichoderma reesei U5 in the field of renewable energy, and new microbial resources are provided for the efficient degradation of biomass.

Description

One strain contains Trichodermareesei recombinant bacterial strain and the application thereof of artificial zinc finger transcription factor
Technical field
The present invention relates to Trichodermareesei recombinant bacterial strain and application thereof that a strain contains artificial zinc finger transcription factor, belong to field of microbial biotechnology.
Background technology
In recent years, along with the fast development of modern social economy and the sustainable growth of population, the demand of people to the energy grows with each passing day, and the exploitation of renewable energy source causes domestic and international common concern.Mierocrystalline cellulose and hemicellulose are renewable resourcess the abundantest in the world, cellulase and hemicellulase is utilized to be hydrolyzed to glucose and xylose, one-step fermentation of going forward side by side produces regenerated biological energy (alcohol fuel and butanols etc.), also can produce multiple bio-based chemical simultaneously.The cellulosic bacterium of filamentous fungus Sum decomposition can generate born of the same parents' outer fiber element enzyme, filamentous fungus cellulase is primarily of three fermentoid components, Mierocrystalline cellulose excision enzyme, Mierocrystalline cellulose restriction endonuclease and beta-glucosidase, these enzymes have been come the cellulosic degraded of substrate by synergy.The source of occurring in nature cellulase is very extensive, wherein filamentous fungus is one of important microorganism of cellulase-producing, Trichodermareesei C30 is that the secretion extracellular protein ability of generally acknowledging at present is the strongest, and the industrial strain that Cellulase is more complete, its exocytosis protein concentration can up to 100 grams often liter.
Although Trichodermareesei has a large amount of exoprotein secretions, it produces, and the enzyme cycle is long, enzyme is alive low, causes the production cost of cellulase too high, can not meet the demand of economy of large scale production renewable energy source and bio-based chemical.Domestic and international research worker has selected multiple cellulase high-yield, but in physical environment, be directly separated the cellulase-producing bacterial classification obtained, and general product enzyme performance is poor, can not meet the needs of suitability for industrialized production.By the inherited character of induced mutations, the method improvement bacterial classification such as genetic engineering modified, it is significant in cellulase suitability for industrialized production and application that seed selection cellulase activity is high, enzyme system forms comprehensive bacterium producing multi enzyme preparation.
Zinc finger protein is the intracellular transcription factor of a class, refers to the transcriptional regulator with zinc fingers, plays an important role in the expression regulation etc. of Eukaryotic fetal development, cytodifferentiation, enhancing resistance, gene.Zinc fingers can be combined with RNA and DNA, again can with DNA-RNA duplex molecule and similar protein binding, transcribing and adjustment in translation skill and controlling gene expression, therefore in the structure of manual transcription factor, zinc finger protein is considered to the most promising DNA binding domain.The function that different protein structures is corresponding different, according to the difference of zinc finger protein conserved domain, can be divided into 3 monoids such as C2H2 (Cys2His2) type, C4 (Cys4) type and C6 (Cys6) type.C2H2 type zinc refers to it is that classic zinc refers to, is that maximum, the zinc the most widely that distributes of research at present refers to.Therefore, artificial DNA binding domain and effect district can be designed, the manual transcription factor (Artificial Transcription Factor, ATF) required for establishment, the simultaneously expression of multiple gene in regulating cell.Manual transcription factor technology has been successfully applied to multiple field, achieve successfully in the expression output of raising albumen, raising cell tolerance solvent, osmotic pressure, temperature, pH value characteristic etc. by this method, successful Application is had (with reference to Nature Biotechnology in yeast saccharomyces cerevisiae and coli strain transformation, 2003,21:1208-1214; Applied Microbiology andBiotechnology, 2015,99 (5): 2441-9), but the related work in filamentous fungus is not also reported.
This patent is by engineer and engineered zinc finger, and then imported in filamentous fungus T. reesei cell, integrate and activate/suppress corresponding regulation and control by manual transcription factor in thalline internal random and produce the expression of cellulose enzyme gene, produce the Trichodermareesei recombinant bacterial strain storehouse that a high storage capacity carries zinc-finger protein transcription factor, and then obtain the cellulose degrading enzyme enzyme recombinant bacterial strain improved alive by the screening of cellulose degradation activity.
