CN104846073B - The biological markers of prostate cancer, therapy target and application thereof - Google Patents
The biological markers of prostate cancer, therapy target and application thereof Download PDFInfo
- Publication number
- CN104846073B CN104846073B CN201510134198.7A CN201510134198A CN104846073B CN 104846073 B CN104846073 B CN 104846073B CN 201510134198 A CN201510134198 A CN 201510134198A CN 104846073 B CN104846073 B CN 104846073B
- Authority
- CN
- China
- Prior art keywords
- prostate cancer
- gene
- fusion
- cancer
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The biological markers of one group of prostate cancer are provided, wherein biological markers include fusion, long-chain non-coding RNA, gene mutation and alternative splicing body.Purposes of these biological markers in the target spot as the reagent of diagnosis of prostate cancer or the medicine for treating prostate cancer is also provided.
Description
Related application
The application is the applying date for September in 2011 16 days, entitled《Biological markers, the therapy target of prostate cancer
And application thereof》Chinese patent application 201180073445.7 divisional application.
Technical field
The present invention relates to cancer field, particularly prostate cancer.Meanwhile the present invention relates to using sequencing technologies of future generation,
With find be used for diagnose, prognosis and therapeutic response prediction biological markers and effectively treatment prostate cancer drug target,
Particularly it is used for the biological markers of prostate cancer.In the present invention, RNA-Seq technologies are especially used, i.e. transcript profile is sequenced
The transcript profile of technical Analysis prostate cancer tissue and Carcinoma side normal tissue, discloses the complete transcripting spectrum of Chinese human prostata cancer.
Background technology
In developed country, prostate cancer is still the highest tumour of incidence, while is arranged in male cancer associated death
Two.The incidence of whole world prostate cancer is constantly rising, but in country variant and race, its incidence is widely different.
Highest incidence is western countries, such as U.S.；Incidence it is minimum be East Asian countries, such as China, this species diversity may parts
It is as caused by not agnate gene difference.In addition, prostate cancer is a kind of different substantiality disease.Each tumour tumour into
Change and biological behaviour (such as Tumor dormancy, local growth, spreads, reaction and recurrence to treatment etc. at a distance) on difference very
Greatly.Therefore, histopathology Classification and stage and Gleason scorings are identical, patient that therapeutic scheme is identical, its Clinical Outcome with
And tumour progression history may be completely different.Some patients its tumour in a dormant state, be confined to prostate, can be with Ten Year Survival
More than, and 2-3 dies of the DISTANT METASTASES IN of tumour to other patients after diagnosis.A variety of evidences show, prostate cancer clinic row
For heterogeneity be during the tumour progression as in it molecular mechanism difference caused by.
Between past more than ten year, DNA and RNA chip technologies are widely used on analysis biological mechanism.It helps me
Have new understanding to the pathogenesis of prostate cancer, found for us for diagnosing, the life of prognosis and therapeutic response prediction
Thing marker provides the foundation.Although so far, before being used for of the OncotypeDx and MammoPrint of similar breast cancer
Row gland cancer genome prognosis detection is few, but some prostate cancer molecules changes being found are being applied to clinic in fact
Trample.(Taylor BS, et al. (2010) the Integrative genomic profiling of human such as Taylor
prostate cancer.Cancer Cell 18(1):11-22.) by being found to the comprehensive gene group analysis of prostate cancer,
The change of some gene copy numbers may distinguish evolving tumor and dormant trait tumour, and the discovery is significant.However, we are still
There is an urgent need to new biological markers more accurately to detect prostate cancer and improve to tumour progression and treatment final result
Predictive ability.
Although it is pointed out that understanding of the research to us to human tumor occurrence and development based on genetic chip
It is made that major contribution, but the technology has significant limitation, cannot such as detect change and the base mutation of genome structure.
The content of the invention
In the past few years, the rapid development of sequencing technologies (Next Generation Sequencing, NGS) of future generation
Overcome above-mentioned deficiency.NGS enables us with unprecedented high-resolution and the whole Oncogenome of high throughput analysis and turns
Record group.The data of NGS can be such as mutated from multiple angle analysis genomes, transcription, and (such as methyl is adjusted after structure variation and transcription
Change).In addition, continuously improving for NGS technologies enables scientist that the genome of main tumor type is sequenced.
At present, nearly all research for the horizontal change of prostate cancer genome and transcript profile be all in white man into
OK, the research of yellow is few.In our current research, we use RNA-Seq technologies, i.e., before transcript profile sequencing technologies analyze 14 pairs
The transcript profile of row adenocarcinoma tissue and Carcinoma side normal tissue.We are analyzed all transcription product types, disclose Chinese
The complete transcripting spectrum of prostate cancer.We, which have found many isomers, includes：Exon skipping, introne reservation, 5 ' and 3 '
Alternative splicing, Gene Fusion, point mutation, long-chain non-coding RNA are held, these all may be in the occurrence and development of prostate cancer
Work.Our research illustrates the complicated collection of illustrative plates of prostate cancer genome change, it was confirmed that the heterogeneity of prostate cancer, pushes away
Into the understanding of our centering Chinese Prostate Cancers.
1. the discovery and verification of prostate cancer New Fusion gene
(1) to Shanghai Changhai Hospital 14, to carrying out RNA-Seq in prostate cancer and cancer beside organism, (i.e. skill is sequenced in transcript profile to
Art), it is found that totally 4 documents do not report height by USP9Y-TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR
Frequency fusion and other dozens of fusions, referring to such as table 1 below.
1. prostate cancer New Fusion gene of table
(2) we these fusions are verified in 54 pairs of prostate cancers and cancer beside organism.We devise
The specific PCR primer of Gene Fusion.After PCR and agar electrophoresis, all RT-PCR amplified fragments are tapped and recovered (Qiagen
QIAquick Gel Extraction kit) Sanger sequencings parallel.We have found that 4 New Fusion genes of verification are in cancer
Specifically expressing, frequency are higher (the result is shown in Fig. 2-4) in tissue.It is not reported before these fusions, but it is in this research
It plays an important role in the generation of Chinese human prostata cancer for the middle higher prompting of frequency, these are expected to obtain in follow-up research
Illustrate.
(3) potential applicability in clinical practices：Expressed in cancerous tissue, the fusion do not expressed by cancer and in normal structure, is high
Spend specific prostate cancer marker, in blood, urine by real time PCR detect, prostate biopsy tissue and
Postoperative tissue, there are situation, for the early diagnosis of prostate cancer patient, molecule parting and is sentenced by FISH detection fusions gene
Disconnected patient's prognosis, while fusion can be as the target spot of targeted therapy.
2. the long-chain non-coding RNA of finding differences property expression
The transcripting spectrum of long-chain non-coding RNA in prostate cancer.More and more evidences show long-chain non-coding RNA thin
Work in many aspects of born of the same parents' biology, prompt it in the teiology of disease, including work in elaboration of tumour mechanism.To current
Untill, the overall transcriptional level that research before does not all set foot in long-chain non-coding RNA in tumour changes.Therefore, we exist first
The overall transcription spectrum of long-chain non-coding RNA is analyzed in prostate cancer tissue and its pairing Carcinoma side normal tissue, finds each mark
Averagely there are 1599 known long-chain non-coding RNA expression in this.Next, we are normal by prostate cancer tissue and pairing cancer
Tissue compares the expression of long-chain non-coding RNA, and discovery averagely has 406 long-chain non-coding RNAs variant between the two
Property expression (multiple change>=2, false positive rate, False positive Rate, FDR<=0.001), wherein 137 long-chains are non-
Consistent up-regulation or downward is all presented in coding RNA in 50% prostate cancer.
Because most of long-chain non-coding RNAs are found related with transcriptional regulatory, we have studied long-chain non-coding RNA table
Up to influence of the change to prostate cancer gene expression of amount.We analyze each long-chain non-coding RNA and all gene expressions
The correlation of amount.It is dividing value to be more than 0.85, False discovery rate less than 0.01 using absolute correlation coefficient, it has been found that with the non-volume of long-chain
The gene of code RNA height correlations.It is absorbing to be, there are 23 long-chain non-coding RNAs to be shown with hundreds of genes in full-length genome
Write related, and other most of genes are only with several gene-correlations, or not related.This prompting long-chain non-coding RNA
May there are the function beyond transcriptional regulatory, such as the adjusting in post-transcriptional level.It was unexpectedly determined that except two non-volumes of long-chain
Outside code RNA, almost all of long-chain non-coding RNA is proportionate with gene expression, prompts these long-chain non-coding RNAs to promote
Into the expression of gene.
In order to study the relation of long-chain non-coding RNA and prostate cancer, we have selected 4 long-chain non-coding RNAs (two
It is known：DD3 and MALAT1；Two new discoveries：FR257520 and FR348383), and with qRT-PCR in two groups of prostate samples
Detect their expression quantity.First group be 40 pairs of prostate cancer tissues and its pairing Carcinoma side normal tissue, second group be 15 just
Ordinary person's prostata tissue and 15 prostate cancer tissues.QRT-PCR and RNA-seq results have very strong correlation.With RNA-Seq
As a result consistent, PCA3, MALAT1 and FR348383 are overexpressed in most of prostate cancer samples, and FR257520 expression quantity drops
It is low.The result that PCA3 is overexpressed with thinking that it is similar that it is likely to become the research of new diagnosis marker before, but we send out first
Existing MALAT1, FR257520 and FR348383 are expressed in prostate cancer has notable difference with normal prostatic.
Potential applicability in clinical practice：Long-chain non-coding RNA is detected there are situation by real time PCR in blood, urine,
Early diagnosis, molecule parting for prostate cancer patient, at the same time as the target spot of targeted therapy, judge patient's prognosis.I
Result of study show that 137 long-chain non-coding RNAs can be used as biomarker, referring specifically to table 2.
2.137 long-chain non-coding RNAs of table
3rd, the detection of single nucleotide polymorphism and point mutation
We use SOAPsnp (Li RQ, Li YR, Fang XD, Yang HM, Wang J, et al. (2009) SNP
detection for massively parallel whole-genome resequencing.Genome Research
19:1124-1132.) detect single nucleotide polymorphism.Sanger sequence verifications are mutated.We reduce monokaryon by following steps
The false positive rate of nucleotide polymorphism detection, including delete the SNP of consistent property amount less than 20, positioned at donor splicing site 5bp with
Interior SNP and reading support the SNP no more than 2.In order to find new SNP, we are further in the six big SNP reported
Database is screened (YH, 1000genomes, Yoruba, Korean, Watson and NCBI dbSNP).
The prostate cancer spectrum of mutation.We averagely find 1725 point mutation in prostate cancer tissue.However, only one is small
Partly (average 1.5%) is located at the code area of gene.It is interesting that some point mutation are located at long-chain non-coding RNA.It is most
It is T to be mutated (91.7%):A to C:The mutation of G.Reasonably explain it is that this point mutation occurs to compile in RNA to one of the discovery
When collecting, for rna editing by the way that adenosine is changed into inosine, the latter is read as guanosint when translating
Glycosides, so as to cause the change of specific RNA nucleotide.
Find 309 point mutation altogether in the code area of 290 genes.Wherein 115 are silent mutation, 181 missense
Mutation, 13 be nonsense mutation.These mutation are not all found in more than one tumor tissues, are prompted in these prostate cancer samples
There is no hot spot mutation in this.However, it has been found that there are 3 samples to have the mutation positioned at UTP14C gene diverse locations, there are two
Sample has the mutation positioned at 4 gene (CBARA1, FRG1, NAMPT and ZNF195) diverse locations.We with Genomic PCR,
RT-PCR and Sanger sequencings confirm 30 mutation.Wherein 27 confirm in genomic level, and 29 in the horizontal confirmations of cDNA.
We, which also find 183, the gene of mutation, but most of is all low frequency mutation.This (Taylor such as with Taylor
BS,et al.(2010)Integrative genomic profiling of human prostate cancer.Cancer
Cell 18(1):11-22.) 138 genetic results of report are consistent.Mutation verification, which is carried out, in 30 genes finds RNA-Seq hairs
The accuracy being now mutated is respectively 96.7% (cDNA is horizontal) and 90% (genomic level).1 sample has KLK3 gene mutations.
It is especially surprising that all samples are all mutated without P53 and PTEN, and the two genes be in COSMIC databases with prostate
The highest gene of the cancer degree of correlation.Although mostly numerical mutation gene before be not reported in prostate cancer, wherein 118
It was found in other tumours, prostate cancer may also be caused by prompting the mutation of these genes.
Potential applicability in clinical practice：Extracted in being organized after prostate biopsy tissue or operation send sequencing to detect after DNA after row PCR
SNP and point mutation, for prostate cancer patient's molecule parting and drug therapy target, judge patient's prognosis there are situation.This hair
194 mutation of 183 genes of bright offer are referring to table 3, wherein preferable 30 gene mutations are as shown in table 8
3. prostatic cancer specific gene mutation of table
4. the detection of alternative splicing
Alternative splicing (alternative splicing, AS) is the universal phenomenon in eukaryotic, it can make gene
Different mRNA products are transcribed out, and then different isomer proteins may be translated.