Summary of the invention
The object of the invention is to provide Trichodermareesei recombinant bacterial strain and the application thereof that a strain contains artificial zinc finger transcription factor, containing the nucleotide sequence (annex sequence 1) that the present invention is used in its genome, its translation product is a kind of protein (annex sequence 2), transcriptional control function can be exercised to carry out the efficient abduction delivering of cellulase, in biomass efficient degraded, there is important using value.
The invention provides the Trichodermareesei recombinant bacterial strain (Trichodermareesei) that a strain contains artificial zinc finger transcription factor, registering on the books of described bacterial strain is numbered CGMCC No.10649, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, preservation date is on April 16th, 2015.
The present invention provides a kind of technological line simultaneously, and Li's Trichoderma strains can be made to obtain proterties and the function of High Cellulase Production, and flow and method is as follows:
(1) filamentous fungus expression vector pCB303 is built, artificial zinc finger protein library nucleic acids sequence is connected in expression vector, artificial zinc finger protein library gene source is in the synthetic gene (NatureBiotechnology, 2003,21:1208-1214) of bibliographical information.
(2) obtained library pool is transferred in filamentous fungus T. reesei by agrobacterium mediation converted.Tested by liquid shake-flask fermentation under Mierocrystalline cellulose is inductor condition, filter out the bacterial strain that cellulase activity stablizes raising.
Finally obtain the Trichodermareesei recombinant bacterial strain U5 that a strain contains artificial zinc finger transcription factor, and carry out follow-up each enzyme analysis mensuration alive and Molecular mechanism analysis on bio to covering bacterial strain.Trichodermareesei U5 is under Mierocrystalline cellulose wheat bran fermentation condition, and total filter paper enzyme activity can improve 35% than starting strain C30, and reach 8.4 enzymes units per ml alive, wherein β glucosidase activity improves 3.5 times, reaches 8.8 enzymes units per ml alive.Determining cellulase activity raising partly cause by gene transcription level analysis is that β alpha-glucosidase gene (bgl1) overexpression caused.
Accompanying drawing illustrates:
Fig. 1 is zinc finger protein Library plasmid collection of illustrative plates of the present invention (wherein ZFP-Gal4 represent zinc refer to and Gal4 activation structure domain fusion protein).
Fig. 2 is that cellulase activity of the present invention is changed significantly the comparison of bacterial strain cellulase.
Fig. 3 is the cellulose components activity contrast of Trichodermareesei U5 and Trichodermareesei C30 in the present invention.
Fig. 4 is the filter paper enzyme activity the result (wherein ZFP-Gal4 represent zinc refer to and Gal4 activation structure domain fusion protein) of zinc finger protein U5 transforming Trichoderma reesei C30 again in the present invention.
Fig. 5 is the comparative analysis of mutant gene expression level and control strain.
Embodiment
Experiment material and reagent
Bacterial strain: starting strain Trichodermareesei Trichoderma reesei C30, buy at American Type Culture preservation center (ATCC), accession number is ATCC 56765.
Substratum:
PDA substratum (1 liter of intensive amount): mealy potato 200 grams, glucose 20 grams, agar powder 20 grams;
Fructus Hordei Germinatus leaching powder substratum (1 liter of intensive amount): malt meal 30 grams, agar powder 20 grams;
Mendelian's salt culture medium (content in 1 liter):
Salts solution: (NH 4) 2sO 41.4 gram; KH 2pO 42 grams; Urea 0.3 gram; CaCl 20.3 gram; MgSO 47H 2o0.3 gram; Trace element solution 1 milliliter of pH 4.8;
Trace element solution: citric acid, 5 grams; ZnSO 47H 2o, 5 grams; Fe (NH 4) 2(SO 4) 26H 2o, 1 gram; CuSO 45H 2o, 0.25 gram; MnSO 4h 2o, 50 milligrams; H 3bO 4, 50 milligrams; NaMnO 42H 2o, 50 milligrams; Add deionized water constant volume to 100 milliliters;
Spore germination substratum (1 liter): peptone 1.0 grams; Glucose 10 grams;
Fermention medium (1 liter): peptone 1.0 grams; Microcrystalline Cellulose 10 grams;
Inducing culture (1 liter): K 2hPO 42.05 gram; KH 2pO 41.45 gram; NaCl 0.15 gram; MgSO 47H 2o 0.5 gram; CaCl 22H 2o 0.067 gram; FeSO 47H 2o 0.0025 gram; (NH 4) 2sO 40.5 gram; Glucose 2.0 grams; PH 5.3;
Dual culture substratum (1 liter): in inducing culture, glucose concn reduces by half, i.e. 1.0g, adds 20g agar powder in addition;
Shaking flask screening culture medium (1 liter): KH 2pO 4, 1.4 grams; MgSO 47H 2o, 0.3 gram; CaCl 22H 2o0.4 gram; FeSO 47H 2o, 10 milligrams; Urea 0.3 gram; Trace element 1 milliliter, 40 grams of Microcrystalline Celluloses; 30 grams of yeast powders, 20 grams of wheat brans.
Illustrate: in following examples, do not make the experimental methods of molecular biology illustrated, concrete grammar listed by equal reference " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book carries out, or carries out according to test kit and product description.
Embodiment 1: Trichodermareesei zinc finger protein library construction
The artificial zinc that the present invention relates to refers to for Cys2His2 type zinc refers to, construction process, with reference to NatureBiotechnology, 2003,21:1208-1214, comprises four Zinc finger domains, provided by ToolGen company of Korea S.This zinc refers to that library feature has to derive from the conservative transcription factor activation territory Gal4 of yeast saccharomyces cerevisiae, and variable C2H2 type Zinc finger binding territory, and storage capacity is approximately 10 6individual; Binary expression vector skeleton is pCB303, this carrier is (with reference to Gene by filamentous fungus expression vector pAN7-1,1987,56:117-124) with pCB301 (reference Plant Molecular Biology, 1999,40:711-717) transform, wherein include the pki promotor from Trichodermareesei and trpC terminator, zinc finger protein library nucleic acids sequence can be inserted between two restriction enzyme sites.Zinc finger protein library DNA fragment in the present invention is obtained from the pRS316-CYC-lib-Gal4 carrier in yeast zinc finger protein library by polymerase chain reaction (PCR), and be connected into pCB303 expression vector by the restriction enzyme site of Nco I and Xba I, set up and obtain pCB303-Lib-Gal-hph zinc and refer to library, see accompanying drawing 1.The resistance selective marker of this carrier in bacterium is kantlex (Kanamycin), and in fungi, selective marker is Totomycin (hygromycin).
1. the acquisition of zinc finger protein and transcription activating domain DNA fragmentation
Forward primer P1:5'-AACACAAATACACACACTAATCTAGAACTAG-3'
Reverse primer P2:5' – CATAACTAATTACATGACTCGAGGTCGACTTAC-3'
PCR reaction conditions is as shown in table 1:
Table 1PCR reaction conditions
PCR reaction system is as shown in table 2:
Table 2PCR reaction system
* this polysaccharase is bought in the biological Dalian company of treasured.
2. build intestinal bacteria Escherichia coli zinc finger protein library
PCR primer in above-mentioned steps and pCB303 expression vector are carried out Nco I and Xba I double digestion, spend the night under 16 degrees Celsius after recovery and carry out ligation, reaction system chart 3.
Table 310 microlitre ligation system
Zinc finger protein expression plasmid library pCB303-Lib-Gal-hph is connected product transform in E.coli DH5 α, step of converting is with reference to " Molecular Cloning: A Laboratory guide " (third edition).After cultivation 12-16 hour, collect the transformant on kalamycin resistance flat board.
3. build agrobacterium tumefaciens Agrobacterium tumefaciens AGL-1 zinc finger protein library
The transformant library pCB303-Lib-Gal-hph that after mixing, upper step obtains is inoculated in incubated overnight in LB liquid nutrient medium.Extract plasmid, reuse electric shocking method and be converted in agrobacterium tumefaciens competent cell AGL-1, conversion operation method is with reference to " Molecular Cloning: A Laboratory guide " (third edition).Wash-out Agrobacterium is also collected, and finally obtains the agrobacterium tumefaciens library containing zinc finger protein.
Embodiment 2: by zinc finger protein agrobacterium tumefaciens AGL-1 library transformation in Trichodermareesei C30
1. the agrobacterium tumefaciens AGL-1 library containing zinc finger protein to be inoculated in 5 milliliters of substratum (100 micrograms per millilitre dimension gram every milliliter of kantlex) by 1% inoculum size, 28 degrees Celsius, 240 rpms of light culture 48 hours; 5000 rpms are centrifugal 10 minutes, collect agrobatcerium cell, and adjustment OD in being suspended in inducing culture (IM) 660be about 0.2, cultivate 6-12 hour according to the same terms.
2. Trichodermareesei C30 is inoculated in PDA flat board, 28 degrees Celsius of illumination cultivation 5-7 days, with conidium under aseptic washing, is adjusted to final concentration about 10 7every milliliter, spore.
3. after getting the C30 spore suspension mixing of AGL-1 that 100 microlitres activate and same volume, be uniformly coated on cover Dual culture substratum (CM) in advance glassine paper on, 25 degrees Celsius of light culture 48 hours, glassine paper is taken off and transfers to containing Totomycin with in the minimum medium of (300 micrograms per millilitre cephamycin), 28 degrees Celsius are carried out cultivation 3-7 days, just have transformant to occur, timely picking is transferred in new minimum medium solid plate and cultivates.
4., cultivate 5-6 generation on solid medium after, will wherein contain in hygromycin resistance culture dish by transformant picking with inoculating needle, after treating one week, growth conditions is good, and the transformant with spore generation is saved in 20% glycerine ,-80 degrees Celsius of preservations.The object of this step is the genetic stability of checking transformant.