(1) we using SpliceMap find shearing site, then detect different types of choosing with distinct methods
The shearing of selecting property includes exon skipping, introne retains and 5 ' and 3 ' shearing sites of selectivity.We find 28 marks first
All alternative splicings in this transcript profile.Then we, which find, exists only in cancerous tissue sample and it matches cancer beside organism and does not have
Alternative splicing.We have found thousands of alternative splicings, reads sequence by nonredundancy and sifts out one group of highly reliably difference
Property shearing.The introne for finding to have KLK3 (being also PSA) gene in the prostate cancer sample more than half retains, this may be produced
A kind of raw new protein sequence.The transcription product and albumen of alternative splicing are all possibly as the neontology of prostate cancer diagnosis
Label.The exon skipping for there are AMACR genes is found in a part of prostate cancer sample.Both alternative splicing modes
All it is verified with RT-PCR in sequencing group.We are verified in other 40 pairs of samples with RT-PCR at the same time, are found
Have in most cancerous tissue samples PSA intrones reservation, and in cancer beside organism almost without.PSA is few in number several
Biological markers conventionally used for diagnosis.However, the examination means accuracy at present based on PSA is limited.We newly send out
Existing PSA intrones retain the Sensitivity and Specificity for potentially contributing to improve PSA.Only 9 have in 40 cancerous tissue samples
AMACR gene extrons jump.
(2) potential applicability in clinical practices：Cut in blood, urine by real time PCR or ELISA detection selectivity
Cut there are situation, early diagnosis, molecule parting for prostate cancer patient, at the same time as the target spot of targeted therapy, sentence
Disconnected patient's prognosis.
4. alternative splicing body of table, including the variation of 3' shearing sites, the variation of 5' shearing sites, exon skipping and introne
Retain four kinds of modes.
3' shearing sites make a variation
5' shearing sites make a variation
Exon skipping
Introne retains
In order to understand, above-mentioned molecular genetics changes in prostate cancer, we with Gene Fusion, point mutation, otherness table
Reach, tumour-specific otherness shears relevant tumour and the signal path of the Taylor dysregulations described compares.Foundation
Documents and materials, the gene and known oncogene that are overexpressed in tumour are defined as activated gene by we, being expressed in tumour
The gene of downward and known tumor suppressor gene are defined as inactivated gene.We calculate each activated gene, inactivated gene exists
Frequency in 14 samples.If tumor specimen has one or more genes to have point mutation, Gene Fusion, difference in signal path
Opposite sex expression or the alternative splicing of tomour specific, we are considered as tumour and are changed in the signal path.We have found that
There are 3 very common signal paths (AR, Ras-PI3K-AKT and RB) to be changed in prostate cancer.
As other many tumours, prostate cancer is a kind of genetic disease, is the accumulation changed by series of genes
It is caused.Therefore, more detailed gene expression characteristics analysis will be helpful to more fully understand these diseases and promote to research and develop new individual
The targeted therapy of change.In addition, not agnate prostate-cancer incidence and clinical prognosis difference particularly between white man and yellow
It is very big.However, although the prostate cancer gene profile of white man is studied very deep, the correlative study in yellow is few.Originally grind
In studying carefully, we carry out RNA-Seq by 14 pairs of cancerous tissues and pairing Carcinoma side normal tissue and have studied above-mentioned two problems.This is at the same time
And disclose many aspects of prostate cancer transcript profile at the same time first, including Gene Fusion, alternative splicing, virus transcription fragment
With the expression and somatic mutation of long-chain non-coding RNA.Pass through the research to above-mentioned aspect, it has been found that different prostate cancers
Patient's transcript profile has very big heterogeneity.The comprehensive analysis of the gene alteration different to these finds to send out with Chinese human prostata cancer
Raw relevant signal path is similar with white man.These pathogenesis for being found to be Study of China human prostata cancer provide it is new can
Can, while provide the possibility mode for the treatment of prostate cancer.
Brief description of the drawings
Fig. 1 system tumor transcriptome analysis flow charts.
Fig. 2 fusion schematic diagrames.Wherein Fig. 2 c are CTAGE5-khdrbs3 fusion schematic diagrames, the of ctage5
The 8th extron of 23 extrons and khdrbs3 is merged；Fig. 2 d are Tmprss2-erg fusion schematic diagrames,
The 4th extron of the 1st extron of Tmprss2 and ERG is merged；Fig. 2 e are the occurrence frequencies of 5 fusions.
Fig. 3 fusion schematic diagrames.Wherein Fig. 3 a are USP9Y-TTTY15 fusion schematic diagrames, are shown outside the 3rd of USP9Y
The 4th extron of son and TTTY15 are merged；Fig. 3 b are the RT-PCR results of USP9Y-TTTY15.
Fig. 4 fusion schematic diagrames.Wherein Fig. 4 a RAD50-PDLIM4 fusions RT-PCR and sanger sequencing knot
Fruit；Fig. 4 b are SDK1-AMACR fusion RT-PCR and sanger sequencing results.
The differential expression of Fig. 5 long-chain non-codings.Wherein Fig. 5 c are long-chain non-coding RNA DD3MALAT1FR0257520FR
0348383 differential expression in 40 pairs of cancers and cancer beside organism；Fig. 5 d are long-chain non-coding RNAs：DD3、MALAT1、
Differential expressions of the FR0257520 and FR0348383 in prostate cancer and Benign Prostatic Hyperplasia Tissuess.
Embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.
Unless otherwise defined, otherwise there are scientific and technical terms used herein those skilled in the art usually to manage
The implication of solution.In order to be better understood from the present invention, the definition of following term is specifically provided.
It was found that fusion, long-chain non-coding RNA, mutation, the common step of alternative splicing：Collect prostate cancer patient
Sample->After cancerous tissue and cancer beside organism's row frozen section by virologist check ensure quality->Prepare cDNA library->
RNA-Seq—>By sequencing result genome and transcript profile positioning->By gene and long-chain non-coding RNA expression standard
The long-chain non-coding RNA of differential expression, the mutation of alternative splicing and tumour-specific, fusion are found after change.
One aspect of the present invention provides the biological markers for prostate cancer, including fusion as shown in Table 1,
The gene mutation shown in long-chain non-coding RNA, table 3 shown in table 2, the one or more in the alternative splicing shown in table 4.
Biological markers of the present invention, it further can be used as the early diagnosis marker of prostate cancer, medicine
Treat Effective judgement marker or patient's prognostic marker.
In the embodiment of the present invention, in the biological markers, the fusion includes the 83 of table 6
One or more in a fusion, preferably include one kind or more in 35 fusions in table 6 shown in underscore
Kind.
In the embodiment of the present invention, in the biological markers, the fusion includes USP9Y-
One or more in TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR, preferably fusion
USP9Y-TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR are expanded with the primer described in table 5.
In the embodiment of the present invention, in the biological markers, the long-chain non-coding RNA includes
One or more in DD3, MALAT1, FR0257520, FR0348383, preferably described long-chain non-coding RNA：DD3、
MALAT1, FR0257520, FR0348383 are expanded with the primer described in table 7.
In the embodiment of the present invention, in the biological markers, the gene mutation is included such as the institute of table 8
One or more in 30 gene mutations shown, preferably 30 shown in earth's surface 8 gene mutation are carried out with the primer described in table 9
Amplification.
The present invention embodiment in, in the biological markers, the alternative splicing include PSA or
AMACR, being preferably chosen property shearing PSA or AMACR are expanded with the primer described in table 10.
The opposing party of the present invention provides the biological markers in the reagent as diagnosis of prostate cancer or treatment
Purposes in the target spot of the medicine of prostate cancer, the particularly early diagnosis marker as prostate cancer, drug therapy are effective
The purposes of property judgement symbol thing or patient's prognostic marker.
Another aspect of the present invention further provides the primer or the biology for expanding the biological markers
Learn purposes of the probe of marker in the reagent that preparation is used for for diagnosis of prostate cancer.Wherein, the primer can be used for special
Property the amplification biological markers, the probe specificity is combined with the biological markers, so as to indicate the biology
Learn the presence of marker.
In the embodiment of the present invention, there is provided for expanding the primer of the biological markers, wherein institute
State primer and preferably include primer described in table 5, its be used for fusion USP9Y-TTTY15, CTAGE5-KHDRBS3,
RAD50-PDLIM4、SDK1-AMACR；Primer shown in table 7, it is used to expand long-chain non-coding RNA：DD3、MALAT1、
FR0257520、FR0348383；Primer shown in table 9, it is used to expand 30 gene mutations shown in table 8；Shown in table 10
Primer, it is used to expand alternative splicing PSA or AMACR.
In the embodiment of the present invention, there is provided the primer described in table 5 is preparing the reagent of diagnosis of prostate cancer
In purposes.
In the embodiment of the present invention, there is provided the primer shown in table 7 is preparing the reagent of diagnosis of prostate cancer
In purposes.
In the embodiment of the present invention, there is provided the primer shown in table 9 is preparing the reagent of diagnosis of prostate cancer
In purposes.
In the embodiment of the present invention, there is provided the primer shown in table 10 is preparing the reagent of diagnosis of prostate cancer
In purposes.
Embodiment
1. differential genes expression analysis of embodiment
1. collect prostate cancer patient's sample
Patient and sample.
14 pairs of prostate cancer tissues and Carcinoma side normal tissue for RNA-Seq are derived from Shanghai Changhai Hospital.54 pairs are used for
The sample of Gene Fusion verification：23 pairs are come this Zhongshan University from Shanghai Changhai Hospital, 17 pairs from Jiangsu provincial hospital, 14 pairs
3rd affiliated hospital.One group 40 for alternative splicing, the prostate cancer of long-chain non-coding RNA verification and cancer beside organism to being derived from
Shanghai Changhai Hospital.(benign prostate increases by another group of 15 tumor samples for being used for the verification of long-chain non-coding RNA and 15 BPH
It is raw) sample is taken respectively from Jiangsu provincial hospital and Shanghai Changhai Hospital.The code of RNA-Seq and its follow-up test have obtained 3
The approval of Hospital Ethical Committee of family.All patients fill in Written informed consent, authorize us to use their sample.
2. checked after cancerous tissue and cancer beside organism's row frozen section by virologist and ensure quality
Pathologic finding
By the disease of this research after cancerous tissue and Carcinoma side normal tissue frozen section progress HE dyeing (hematoxylin eosin staining)
Neo-confucian is checked to ensure that selected tissue cancerous tissue density more than 80%, while does not have cancerous tissue in Carcinoma side normal tissue.It is all
Pathology sample is checked by another virologist.If there is the inconsistent situation of conclusion, two virologists inquire into jointly with
Determine conclusion.
3. prepare cDNA library and RNA-Seq
Oligomerization deoxythymidine magnetic bead is used to separate poly A mRNA from total serum IgE.MRNA will be purified with fragmentation buffer
Fragmentation.Using these short-movie sections as template, first segment cDNA chains are synthesized with random hexamers.Second segment cDNA chains are used
Buffer solution, dNTPs, RNase H and DNA polymerases I synthesis.Short double stranded cDNA fragment QIAQuick PCR extraction
Kit (vendor) is purified and eluted with EB buffer solutions to repair end and add " A ".Then, short-movie section is connected to
On Illumina sequencing adaptors.The DNA of purpose fragment size is used for PCR amplification by rubber tapping purifying.With
Illumina HiSeqTM2000 pairs of amplification libraries are sequenced.
(article No. is by mRNA-Seq 8-Sample Prep Kit that cDNA library structure is provided using Illumina companies：
RS-100-0801) carry out, its concrete operations flow is：Oligomerization deoxythymidine magnetic bead is used to separate poly A from total serum IgE
mRNA.MRNA fragmentations will be purified with fragmentation buffer.Using these short-movie sections as template, closed with random hexamers
Into first segment cDNA chains.Second segment cDNA chains buffer solution, dNTPs, RNase H and DNA polymerases I synthesis.Short double-strand cDNA
Fragment is purified with QIAQuick PCR extraction kit (Qiagen) and eluted with EB buffer solutions to repair end and add
“A”.Then, short-movie section is connected on Illumina sequencing adaptors.The DNA of purpose fragment size is tapped rubber
Purifying is used for PCR amplification.Determined by using Agilent 2100Bioanalyzer biological analysers and Stepone plus fluorescence
Amount PCR instrument carries out cDNA library after quality testing that (criterion of acceptability is：Pcr amplification product size is 322 ± 20bp, wherein inserting
It is 200 ± 20bp to enter short-movie section size, and library molar concentration is not less than 1.3nM), using with Illumina HiSeqTM2000 pairs
Amplification library is sequenced.
4. data analysis
Original reading screening
The image of sequenator generation is subjected to base calling processing by supporting sequenator control software.Original sequence
Row save as fastq forms.Dirty reading is deleted before analysis data.We delete dirty reading with three standards：
1) dirty reading is deleted；
2) reading of " N " base more than 2% is deleted；
3) the low quality reading for having the base of more than 50% QA≤15 is deleted.