Embodiment 3: the Trichodermareesei transformant cellulolytic activity screening containing zinc finger protein
Obtain Trichodermareesei transformant by PCR and resistance screening qualification, transformant carries out the mutant of screen fibre element enzymic activity raising by cellulosic pulp fask oscillating method.In 100 milliliters of Erlenmeyer flasks, add shaking flask screening culture medium 50 milliliters, access activation 7 days spore-bearing Trichodermareesei transformants about 10 respectively 8every milliliter, at 150 rpms, cultivate in 28 degrees Celsius of shaking tables and draw nutrient solution, measuring cellulosic filter paper Enzyme activity, wild-type T. reesei C30 is contrasted, carrying out enzyme work and compare.
The cellulase activity that primary dcreening operation is obtained change obvious bacterial strain carry out further liquid enzymes live fermentation compare, further verify.
Embodiment 4: the identification of strains that cellulase activity improves and checking
After carrying out cellulosic substrate enzymatic production, found the bacterial strain that a few strain cellulase activity is changed significantly, i.e. U3, U4, U5, U6, carries out enzymatic production by above-mentioned transformant bacterial strain and compares, see accompanying drawing 2.Finally determine that the activity of U5 is optimum, under Mierocrystalline cellulose wheat bran fermentation condition, total filter paper enzyme activity can improve about 35% than starting strain, reach 8.4 enzymes units per ml alive, wherein β glucosidase activity improves 3.5 times, reaches 8.8 enzymes units per ml alive, sees accompanying drawing 3.Also the enzymic activity of independent component is studied simultaneously.The expression amount of endoglucanase reaches 11.16 enzymes units per ml alive in U5 mutant, and the endoglucanase enzyme work of wild-type C30 is 9.41 enzymes units per ml alive, and in U5 mutant, Endoglucanase is lived and improve about 18%; Xylanase activity is 1055 and 975.4 Mei Huo units respectively in U5 mutant and wild-type C30, difference with insignificance; Secretion and the xylanase activity trend of extracellular protein are similar, and in U5 mutant and Trichodermareesei C30, exocytosis albumen is 11.54 milligrams every milliliter respectively, 11.37 milligrams every milliliter, difference with insignificance.Extract the genome of Trichodermareesei U5, analyze zinc finger protein nucleotide sequence in bacterial strain by zinc finger protein nucleotide sequence primers designed.Zinc finger protein primers designed is as follows:
Forward primer P3:5'CGACACCAACGATCTTATATCCAG 3'
Reverse primer P4:5'TGTGAGACCATGAGCTATTATTGC 3'
PCR reaction conditions and system are with table 1, and 2 is identical.Finally obtain the artificial zinc finger protein of Trichodermareesei U5 inside, called after ZFP-U5, sequencing result is shown in attached explanation annex sequence 1.
By analyzing, zinc finger protein sequence contained in Li's Trichoderma strains U5 genome of the present invention is C2H2 tetra-zinc fingers, and this zinc refers to that the protein coding of sequence is shown in annex sequence 2.
Simultaneously in order to verify that the reason that cellulase improves is that the zinc finger protein proceeded to caused really.The nucleotide sequence of the zinc finger protein ZFP-U5 of acquisition is carried out Nco I and Xba I enzyme is cut, be connected with fungus expression vector pCB303, again repeat above-mentioned step of converting, again transform checking, the results are shown in accompanying drawing 4.After transforming, result shows, the cellulase activity with U5 zinc finger protein sequence 15 bacterial strains of random picking comparatively wild-type T. reesei all increases significantly, and further illustrates the validity that zinc refers to sequence.
Eventually through measuring the relative transcript amount of some fibre element enzyme component gene in mutant and in wild type strain, comprising Mierocrystalline cellulose excision enzyme gene cbh1, β alpha-glucosidase gene bgl1, the positive regulatory factor xyr1 of regulation and control trichoderma reesei cellulase genetic expression and the transcription factor bglR of regulation and control alpha-glucosidase gene transcriptional expression.Found by genetic transcription and Enzyme activity measurement result, the enzymic activity of transcribing raising and this enzyme of the raising of filter paper enzyme activity gross activity and wherein β alpha-glucosidase gene (bgl1) improves positive correlation, raising also appears in cbh1 genetic transcription, but obvious not.Genetic transcription the results are shown in accompanying drawing 5.
Annex:
Artificial zinc finger protein nucleotide sequence in sequence 1 Trichodermareesei U5:
Artificial zinc finger protein protein sequence in sequence 2 Trichodermareesei U5:

Claims (2)

1. a strain contains the Trichodermareesei recombinant bacterial strain (Trichoderma reesei) of artificial zinc finger transcription factor, it is characterized in that: the grade of described bacterial strain enters volume and is numbered CGMCC No.10649, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date is on April 16th, 2015.
2. a strain according to claim 1 contains the application of the Trichodermareesei recombinant bacterial strain of artificial zinc finger transcription factor, it is characterized in that: described bacterial strain is applied to the degraded of biomass.
CN201510338523.1A 2015-06-14 2015-06-14 One plant of trichoderma reesei recombinant bacterial strain containing artificial zinc finger transcription factor and its application Expired - Fee Related CN104862237B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510338523.1A CN104862237B (en) 2015-06-14 2015-06-14 One plant of trichoderma reesei recombinant bacterial strain containing artificial zinc finger transcription factor and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510338523.1A CN104862237B (en) 2015-06-14 2015-06-14 One plant of trichoderma reesei recombinant bacterial strain containing artificial zinc finger transcription factor and its application

Publications (2)

Publication Number Publication Date
CN104862237A true CN104862237A (en) 2015-08-26
CN104862237B CN104862237B (en) 2017-10-17

Family

ID=53908419

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510338523.1A Expired - Fee Related CN104862237B (en) 2015-06-14 2015-06-14 One plant of trichoderma reesei recombinant bacterial strain containing artificial zinc finger transcription factor and its application

Country Status (1)

Country Link
CN (1) CN104862237B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3046180A1 (en) * 2015-12-28 2017-06-30 Ifp Energies Now MUTANT STRAINS OF TRICHODERMA REESEI
CN110724644A (en) * 2019-12-05 2020-01-24 西北农林科技大学 Trichoderma reesei engineering bacterium for producing recombinant human proinsulin and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994437A (en) * 2012-11-06 2013-03-27 大连理工大学 Streptomycete artificial zinc finger protein mutant strains with high yield of lignocellulose degrading enzymes and method for obtaining same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994437A (en) * 2012-11-06 2013-03-27 大连理工大学 Streptomycete artificial zinc finger protein mutant strains with high yield of lignocellulose degrading enzymes and method for obtaining same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
FEI ZHANG等: "Enhanced cellulase production from Trichoderma reesei Rut-C30 by engineering with an artificial zinc finger protein library", 《BIOTECHNOL. J.》 *
MA C等: "Improvement of acetic acid tolerance of Saccharomyces cerevisiae using a zinc-finger-based artificial transcription factor and identification of novel genes involved in acetic acid tolerance", 《APPL. MICROBIOL. BIOTECHNOL》 *
PARK KS等: "Phenotypic alteration and target gene identification using combinatorial libraries of zinc finger proteins in prokaryotic cells", 《J. BACTERIOL.》 *
杨帆等: "锌指蛋白在丝状真菌纤维素酶基因表达调控中的研究进展", 《纤维素科学与技术》 *
杨帆等: "锌指蛋白在丝状真菌纤维素酶基因表达调控中的研究进展", 《纤维素科学与技术》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3046180A1 (en) * 2015-12-28 2017-06-30 Ifp Energies Now MUTANT STRAINS OF TRICHODERMA REESEI
WO2017115033A1 (en) * 2015-12-28 2017-07-06 IFP Energies Nouvelles Mutant strains of trichoderma reesei
CN108738327A (en) * 2015-12-28 2018-11-02 Ifp新能源公司 The mutant strain of trichoderma reesei
CN110724644A (en) * 2019-12-05 2020-01-24 西北农林科技大学 Trichoderma reesei engineering bacterium for producing recombinant human proinsulin and application thereof