All analysis below are all based on the reading after arranging.
Reading is positioned on human genome and transcript profile.
The genome and the reference sequences of transcript profile that we use are to download (hg18version) from UCSC websites.We
Use SOAP2 (Short Oligonucleotide Analysis Package (SOAP) aligner (SOAP2)；Li R,Yu
C,Li Y,Lam TW,Yiu SM,et al.(2009)SOAP2:an improved ultrafast tool for short
read alignment.Bioinformatics 25:1966-1967) method by the reading after arrangement respectively with genome and turn
Record group is contrasted.The mismatch number of each reading is no more than 3.
The standardization of gene and long-chain non-coding RNA expression.
The reading that specific gene can be positioned to is used for calculation expression level.Gene expression dose is every million read
Read number from Mr. Yu's gene per kilobase length.Formula is as follows：
C is the copy number of selected gene reading；N is the copy number of all reading genes；L is the total of selected gene extron
Length.Gene for having more than an alternative transcription product, longest transcription product are used to calculate RPKM.RPKM methods can
The influence that elimination different genes length and sequence difference calculate gene expression.Therefore, RPKM is used directly for comparative sample
The differential expression of this gene.
We calculate non-coding RNA expression with same procedure.
5. difference expression gene is analyzed
With reference to " conspicuousness of digital gene express spectra " (such as Audic S＆Claverie JM (1997) The
significance of digital gene expression profiles.Genome Res 7(10):986-995), I
Use False discovery rate<=0.001 and multiple change>=2 have found by 14 pairs of prostate cancer tissues and pairing cancer as standard
The gene of differential expression in normal structure.Each sample generation averagely sequencing of 66,432,064 readings and 5.98Gb sizes
Nucleotide.By SOAP2 technologies, 84.4% reading is navigated to human genome (UCSC hg18version) by we.It is logical
Cross contrast cancerous tissue and match the transcript profile sequence of Carcinoma side normal tissue, we have found in row gland cancer sample in each of front
Gene Fusion, the long-chain non-coding RNA of differential expression, the gene of alternative splicing and differential expression.Additionally, it has been found that
Average each cancerous tissue sample has 1725 point mutation.These results are disclosed in prostate cancer there is very big heterogeneity, together
When signal path and molecular mechanism work in the generation of prostate cancer.
The discovery and verification of 2. prostate cancer New Fusion gene of embodiment
We by short rna reading compared with reference gene group when find, some sequences will be divided into two sections of ability and gene
Group matches.This kind of reading need to meet the following conditions：
A) it is not shorter than 8bp compared with short fragment size；
B) pay attention to no matter introne where (from 5 ' to 3 ', normal chain or minus strand)
Two sections of contrapositions are analyzed, we allow to be no more than the mismatch of one and are aligned without room.
RT-PCR and sequence verification Gene Fusion.We test the Gene Fusion that RNA-Seq is obtained in transcriptional level
Card.We devise the specific PCR primer of Gene Fusion.After PCR and agar electrophoresis, all RT-PCR amplified fragments are tapped rubber back
Receive (Qiagen QIAquick Gel Extraction kit) parallel Sanger sequencings.We demonstrate 5 in this way
Fusion, is TMPRSS2-ERG, USP9Y-TTTY15, SDK1-AMACR, CTAGE5-KHDRBS3, RAD50- respectively
PDLIM4, wherein other 4 fusions in addition to TMPRSS2-ERG are that the present inventor is newfound.
4 newfound fusions are：
>39a fwd chrY 15539b fwd chrY
USP9Y-TTTY15
GATAACTACATAAAGAGACAAAAAAAAGAAAAAAGAGCAAAGATCTGTGCTGTGTCAAGTATGACAGCCATCACTCA
TGGCTCTCCAGTAGGAGGGAACGACAGCCAGGGCCAGGTTCTTGATGGCCAGTCTCAGCATCTCTTCCAACAGAACC
AGgaatcaaacttgacgtatggagccaagaaagcccttggaaaaactggcctcatattttgtgtacacagtccctgt
acagggtttctgacctgtg
>31a fwd chr7 121 31b rev chr5
SDK1-AMACR
ACCTTCCTGGTGCCCCATCCAACCTGGTCATTTCCAACATCAGCCCTCGCTCCGCCACCCTTCAGTTCCGGCCAGGC
TATGACGGGAAAACGTCCATCTCCAGGTGGATTGTTGAGGGGCAGgtgtcatggagaaactccagctgggcccagag
attctgcagcgggaaaatccaaggcttatttatgccaggctgagtggatttggccagtcaggaagcttctgccggtt
agctggccacgatatcaactatttggctttgtcag
>2a site:235 ID:4253 fwd_chr14<=>fwd_chr8 ID:10656
CTAGE5-KHDRBS3
AATTTAAATGTGCCTGATTCATCTCTCCCTGCTGAAAATGAAGCCACTGGCCCTGGCTTTGTTCCTCCACCTCTTGC
TCCAATCAGAGGTCCATTGTTTCCAGTGGATGCAAGAGGCCCATTCTTGAGAAGAGGACCTCCTTTCCCCCCACCTC
CTCCAGGAGCCATGTTTGGAGCTTCTCGAGATTATTTTCCACCAGGGGATTTCCCAGGTCCACCACCTGCTCCATTT
GCAAtggtgctgattactatgattacggacatggactcagtgaggagacttatgattcctacg
>44a fwd chr5 113 44b fwd chr5 10111(RAD50)8572(PDLIM4)
CAAAAAGAAACTGAACTTAATAAAGTAATAGCTCAACTAAGTGAATGCGAGAAACACAAAGAAAAGATAAATGAAGA
TATGAGACTCATGAGACAAGATATTGATACACAGAAGgtccatgctggcagcaaggctgcattggctgccctgtgcc
caggagacctgatccaggccatcaatggtgagagcacagagctcatgacacacctggaggcacagaaccgcatcaag
ggctgccacgatcacctcacactgtctgtgagcag
Wherein capitalization represents the sequence of first gene, the sequence of second gene of lowercase letter.
For the amplimer such as table 5 below of this 5 fusions.
The amplimer of 5.5 fusions of table
PCR conditions are：95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；38-43 circulation.
Use PCR purification kit PCR Cleanup Kit 50-prep (AXYGEN, Cat No.AP-PCR-50, Lot
No.KB10101204-G PCR product purifying) is carried out, 2% agarose gel electrophoresis is carried out to PCR product, uses glue reclaim reagent
Box DNA Gel Extraction Kit 50-prep (AXYGEN, Cat No.AP-GX-50, Lot No.KE10101204-G)
Carry out glue reclaim.
There is the electrophoresis picture of fusion, respectively attend and see Fig. 2 d (TMPRSS2-ERG and CTAGE5-KHDRBS3), Fig. 3 a
With b (USP9Y-TTTY15) and Fig. 4 a (RAD50-PDLIM4), Fig. 4 b (SDK1-AMACR).
Screen the Gene Fusion of high frequency.After demonstrating Gene Fusion with RT-PCR, we test in other 54 pairs of samples
Each (above 4) fusion is demonstrate,proved.The RNA and reverse transcription for extracting all samples first are cDNA.RT-PCR primer with it is upper
It is identical to state verification primer.The cDNA of sample is sequenced as positive control.
Prostate cancer Gene Fusion collection of illustrative plates.The Gene Fusion that transcript profile sequencing be used to detect in prostate cancer earliest shows
As.Using pairing end reading, we have found 84 Gene Fusions altogether.Except well-known TMPRSS2-ERG genes
Fusion is outer, we have found 83 new Gene Fusions, these are not all reported in the research for white man before.35
It is new and 1 before known to Gene Fusion be detected in prostate cancer tissue and be not found in (seeing below in pairing Carcinoma side normal tissue
The fusion of dashed part), in addition there is fusion to be expressed in Carcinoma side normal tissue (see black matrix thickened portion), specific biology
It is temporarily unknown to learn meaning, also has following 4 fusions to have by cancer and cancer.
The Gene Fusion only expressed in cancer is defined as tumor-specific genes fusion.The gene of each cancerous tissue sample melts
Conjunction number, which is respectively 1 to 6, to be differed.83 new genes fusion is as shown in table 6, is drawn below 35 new Gene Fusions therein
Line marks
6.83 new gene fusions of table
Most common Gene Fusion is TMPRSS2-ERG and USP9Y-TTTY15.The two sees 14 sequencing prostates
3 samples in cancerous tissue sample.We detect that another most common fusion is dyed positioned at Y by RNA-Seq
USP9Y-TTTY15 on body.USP9Y encodes the albumen for being similar to ubiquitin-specific protease, and TTTY15 is one non-
Coding RNA.USP9Y gene delections or mutation are related with male sterility.However, research before does not all disclose above two gene
It is related with tumour generation.In RNA-Seq results, the 3 exons fusion of 3 exons and TTTY15 genes of USP9Y genes
The USP9Y-TTTY15 frequencies (3/14=21.4%) of formation are identical with TMPRSS2-ERG.But RT-PCR has found 54 forefront
19 have USP9Y-TTTY15 in adenocarcinoma tissue.Be not reported before the fusion, but its frequency is higher in our current research
It is prompted to play an important role in the generation of Chinese human prostata cancer, these are expected to be elucidated in follow-up research.It is interesting
, the transcription product of the fusion is found seemingly with open reading frame (ORF) forecasting tool Six-Frame Translation
There is no open reading frame, it is probably non-coding RNA to prompt it.It has been found that the fusion may cause lacking for USP9Y functions
The fusion transcription product for a new non-coding of becoming estranged.The fusion is higher in sequencing sample and verification sample to be gone out
Existing frequency prompts it to play an important role in prostate cancer.
In 54 pairs of prostate cancer samples, we also demonstrate other 3 (CTAGE5-KHDRBS3, SDK1-AMACR
And RAD50-PDLIM4) Gene Fusion, their frequency is 37%, 20%, 33.3% respectively.
The discovery and verification of 3. prostate cancer long-chain non-coding RNA of embodiment
(1) is from http://www.ncrna.org/frnadb/download downloads ncRNA databases, then deletes piece
Section ncRNA, zRNA less than 200nt and non-human RNA simultaneously obtains 2981 long-chain non-coding RNAs.Next we are counted with this
The expression of long-chain non-coding RNA is calculated according to storehouse.Match the mark of the long-chain non-coding RNA differential expression of sample by cancer and cancer
Standard is：False discovery rate<=0.001, multiple changes>=2.The long-chain that selection is unanimously raised or lowered in more than 50% sample is non-
The coding RNA cluster analysis that exercises supervision (it is poly- to carry out gene and long-chain non-coding RNA express spectra using cluster 3.0 layering
Alanysis).The further correlation analysis of row long-chain non-coding RNA and gene.We are selected more than 50% prostate cancer sample
In the long-chain non-coding RNA that unanimously raises or lower and analyze their phases with all genes found in prostate cancer tissue
Guan Xing.The expression of long-chain non-coding RNA and gene (RPKM) is used as calculating coefficient R.
(2) (our .qRT-PCR verification long-chains non-coding RNA existed using Power SYBR Green Mastermix reagents
Applied Biosystems Step One Plus are qRT-PCR.GAPDH primers are used as internal reference.One group 40 as described above right
Prostate cancer and cancer beside organism are derived from Shanghai Changhai Hospital, and another group takes respectively for 15 tumor samples and 15 BPH samples
From Jiangsu provincial hospital and Shanghai Changhai Hospital, verified for long-chain non-coding RNA.Use two-step method PCR amplification standardization program：
Stage1：Pre-degeneration (Reps:1；95 DEG C 30 seconds)；Stage2：PCR reacts (Reps：40；95 DEG C 5 seconds；60 DEG C 34 seconds)；
Dissociation Stage (dissociation stage).
Devise the primer such as table 7 below for 4 long-chain non-coding RNAs：
The primer of 7.4 long-chain non-coding RNAs of table
All experiments all carry out parallel repetition using two or three holes and test, as a result with being averaged relative to GAPDH
Multiple, which changes, draws (Fig. 5).We have found that there are 137 long-chain non-coding RNAs all to be presented unanimously in 50% prostate cancer
Up-regulation is lowered.The correlation that we analyze each long-chain non-coding RNA and all gene expression amounts finds there are 23 long-chains
Non-coding RNA and hundreds of genes in full-length genome are significantly correlated, and other most of genes only with several gene-correlations, or
It is not related.
Interpretation of result part
We are in 40 pairs of prostate cancers and cancer beside organism, 15 normal human prostate tissues and 15 prostate cancer tissues
Middle verification finds that PCA3 (also known as DD3), MALAT1 and FR0348383 are overexpressed in most of prostate cancer samples, and
FR0257520 expression quantity reduces (Fig. 5).The result and think that it is likely to become new diagnosis marker before that PCA3 is overexpressed
Study it is similar, but we find first MALAT1 be overexpressed frequency it is very high in prostate cancer.