Also Published As

Publication number Publication date
CN104862237B (en) 2017-10-17

Similar Documents

Publication Publication Date Title
Ellilä et al. Development of a low-cost cellulase production process using Trichoderma reesei for Brazilian biorefineries
US11753631B2 (en) Host cell capable of producing enzymes useful for degradation of lignocellulosic material
Bala et al. Cellulolytic and xylanolytic enzymes of thermophiles for the production of renewable biofuels
Anasontzis et al. Homologous overexpression of xylanase in Fusarium oxysporum increases ethanol productivity during consolidated bioprocessing (CBP) of lignocellulosics
CN106978360A (en) One plant height cellulase-producing trichoderma reesei recombinant bacterial strain and its application
RU2008107784A (en) GENETIC CONSTRUCTION FOR PROVISION OF EXPRESSION OF TARGET HOMOLOGICAL AND HETEROLOGICAL GENES IN CELLS OF HEROSENUS CHEROMIUM CHESOME
Shin et al. Enhanced hydrolysis of lignocellulosic biomass: Bi‐functional enzyme complexes expressed in Pichia pastoris improve bioethanol production from Miscanthus sinensis
Karuppiah et al. Co-cultivation of T. asperellum GDFS1009 and B. amyloliquefaciens 1841: strategy to regulate the production of ligno-cellulolytic enzymes for the lignocellulose biomass degradation
WO2013070949A1 (en) Consolidated bioprocess for biofuel and chemical production from lignocellulosic biomass
CN103820347A (en) Industrial saccharomyces cerevisiae strain with acetic acid tolerance
Xia et al. Combined strategy of transcription factor manipulation and β-glucosidase gene overexpression in Trichoderma reesei and its application in lignocellulose bioconversion
CN104862237A (en) Trichoderma reesei recombinant strain containing artificial zinc finger transcription factor and application of Trichoderma reesei recombinant strain
Song et al. Simultaneous saccharification and fermentation of corncobs with genetically modified Saccharomyces cerevisiae and characterization of their microstructure during hydrolysis
Rastegari Molecular mechanism of cellulase production systems in penicillium
KR101744670B1 (en) Recombinant cellulase cocktails, recombinant yeast complex strains, and use thereof
WO2013122549A1 (en) A method for enzymatic hydrolysis of cellulose
CN113151264A (en) Method for constructing high-yield cellulase strain by utilizing forward regulatory gene and application
Song et al. Genetically modified Saccharomyces cerevisiae for one-step fermentation of bioalcohol using corncob as sole carbon source
US10526593B2 (en) Method for obtaining a composition for biomass hydrolysis
Chandel et al. Sustainable role of thermophiles in the second generation of ethanol production
Chetty Improvement of cell-surface adhered cellulase activities in recombinant strains of Saccharomyces cerevisiae engineered for consolidated bioprocessing
KR101463899B1 (en) Novel strain Cellulophaga sp. degrading polysaccharides and a method for degrading polysaccharides using the same
CN103589675A (en) Alkaline pectinase genetic engineering bacteria and construction method thereof
Auta Purification and characterisation of novel recombinant β-glucosidases from aspergillus with application in biofuel production
WO2015011319A1 (en) Myceliophthora thermophila host cell expressing a heterologous alpha-xilosidase enzyme and use thereof in a method for the degradation biomass

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20171017

Termination date: 20180614

CF01 Termination of patent right due to non-payment of annual fee