It can be used for diagnosing the present invention provides 137 long-chain non-coding RNAs, judge patient's prognosis and drug response, and
The target spot for the treatment of, referring to table 2.
4. single nucleotide polymorphism of embodiment and the discovery and verification of point mutation
(1) we using SOAPsnp detection single nucleotide polymorphism.The software is by that will survey with repetition sequencing approach
Sequence sequence contrasts with known array the individual consensus sequence being newly sequenced being assembled into genome.By by consensus sequence with reference
Sequence compares, and can find single nucleotide polymorphism.
(2) we made a variation with candidate's base-pairs for filtering out of RT-PCR joint Sanger sequence verifications RNA-Seq.PCR bars
Part is：95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；38-43 circulation.Sample is from Shanghai Changhai Hospital 14 to prostate cancer
And cancer beside organism.We randomly choose 30 encoding histone mutation and are verified.Wherein 27 exist only in cancerous tissue (cDNA and
Have in DNA), and it is not found in Carcinoma side normal tissue (cDNA and DNA in equal nothing).2 rarely seen and cancerous tissue cDNA that make a variation, and not
See normal structure cDNA.1 variation does not have in cancerous tissue and Carcinoma side normal tissue.
Have verified that 30 mutation of table 8., wherein the template that a most right row are is CDNA and DNA respectively, S representatives into
Work(, F represent failure.
Primer used in 9.30 mutation of table
(3) all samples of are all mutated without P53 and PTEN, and the two genes be in COSMIC databases with prostate
The highest gene of the cancer degree of correlation.Although mostly numerical mutation gene before be not reported in prostate cancer, wherein 118
It was found in other tumours, prostate cancer may also be caused by prompting the mutation of these genes.
The present invention provides 183 mutation, these mutation can be used as diagnosis marker, Index for diagnosis, curative effect of medication to judge
And therapy target, referring specifically to table 3.
The discovery and verification of 5. alternative splicing of embodiment
The method that we are used to detect alternative splicing mainly includes two steps：
1) reading is navigated to people's reference sequences by us using SOAPsplice 1.1, then according to tie point reading (with
The corresponding reading of the two or more independent segments of reference sequences, is separated by introne between the two fragments) contrast knot
Fruit finds shearing site.We using the default parameters of SOAPsplice, allow 3 mistakes for the reading completely compared as far as possible
Match somebody with somebody, each fragment of reading compared for segmentation only allows 1 mispairing.
2) according to alternative splicing mechanism, we detect four kinds of basic selectivity using shearing site and comparing result
Shearing, including exon skipping, 5 ' shearing sites of selectivity, 3 ' shearing sites of selectivity and introne retain.
After finding out four kinds of alternative splicings, we, which select, is present in cancerous tissue selection in Carcinoma side normal tissue may be not present
Property shearing.To each cancerous tissue sample, we calculate 3 kinds of alternative splicings of support respectively, and (exon skipping, selectivity 5 ' are sheared
3 ' shearing sites of site and selectivity) corresponding connection site tie point number of readings per taken and introne reservation event in retain
The mean depth of the introne come.Because every kind of alternative splicing enormous amount, we are by taking 0.99 percentile to obtain
The alternative splicing of high confidence level, and by drawing circos figures to disclose some common patterns.By taking 1T as an example, it has 2047
3 ' shearing sites of selectivity.The tie point reading of 3 ' shearing sites of selectivity is supported to be differed from 1 to 609, its 0.99 percentile
It is 69.Therefore, we retain the shearing site of selectivity 3 ' of tie point reading >=69.In addition, we are also deleted by cancer just
The alternative splicing often also having in tissue.Finally, we obtain one group it is special with the cancer of the corresponding high confidence of each sample
Alternative splicing.RT-PCR verifies alternative splicing.We extract total serum IgE from frost cancerous tissue and cancer beside organism, then take 5
μ gRNA reverse transcriptions are cDNA (Qiagen QuantiTect Reverse Transcription kit).We are in 40 pairs of cancer groups
Knit and alternative splicing is verified with RT-PCR with Carcinoma side normal tissue.
PCR conditions are：95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；33-36 circulation.Wherein especially two genes draw
Thing is as follows：
The amplimer of table 10.PSA and AMACR alternative splicing
Alternative splicing forward primer reverse primer
PSA CCAAGTTCATGCTGTGTGCT TGCCTAGTAACCGTGTGCTG
AMACR GGGAAAATCCAAGGCTTATTTATG AAGTCGTATAGAAAGGTGCTCCAC
Invention provides the alternative splicing of tumour-specific as shown in table 4, these alternative splicings can be used as blood
The diagnosis marker of liquid, urine and tissue, can also be also used as tumour and controls as judging prognosis, the marker of therapeutic effect
The target spot for the treatment of.
The introne for finding to have KLK3 (being also PSA) gene in the prostate cancer sample more than half retains, at one
The exon skipping for there are AMACR genes is found in point prostate cancer sample.Both alternative splicing modes are all existed with RT-PCR
Sequencing group is verified.We are tested in 40 pairs of samples (40 samples from Changhai hospital) with RT-PCR at the same time
Card, finds there is the reservation of PSA intrones in most cancerous tissue samples, and in cancer beside organism almost without.40 cancerous tissue samples
Only 9 have the jump of AMACR gene extrons in this.
Although the embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.Root
According to disclosed all teachings, various modifications and replacement can be carried out to those details, these change in the guarantor of the present invention
Within the scope of shield.The four corner of the present invention is provided by appended claims and its any equivalent.
Claims (2)
1. the primer of the biological markers fusion CTAGE5-KHDRBS3 for expanding prostate cancer, it is characterised in that
The nucleotide sequence of the primer is as follows：
Forward primer：TGCTGAAAATGAAGCCACTG；
Reverse primer：GGACTGGTGGAGATTGGCTA.
2. the biological markers fusion CTAGE5-KHDRBS3 for being used to expand prostate cancer described in claim 1 draws
Purposes of the thing in the reagent that preparation is used for for diagnosis of prostate cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510134198.7A CN104846073B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510134198.7A CN104846073B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201180073445.7A CN103797120B (en) | 2011-09-16 | 2011-09-16 | Prostate cancer biomarkers, therapeutic targets and uses thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201180073445.7A Division CN103797120B (en) | 2011-09-16 | 2011-09-16 | Prostate cancer biomarkers, therapeutic targets and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846073A CN104846073A (en) | 2015-08-19 |
| CN104846073B true CN104846073B (en) | 2018-04-13 |
Family
ID=53835753
Family Applications (6)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134100.8A Active CN104830972B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134198.7A Active CN104846073B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134199.1A Active CN104845992B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134196.8A Active CN104846072B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134175.6A Active CN104846071B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134173.7A Active CN104846070B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134100.8A Active CN104830972B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Family Applications After (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134199.1A Active CN104845992B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134196.8A Active CN104846072B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134175.6A Active CN104846071B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134173.7A Active CN104846070B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (6) | CN104830972B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107362353A (en) * | 2016-05-11 | 2017-11-21 | 上海长海医院 | A kind of related drug target of prostate cancer of castration resistance and its application |
| CN109762905A (en) * | 2019-03-11 | 2019-05-17 | 天津脉络医学检验有限公司 | It is a kind of for assist detection prostate cancer ddPCR Primer composition and its application |
| CN111518908B (en) * | 2020-05-18 | 2023-10-17 | 奥尔文泰生物科技(杭州)有限公司 | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009094312A2 (en) * | 2008-01-22 | 2009-07-30 | Veridex, Llc | Detection of gstp1 hypermethylation in prostate cancer |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050259483A1 (en) * | 2002-09-30 | 2005-11-24 | Oncotherapy Science, Inc. | Genes and polypeptides relating to prostate cancers |
| US20100143247A1 (en) * | 2004-11-24 | 2010-06-10 | St. George's Enterprises Limited | Diagnosis of prostate cancer |
| ZA200803021B (en) * | 2005-09-12 | 2010-09-29 | Univ Michigan | Recurrent gene fusions in prostate cancer |
| MX2010008572A (en) * | 2008-02-04 | 2010-11-30 | Bipar Sciences Inc | Methods of diagnosing and treating parp-mediated diseases. |
| WO2009147537A2 (en) * | 2008-05-27 | 2009-12-10 | Dako Denmark A/S | Compositions and methods for detection of chromosomal aberrations with novel hybridization buffers |
| CN101386889A (en) * | 2008-10-31 | 2009-03-18 | 芮屈生物技术（上海）有限公司 | Kit for AMACR gene hybridization in situ, detection method and use thereof |
-
2011
- 2011-09-16 CN CN201510134100.8A patent/CN104830972B/en active Active
- 2011-09-16 CN CN201510134198.7A patent/CN104846073B/en active Active
- 2011-09-16 CN CN201510134199.1A patent/CN104845992B/en active Active
- 2011-09-16 CN CN201510134196.8A patent/CN104846072B/en active Active
- 2011-09-16 CN CN201510134175.6A patent/CN104846071B/en active Active
- 2011-09-16 CN CN201510134173.7A patent/CN104846070B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009094312A2 (en) * | 2008-01-22 | 2009-07-30 | Veridex, Llc | Detection of gstp1 hypermethylation in prostate cancer |
Non-Patent Citations (1)
| Title |
|---|
| Discovery of non-ETS gene fusions in human prostate cancer using next-generation RNA sequencing;Dorothee Pflueger et al.;《Genome Research》;20101029;第21卷(第1期);56-67 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104846072B (en) | 2018-12-07 |
| CN104830972A (en) | 2015-08-12 |
| CN104830972B (en) | 2019-03-15 |
| CN104846071B (en) | 2019-03-15 |
| CN104846071A (en) | 2015-08-19 |
| CN104846073A (en) | 2015-08-19 |
| CN104846070B (en) | 2018-02-09 |
| CN104846072A (en) | 2015-08-19 |
| CN104846070A (en) | 2015-08-19 |
| CN104845992B (en) | 2018-09-14 |
| CN104845992A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103797120B (en) | Prostate cancer biomarkers, therapeutic targets and uses thereof | |
| Lorenzi et al. | Long noncoding RNA expression profiling in cancer: challenges and opportunities | |
| Waddell et al. | Gene expression profiling of formalin‐fixed, paraffin‐embedded familial breast tumours using the whole genome‐DASL assay | |
| CN104685065B (en) | Breast cancer biomarker signatures for invasiveness and prognosis | |
| JP2022521492A (en) | An integrated machine learning framework for estimating homologous recombination defects | |
| CN107475375A (en) | A kind of DNA probe storehouse, detection method and kit hybridized for microsatellite locus related to microsatellite instability | |
| CN107075730A (en) | The identification of circle nucleic acid and purposes | |
| CN113337604A (en) | Identification and use of circulating nucleic acid tumor markers | |
| CN106755344A (en) | Molecular marked compound and its application for the diagnosis of cancer of pancreas clinical prognosis | |
| CN109563544A (en) | The diagnostic assay of urine monitoring for bladder cancer | |
| CN104846073B (en) | The biological markers of prostate cancer, therapy target and application thereof | |
| Zhang et al. | Intratumor heterogeneity and clonal evolution revealed in castration-resistant prostate cancer by longitudinal genomic analysis | |
| CN110004229A (en) | Application of the polygenes as EGFR monoclonal antibody class Drug-resistant marker | |
| CN116631508B (en) | Detection method for tumor specific mutation state and application thereof | |
| CN108315425A (en) | PCR specific primers, kit and its application method of metastasis of thyroid carcinoma related gene detection | |
| Wang et al. | Clinicopathological and molecular characterization of biphasic hyalinizing psammomatous renal cell carcinoma: further support for the newly proposed entity | |
| US10443102B2 (en) | Recurrent SPOP mutations in prostate cancer | |
| CN113817822B (en) | Tumor diagnosis kit based on methylation detection and application thereof | |
| CN114045344A (en) | Urine miRNA marker for prostate cancer diagnosis, diagnostic reagent and kit | |
| CN108342483B (en) | Group of genes for molecular typing of non-hyper-mutant colorectal cancer and application thereof | |
| CN113564172A (en) | Liquid biopsy tumor cell DNA aptamer | |
| CN106148511A (en) | A kind of liver cancer patient accepts predicting marker and the test kit of recurrence after resection risk | |
| CN115466794B (en) | Tumor marker and application thereof in preparation of colorectal cancer diagnosis kit | |
| Chen | SUPPLEMENTARY METHODS Patient selection | |
| Fraser et al. | Prostate cancer genomics as a driver of personalized medicine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20151214 Address after: 200433 Shanghai city Yangpu District Changhai Road No. 168 Applicant after: Shanghai Changhai Hospital Applicant after: BGI SHENZHEN CO LTD Address before: 200433 Shanghai city Yangpu District Changhai Road No. 168 Applicant before: Shanghai Changhai Hospital Applicant before: BGI-Shenzhen Co., Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |