CN104846072B - The biological markers of prostate cancer, therapy target and application thereof - Google Patents
The biological markers of prostate cancer, therapy target and application thereof Download PDFInfo
- Publication number
- CN104846072B CN104846072B CN201510134196.8A CN201510134196A CN104846072B CN 104846072 B CN104846072 B CN 104846072B CN 201510134196 A CN201510134196 A CN 201510134196A CN 104846072 B CN104846072 B CN 104846072B
- Authority
- CN
- China
- Prior art keywords
- prostate cancer
- gene
- biological markers
- fusion
- long
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The biological markers of one group of prostate cancer are provided, wherein biological markers include fusion, long-chain non-coding RNA, gene mutation and alternative splicing body.Purposes of these biological markers in the target spot of the reagent as diagnosis of prostate cancer or the drug for treating prostate cancer is also provided.
Description
Related application
The application be the applying date be September in 2011 16, entitled " biological markers, the therapy target of prostate cancer
And application thereof " Chinese patent application 201180073445.7 divisional application.
Technical field
The present invention relates to cancer fields, especially prostate cancer.Meanwhile the present invention relates to using next-generation sequencing technologies,
With find for diagnosing, prognosis and therapeutic response prediction biological markers and effectively treatment prostate cancer drug target,
Especially it is used for the biological markers of prostate cancer.In the present invention, RNA-Seq technology is especially used, i.e. transcript profile is sequenced
Technology analyzes the transcript profile of prostate cancer tissue and Carcinoma side normal tissue, discloses the complete transcripting spectrum of Chinese human prostata cancer.
Background technique
In developed country, prostate cancer is still the highest tumour of disease incidence, while is arranged in male cancer associated death
Two.The disease incidence of whole world prostate cancer is constantly rising, but in country variant and race, disease incidence is widely different.
Highest disease incidence is western countries, such as U.S.；Disease incidence it is minimum be East Asian countries, such as China, this species diversity may parts
It is as caused by not agnate gene difference.In addition, prostate cancer is a kind of different substantiality disease.Each tumour is in tumour
It is poor in evolution and biological behaviour (such as Tumor dormancy, local growth are spread, reaction and recurrence to treatment etc. at a distance)
It is different very big.Therefore, histopathology Classification and stage and identical, the identical patient of therapeutic scheme of Gleason scoring, it is clinical
Final result and tumour progression history may be completely different.Some patients its tumour in a dormant state, be confined to prostate, can be with
More than Ten Year Survival, and 2-3 dies of the DISTANT METASTASES IN of tumour to other patients after diagnosis.Various evidences show prostate
The heterogeneity of cancer clinical behavior be during tumour progression as in it molecular mechanism difference caused by.
Between past more than ten year, DNA and RNA chip technology is widely used on analysis biological mechanism.It helps me
Have new understanding to the pathogenesis of prostate cancer, find for us for diagnosing, the life of prognosis and therapeutic response prediction
Object marker provides the foundation.Although so far, before being used for of the OncotypeDx and MammoPrint of similar breast cancer
Column gland cancer genome prognosis detection is few, but some prostate cancer molecules changes being found are being applied to clinic in fact
It tramples.(Taylor BS, et al. (2010) the Integrative genomic profiling of human such as Taylor
Prostate cancer. Cancer Cell 18 (1): 11-22.) it is found by the comprehensive gene group analysis to prostate cancer,
The variation of certain gene copy numbers may distinguish evolving tumor and dormant trait tumour, and the discovery is significant.However, we
Still there is an urgent need to new biological markers more accurately to detect prostate cancer and improve to tumour progression and treatment final result
Predictive ability.
Although being pointed out that understanding of the research to us to human tumor occurrence and development based on genetic chip
It makes
Summary of the invention
In the past few years, the rapid development of next-generation sequencing technologies (Next Generation Sequencing, NGS)
Overcome above-mentioned deficiency.NGS enables us with unprecedented high-resolution and the entire Oncogenome of high throughput analysis and turns
Record group.The data of NGS can be such as mutated from multiple angle analysis genomes, and transcription adjusts (such as methyl after structure variation and transcription
Change).In addition, continuously improving for NGS technology enables scientist that the genome of main tumor type is sequenced.
Currently, nearly all research changed for prostate cancer genome and transcript profile level be all in white man into
Row, the research of yellow are few.In our current research, we use RNA-Seq technology, i.e. transcript profile sequencing technologies analyze 14 pairs
The transcript profile of prostate cancer tissue and Carcinoma side normal tissue.We analyze all transcription product types, disclose China
The complete transcripting spectrum of human prostata cancer.We have found many isomers include: exon skipping, introne retain, 5 ' and
3 ' end alternative splicings, Gene Fusion, point mutation, long-chain non-coding RNA, these all may generation in prostate cancer and hair
It works in exhibition.Our research illustrate prostate cancer genome variation complicated map, it was confirmed that prostate cancer it is heterogeneous
Property, advance the understanding of our centering Chinese Prostate Cancers.
1. the discovery and verifying of prostate cancer New Fusion gene
(1) to Shanghai Changhai Hospital 14, to RNA-Seq is carried out in prostate cancer and cancer beside organism, (i.e. skill is sequenced in transcript profile to
Art), totally 4 documents do not report height by discovery USP9Y-TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR
Frequency fusion and other dozens of fusions, referring to such as the following table 1.
1. prostate cancer New Fusion gene of table
(2) we these fusions are verified in 54 pairs of prostate cancers and cancer beside organism.We devise
The PCR primer of Gene Fusion specificity.After PCR and agar electrophoresis, all RT-PCR amplified fragments are tapped and recovered (Qiagen
QIAquick Gel Extraction kit) Sanger sequencing parallel.We have found that 4 New Fusion genes of verifying are in cancer
Specifically expressing, frequency are higher (result is shown in Fig. 2-4) in tissue.It is not reported before these fusions, but it is originally grinding
Studying carefully the higher prompt of frequency, it plays an important role in the generation of Chinese human prostata cancer, these are expected in subsequent research
It is set forth.
(3) potential applicability in clinical practice: expressing in cancerous tissue, and the fusion that do not express by cancer and in normal tissue is
The prostate cancer marker of high degree of specificity is detected in blood, urine by real time PCR, prostate biopsy tissue
With postoperative tissue by FISH detection fusion gene there are situation, for the early diagnosis of prostate cancer patient, molecule parting and
Judge patient's prognosis, while fusion can be used as the target spot of targeted therapy.
2. the long-chain non-coding RNA of finding differences property expression
The transcripting spectrum of long-chain non-coding RNA in prostate cancer.More and more evidences show that long-chain non-coding RNA exists
It works in many aspects of cell biology, it is prompted to work in the teiology of disease, including in elaboration of tumour mechanism.It arrives
So far, the whole transcriptional level that research before does not all set foot in long-chain non-coding RNA in tumour changes.Therefore, we are first
The whole transcription spectrum of long-chain non-coding RNA is first analyzed in prostate cancer tissue and its pairing Carcinoma side normal tissue, discovery is every
Averagely there are 1599 known long-chain non-coding RNA expression in a sample.Next, we are in prostate cancer tissue and pairing cancer
Other normal tissue compares the expression of long-chain non-coding RNA, and discovery averagely has 406 long-chain non-coding RNAs between the two
It is variant expression (multiple change >=2, false positive rate, False positive Rate, FDR≤0.001), wherein 137
Consistent up-regulation or downward is all presented in a long-chain non-coding RNA in 50% prostate cancer.
Because most of long-chain non-coding RNAs are found related with transcriptional regulatory, we have studied long-chain non-coding RNAs
Influence of the variation of expression quantity to prostate cancer gene expression.We analyze each long-chain non-coding RNA and all gene tables
Up to the correlation of amount.Being greater than 0.85, False discovery rate using absolute correlation coefficient is dividing value less than 0.01, it has been found that with long-chain
The highly relevant gene of non-coding RNA.It is absorbing to be, there are hundreds of bases in 23 long-chain non-coding RNAs and full-length genome
Because of significant correlation, and other most of genes are only with several gene-correlations, or not related.This prompt non-volume of long-chain
Code RNA may have the function other than transcriptional regulatory, such as the adjusting in post-transcriptional level.It was unexpectedly determined that in addition to two long
Outside chain non-coding RNA, almost all of long-chain non-coding RNA is positively correlated with gene expression, prompts these long-chain non-codings
RNA may promote the expression of gene.
In order to study the relationship of long-chain non-coding RNA and prostate cancer, we have selected 4 long-chain non-coding RNAs (two
It is a known: DD3 and MALAT1；Two new discoveries: FR257520 and FR348383), and with qRT-PCR in two groups of prostate marks
Their expression quantity is detected in this.First group is 40 pairs of prostate cancer tissues and its pairing Carcinoma side normal tissue, and second group is 15
A normal human prostate tissue and 15 prostate cancer tissues.QRT-PCR and RNA-seq result has very strong correlation.With
RNA-Seq result is consistent, and PCA3, MALAT1 and FR348383 are overexpressed in most of prostate cancer samples, and FR257520
Expression quantity reduces.The result that PCA3 is overexpressed with think that it is similar that it is likely to become the research of new diagnosis marker before, but I
For the first time discovery MALAT1, FR257520 and FR348383 express in prostate cancer and normal prostatic have notable difference.
Potential applicability in clinical practice: detecting long-chain non-coding RNA there are situation by real time PCR in blood, urine,
Early diagnosis, molecule parting for prostate cancer patient judge patient's prognosis at the same time as the target spot of targeted therapy.I
Result of study show that 137 long-chain non-coding RNAs can be used as biomarker, referring specifically to table 2.
2.137 long-chain non-coding RNAs of table
3, the detection of single nucleotide polymorphism and point mutation
We use SOAPsnp (Li RQ, Li YR, Fang XD, Yang HM, Wang J, et al. (2009) SNP
detection for massively parallel whole-genome resequencing.Genome Research
19:1124-1132.) detection single nucleotide polymorphism.The mutation of Sanger sequence verification.We reduce monokaryon by following steps
The false positive rate of nucleotide polymorphism detection, including delete the SNP of consistent property amount lower than 20, be located at donor splicing site 5bp with
Interior SNP and reading supports to be no more than 2 SNP.In order to find new SNP, we are further big reported six
Snp database is screened (YH, 1000genomes, Yoruba, Korean, Watson and NCBI dbSNP).
The prostate cancer spectrum of mutation.We averagely find 1725 point mutation in prostate cancer tissue.However, only one
Fraction (average 1.5%) is located at the code area of gene.It is interesting that some point mutation are located at long-chain non-coding RNA.It is big absolutely
Majority mutation (91.7%) is the mutation of T:A to C:G.Reasonably explain it is that this point mutation occurs to one of the discovery
When rna editing, for rna editing by the way that adenosine is changed into inosine, it is fast that the latter is read as bird when translating
Purine nucleosides, so as to cause the change of specific RNA nucleotide.
Find 309 point mutation altogether in the code area of 290 genes.Wherein 115 are silent mutation, 181 missense
Mutation, 13 be nonsense mutation.These mutation are not all found in more than one tumor tissues, are prompted in these prostate cancers
There is no hot spot mutation in sample.However, it has been found that there are 3 samples to have the mutation positioned at UTP14C gene different location, there is two
A sample has the mutation positioned at 4 gene (CBARA1, FRG1, NAMPT and ZNF195) different locations.We use genome
PCR, RT-PCR and Sanger sequencing confirm 30 mutation.Wherein 27 confirm in genomic level, and 29 in cDNA level
It confirms.
We also find 183 genes for having mutation, but most of is all low frequency mutation.(the Taylor such as this and Taylor
BS, et al.(2010)Integrative genomic profiling of human prostate cancer.Cancer
Cell 18 (1): 11-22.) 138 genetic results reported are consistent.Mutation verifying discovery RNA-Seq hair is carried out in 30 genes
The accuracy being now mutated is respectively 96.7% (cDNA is horizontal) and 90% (genomic level).1 sample has KLK3 gene prominent
Become.It is especially surprising that all samples are all mutated without P53 and PTEN, and the two genes be in COSMIC database with before
The highest gene of the column gland cancer degree of correlation.Although not being reported in prostate cancer before the gene of most numerical mutation, wherein
118 were found in other tumours, prompted the mutation of these genes that may also lead to prostate cancer.
Potential applicability in clinical practice: sequencing is sent to examine after row PCR from being extracted in tissue after DNA after prostate biopsy tissue or operation
Surveying SNP and point mutation, there are situations, are used for prostate cancer patient's molecule parting and drug therapy target, judge patient's prognosis.This
194 mutation of 183 genes provided are invented referring to table 3, wherein preferred 30 gene mutations are as shown in table 8
3. prostatic cancer specific gene mutation of table
4. the detection of alternative splicing
Alternative splicing (alternative splicing, AS) is the universal phenomenon in eukaryocyte, it can make gene
Different mRNA products is transcribed out, and then different isomer proteins may be translated.
(1) we shearing site is found using SpliceMap, then detect different types of choosing with distinct methods
The shearing of selecting property includes exon skipping, introne retains and 5 ' and 3 ' shearing sites of selectivity.We find 28 first
All alternative splicings in sample transcript profile.Then we, which find, exists only in cancerous tissue sample and it matches cancer beside organism
No alternative splicing.We have found thousands of alternative splicings, read sequence by nonredundancy and sift out one group highly reliably
Otherness shearing.Discovery has the introne of KLK3 (being also PSA) gene to retain in the prostate cancer sample for being more than half, this
There may be a kind of new protein sequences.The transcription product and albumen of alternative splicing all may be as prostate cancer diagnosis
Neontology marker.Discovery has the exon skipping of AMACR gene in a part of prostate cancer sample.Both selections
Property cut mode is all verified with RT-PCR in sequencing group.We are carried out in other 40 pairs of samples with RT-PCR simultaneously
Verifying finds there is the reservation of PSA introne in most cancerous tissue samples, and in cancer beside organism almost without.PSA be for
The few several biological markers conventionally used for diagnosis of number.However, the screening means accuracy based on PSA at present
It is limited.We retain the sensibility and specificity for potentially contributing to improve PSA by newfound PSA introne.40 cancerous tissue samples
In this only 9 have the jump of AMACR gene extron.
(2) it potential applicability in clinical practice: is cut in blood, urine by detecting and selecting property of real time PCR or ELISA
Cut there are situations, early diagnosis, molecule parting for prostate cancer patient, at the same time as the target spot of targeted therapy,
Judge patient's prognosis.
4. alternative splicing body of table, including the variation of 3' shearing site, the variation of 5' shearing site, exon skipping and introne
Retain four kinds of modes.
The variation of 3' shearing site
The variation of 5' shearing site
Exon skipping
Introne retains
In order to understand, above-mentioned molecular genetics changes in prostate cancer, we with Gene Fusion, point mutation, otherness
Expression, tumour-specific otherness shears relevant tumour and the signal path of the Taylor dysregulation described compares.According to
According to documents and materials, the gene and known oncogene that are overexpressed in tumour are defined as activated gene by we, table in tumour
Inactivated gene is defined as up to the gene of downward and known tumor suppressor gene.We calculate each activated gene, inactivated gene
Frequency in 14 samples.If tumor specimen has one or more genes to have point mutation, gene to melt in signal path
The alternative splicing of conjunction, differential expression or tomour specific, we are considered as tumour and are changed in the signal path.I
Find that 3 very common signal paths (AR, Ras-PI3K-AKT and RB) are changed in prostate cancer.
As other many tumours, prostate cancer is a kind of genetic disease, is the accumulation changed by series of genes
It is caused.Therefore, more detailed gene expression characteristics analysis will be helpful to more fully understand these diseases and promote to research and develop new individual
The targeted therapy of change.In addition, not agnate prostate-cancer incidence and clinical prognosis difference especially between white man and yellow
It is very big.Although correlative study in yellow is few however, the prostate cancer gene profile of white man is studied very deep.Originally it grinds
In studying carefully, we carry out RNA-Seq by 14 pairs of cancerous tissues and pairing Carcinoma side normal tissue and have studied above-mentioned two problems.This is same
When be also for the first time while to disclose many aspects of prostate cancer transcript profile, including Gene Fusion, alternative splicing, virus transcription
The expression and somatic mutation of segment and long-chain non-coding RNA.Pass through the research to above-mentioned aspect, it has been found that not the same
Column gland cancer patient's transcript profile has very big heterogeneity.Before the comprehensive analysis discovery of the gene alteration different to these is with Chinese
It is similar with white man that relevant signal path occurs for column gland cancer.These pathogenesis for being found to be Study of China human prostata cancer mention
New possibility has been supplied, while having provided the possibility mode for the treatment of prostate cancer.
Detailed description of the invention
Fig. 1 system tumor transcriptome analysis flow chart.
Fig. 2 fusion schematic diagram.Wherein Fig. 2 a is CTAGE5-khdrbs3 fusion schematic diagram, the of ctage5
23 exons are fused together with the 8th exon of khdrbs3；Fig. 2 b is Tmprss2-erg fusion schematic diagram,
The 4th exon of the 1st exon of Tmprss2 and ERG is fused together；Fig. 2 c is the occurrence frequency of 5 fusions.
Fig. 3 fusion schematic diagram.Wherein Fig. 3 a is USP9Y-TTTY15 fusion schematic diagram, is shown outside the 3rd of USP9Y
The 4th exon of son and TTTY15 are fused together；Fig. 3 b is the RT-PCR result of USP9Y-TTTY15.
Fig. 4 fusion schematic diagram.Wherein Fig. 4 a RAD50-PDLIM4 fusion RT-PCR and sanger sequencing knot
Fruit；Fig. 4 b is SDK1-AMACR fusion RT-PCR and sanger sequencing result.
The differential expression of Fig. 5 long-chain non-coding.Wherein Fig. 5 a is long-chain non-coding RNA DD3 MALAT1 FR0257520
Differential expression of the FR0348383 in 40 pairs of cancers and cancer beside organism；Fig. 5 b is long-chain non-coding RNA: DD3, MALAT1,
Differential expression of the FR0257520 and FR0348383 in prostate cancer and Benign Prostatic Hyperplasia Tissuess.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.
Unless otherwise defined, there are scientific and technical terms used herein those skilled in the art usually to manage
The meaning of solution.In order to better understand the present invention, the definition of following term is specifically provided.
It was found that fusion, long-chain non-coding RNA, mutation, alternative splicing common step: collect prostate cancer patient
Sample → checked after cancerous tissue and cancer beside organism's row frozen section by virologist and guarantee quality → prepares cDNA library → RNA-
Seq → by sequencing result in genome and transcript profile positioning → is looked for after standardizing gene and long-chain non-coding RNA expression
To the long-chain non-coding RNA of differential expression, the mutation of alternative splicing and tumour-specific, fusion.
One aspect of the present invention provides the biological markers for prostate cancer, including fusion as shown in Table 1,
One of gene mutation shown in long-chain non-coding RNA, table 3 shown in table 2, alternative splicing shown in table 4 are a variety of.
Biological markers of the present invention further can be used as early diagnosis marker, the drug of prostate cancer
Treat Effective judgement marker or patient's prognostic marker.
In a specific embodiment of the invention, in the biological markers, the fusion includes the 83 of table 6
One of a fusion is a variety of, preferably includes one of 35 fusions shown in underscore or more in table 6
Kind.
In a specific embodiment of the invention, in the biological markers, the fusion includes USP9Y-
One of TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR or a variety of, preferably fusion
USP9Y-TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR primer described in table 5 are expanded.
In a specific embodiment of the invention, in the biological markers, the long-chain non-coding RNA includes
One of DD3, MALAT1, FR0257520, FR0348383 or a variety of, the preferably described long-chain non-coding RNA: DD3,
MALAT1, FR0257520, FR0348383 primer described in table 7 are expanded.
In a specific embodiment of the invention, in the biological markers, the gene mutation includes such as 8 institute of table
One of 30 gene mutations shown are a variety of, preferably 30 gene mutation primers described in table 9 shown in earth's surface 8 into
Row amplification.
In a specific embodiment of the invention, in the biological markers, the alternative splicing include PSA or
AMACR, being preferably chosen property shearing PSA or AMACR primer described in table 10 are expanded.
Another party of the present invention provide the biological markers as diagnosis of prostate cancer reagent or treatment
Purposes in the target spot of the drug of prostate cancer, the early diagnosis marker, drug therapy especially as prostate cancer are effective
The purposes of property judgement symbol object or patient's prognostic marker.
Another aspect of the present invention further provides the primer or the biology for expanding the biological markers
Learn purposes of the probe of marker in the reagent that preparation is used for as diagnosis of prostate cancer.Wherein, the primer can be used for specifically
Property the amplification biological markers, the probe specificity is in conjunction with the biological markers, to indicate the biology
Learn the presence of marker.
In a specific embodiment of the invention, the primer for expanding the biological markers is provided, wherein institute
State primer and preferably include primer described in table 5, be used for fusion USP9Y-TTTY15, CTAGE5-KHDRBS3,
RAD50-PDLIM4,SDK1-AMACR；Primer shown in table 7, is used to expand long-chain non-coding RNA: DD3, MALAT1,
FR0257520,FR0348383；Primer shown in table 9 is used to expand 30 gene mutations shown in table 8；Shown in table 10
Primer is used to expand alternative splicing PSA or AMACR.
In a specific embodiment of the invention, primer described in table 5 is provided in the reagent of preparation diagnosis of prostate cancer
In purposes.
In a specific embodiment of the invention, primer shown in table 7 is provided in the reagent of preparation diagnosis of prostate cancer
In purposes.
In a specific embodiment of the invention, primer shown in table 9 is provided in the reagent of preparation diagnosis of prostate cancer
In purposes.
In a specific embodiment of the invention, primer shown in table 10 is provided in the reagent of preparation diagnosis of prostate cancer
In purposes.
Embodiment
1. differential genes expression analysis of embodiment
1. collecting prostate cancer patient's sample
Patient and sample.
14 pairs of prostate cancer tissues and Carcinoma side normal tissue for RNA-Seq are derived from Shanghai Changhai Hospital.54 pairs are used for
The sample of Gene Fusion verifying: 23 pairs from Shanghai Changhai Hospital, 17 pairs from Jiangsu provincial hospital, 14 pairs to come mountain in this big
Learn third affiliated hospital.One group 40 to for alternative splicing, the prostate cancer of long-chain non-coding RNA verifying and cancer beside organism
It is derived from Shanghai Changhai Hospital.Another group of 15 tumor samples and 15 (benign forefront BPH for the verifying of long-chain non-coding RNA
Gland hyperplasia) sample is taken respectively from Jiangsu provincial hospital and Shanghai Changhai Hospital.The regulation of RNA-Seq and its follow-up test obtain
To the approval of 3 Hospital Ethical Committees.All patients fill in Written informed consent, us is authorized to use them
Sample.
2. being checked after cancerous tissue and cancer beside organism's row frozen section by virologist and guaranteeing quality
Pathologic finding
By the disease of this research after cancerous tissue and Carcinoma side normal tissue frozen section progress HE dyeing (hematoxylin eosin staining)
Neo-confucian is checked to ensure that selected tissue cancerous tissue density is more than 80%, while not having cancerous tissue in Carcinoma side normal tissue.It is all
Pathology sample is checked by another virologist.If there is the inconsistent situation of conclusion, two virologists inquire into jointly with
Determine conclusion.
3. preparing cDNA library and RNA-Seq
Oligomerization deoxythymidine magnetic bead is used to separate poly A mRNA from total serum IgE.MRNA will be purified with fragmentation buffer
Fragmentation.Using these short-movie sections as template, first segment cDNA chain is synthesized with random hexamers.Second segment cDNA chain
It is synthesized with buffer, dNTPs, RNase H and DNA polymerase I.Short double stranded cDNA fragment QIAQuick PCR
Extraction kit (vendor) purifying is simultaneously eluted with EB buffer to repair end and plus " A ".Then, short-movie section is connected
It is connected on Illumina sequencing adaptors.The DNA of target fragment size is used for PCR amplification by rubber tapping purifying.With
Illumina HiSeqTM2000 pairs of amplification libraries are sequenced.
MRNA-Seq 8-Sample Prep Kit that cDNA library building is provided using Illumina company (article No. are as follows:
RS-100-0801 it) carries out, concrete operations process are as follows: oligomerization deoxythymidine magnetic bead is used to separate poly A from total serum IgE
mRNA.MRNA fragmentation will be purified with fragmentation buffer.Using these short-movie sections as template, with random hexamers come
Synthesize first segment cDNA chain.Second segment cDNA chain buffer, dNTPs, RNase H and DNA polymerase I synthesis.Short double-strand
CDNA segment is purified with QIAQuick PCR extraction kit (Qiagen) and is eluted with EB buffer to repair end
And add " A ".Then, short-movie section is connected on Illumina sequencing adaptors.Target fragment size
DNA is used for PCR amplification by rubber tapping purifying.By using Agilent 2100Bioanalyzer biological analyser and Stepone
Plus fluorescence quantitative PCR instrument to cDNA library carry out quality testing after (criterion of acceptability are as follows: pcr amplification product size be 322 ±
20bp, wherein insertion short-movie section size is 200 ± 20bp, library molar concentration is not less than 1.3nM), using using Illumina
HiSeqTM2000 pairs of amplification libraries are sequenced.
4. data are analyzed
Original reading screening
The image that sequenator is generated controls software by matched sequenator and carries out base calling processing.Original sequence
Column are stored as fastq format.Dirty reading is deleted before analysis data.We delete dirty reading with three standards:
1) dirty reading is deleted；
2) reading that " N " base is more than 2% is deleted；
3) deleting has the low quality of the base of 50% or more QA≤15 to read.
All following analysis are all based on the reading after arranging.
Reading is positioned on human genome and transcript profile.
The reference sequences of genome and transcript profile that we use are to download (hg18version) from the website UCSC.We
Use SOAP2 (Short Oligonucleotide Analysis Package (SOAP) aligner (SOAP2)；Li R,Yu
C,Li Y, Lam TW,Yiu SM,et al.(2009)SOAP2:an improved ultrafast tool for short
Read alignment. Bioinformatics 25:1966-1967) method by the reading after arrangement respectively with genome and
Transcript profile compares.The mismatch number of each reading is no more than 3.
The standardization of gene and long-chain non-coding RNA expression.
The reading that specific gene can be positioned to is horizontal for calculation expression.Gene expression dose is every million read
From the read number of the every kilobase length of Mr. Yu's gene.Formula is as follows:
C is the copy number of selected gene reading；N is the copy number of all reading genes；L is the total of selected gene extron
Length.For having more than the gene of an alternative transcription product, longest transcription product is for calculating RPKM.RPKM method energy
Enough eliminate the influence that different genes length and sequence difference calculate gene expression.Therefore, RPKM is used directly for comparing
The differential expression of gene between sample.
We calculate non-coding RNA expression with same procedure.
5. difference expression gene is analyzed
With reference to " conspicuousness of digital gene express spectra " (such as Audic S&Claverie JM (1997) The
Significance of digital gene expression profiles.Genome Res 7 (10): 986-995), I
Use False discovery rate≤0.001 and the multiple to change >=2 have found as standard in 14 pairs of prostate cancer tissues and match by cancer
The gene of differential expression in normal tissue.Each sample generates the sequencing of average 66,432,064 readings and 5.98Gb size
Nucleotide.By SOAP2 technology, 84.4% reading is navigated to human genome (UCSC hg18version) by we.
By comparison cancerous tissue and the transcript profile sequence of Carcinoma side normal tissue is matched, we have found in column gland cancer sample in each of front
Some Gene Fusions, the long-chain non-coding RNA of differential expression, alternative splicing and differential expression gene.In addition, I
Find that averagely each cancerous tissue sample has 1725 point mutation.These results disclose in prostate cancer that there is very big different
Matter, synchronous signal access and molecular mechanism work in the generation of prostate cancer.
The discovery and verifying of 2. prostate cancer New Fusion gene of embodiment
It is found when we read short rna with reference to genome comparison, some sequences will be divided into two sections of ability and gene
Group matches.This kind of reading need to meet the following conditions:
A) it is not shorter than 8bp compared with short fragment size；
B) pay attention to regardless of introne where (from 5 ' to 3 ', normal chain or minus strand)
Contraposition analysis to two sections, we allow to be no more than one mismatch and align without vacancy.
RT-PCR and sequence verification Gene Fusion.We test the Gene Fusion that RNA-Seq is obtained in transcriptional level
Card.We devise the PCR primer of Gene Fusion specificity.After PCR and agar electrophoresis, all RT-PCR amplified fragments rubber tapping
Recycle (Qiagen QIAquick Gel Extraction kit) parallel Sanger sequencing.We demonstrate 5 in this way
A fusion is TMPRSS2-ERG, USP9Y-TTTY15, SDK1-AMACR, CTAGE5-KHDRBS3, RAD50- respectively
PDLIM4, wherein other 4 fusions in addition to TMPRSS2-ERG are that the present inventor is newfound.
4 newfound fusions are:
>39a fwd chrY 155 39b fwd chrY
USP9Y-TTTY15
GATAACTACATAAAGAGACAAAAAAAAGAAAAAAGAGCAAAGATCTGTGCTGTG
TCAAGTATGACAGCCATCACTCATGGCTCTCCAGTAGGAGGGAACGACAGCCAGGGC
CAGGTTCTTGATGGCCAGTCTCAGCATCTCTTCCAACAGAACCAGgaatcaaacttgacgtatgga
gccaagaaagcccttggaaaaactggcctcatattttgtgtacacagtccctgtacagggtttctgacctgtg
>31a fwd chr7 121 31b rev chr5
SDK1-AMACR
ACCTTCCTGGTGCCCCATCCAACCTGGTCATTTCCAACATCAGCCCTCGCTCCGC
CACCCTTCAGTTCCGGCCAGGCTATGACGGGAAAACGTCCATCTCCAGGTGGATTGTT
GAGGGGCAGgtgtcatggagaaactccagctgggcccagagattctgcagcgggaaaatccaaggcttatttatgcc
aggctgagt ggatttggccagtcaggaagcttctgccggttagctggccacgatatcaactatttggctttgtcag
> 2a site:235 ID:4253 fwd_chr14≤> fwd_chr8 ID:10656
CTAGE5-KHDRBS3
AATTTAAATGTGCCTGATTCATCTCTCCCTGCTGAAAATGAAGCCACTGGCCCTGG
CTTTGTTCCTCCACCTCTTGCTCCAATCAGAGGTCCATTGTTTCCAGTGGATGCAAGA
GGCCCATTCTTGAGAAGAGGACCTCCTTTCCCCCCACCTCCTCCAGGAGCCATGTTTG
GAGCTTCTCGAGATTATTTTCCACCAGGGGATTTCCCAGGTCCACCACCTGCTCCATTT
GCAAtggtgctgattactatgattacggacatggactcagtgaggagacttatgattcctacg
>44a fwd chr5 113 44b fwd chr5 10111(RAD50)8572(PDLIM4)
CAAAAAGAAACTGAACTTAATAAAGTAATAGCTCAACTAAGTGAATGCGAGAAA
CACAAAGAAAAGATAAATGAAGATATGAGACTCATGAGACAAGATATTGATACACAGA
AGgtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagc
acagagctcatg acacacctggaggcacagaaccgcatcaagggctgccacgatcacctcacactgtctgtgagca
g
Wherein capitalization indicates the sequence of first gene, and lowercase indicates the sequence of second gene.
For amplimer such as the following table 5 of this 5 fusions.
The amplimer of 5.5 fusions of table
PCR condition is: 95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；38-43 circulation.
Use PCR purification kit PCR Cleanup Kit 50-prep (AXYGEN, Cat No.AP-PCR-50, Lot
No.KB10101204-G PCR product purifying) is carried out, 2% agarose gel electrophoresis is carried out to PCR product, is recycled and is tried using glue
Agent box DNA Gel Extraction Kit 50-prep (AXYGEN, Cat No.AP-GX-50, Lot No.KE10101204-
G glue recycling) is carried out.
There is the electrophoresis picture of fusion, respectively attend and see Fig. 2 b (TMPRSS2-ERG and CTAGE5-KHDRBS3), schemes
3a and b (USP9Y-TTTY15) and Fig. 4 a (RAD50-PDLIM4), Fig. 4 b (SDK1-AMACR).
Screen the Gene Fusion of high frequency.After demonstrating Gene Fusion with RT-PCR, we test in other 54 pairs of samples
Each (above 4) fusion is demonstrate,proved.The RNA of all samples is extracted first and reverse transcription is cDNA.RT-PCR primer with
Above-mentioned verifying primer is identical.The cDNA of sample is sequenced as positive control.
Prostate cancer Gene Fusion map.It is existing that transcript profile sequencing be used to detect the Gene Fusion in prostate cancer earliest
As.It is read using pairing end, we have found altogether 84 Gene Fusions.In addition to well-known TMPRSS2-ERG gene
Fusion is outer, we have found 83 new Gene Fusions, these are not all reported in the research for being directed to white man before.35
It is a new and before 1 known to Gene Fusion be detected in prostate cancer tissue and be not found in pairing Carcinoma side normal tissue (see
The fusion of underscore part), in addition there is fusion to express (see black matrix thickened portion) in Carcinoma side normal tissue, specifically
Biological significance is temporarily unknown, has by cancer and cancer there are also following 4 fusions.
The Gene Fusion only expressed in cancer is defined as tumor-specific genes fusion.The gene of each cancerous tissue sample melts
Conjunction number, which is respectively 1 to 6, to be differed.83 new genes fusion is as shown in table 6, below 35 new Gene Fusions therein
It lines out
6.83 new gene fusions of table
The most common Gene Fusion is TMPRSS2-ERG and USP9Y-TTTY15.The two sees 14 sequencing prostates
3 samples in cancerous tissue sample.We detect that another most common fusion is to be located at Y to dye by RNA-Seq
USP9Y-TTTY15 on body.USP9Y encodes the albumen for being similar to ubiquitin-specific protease, and TTTY15 is one
Non-coding RNA.USP9Y gene delection or mutation are related with male sterility.However, research before all do not disclose it is above two
Gene is related with tumour generation.In RNA-Seq result, 3 exons of USP9Y gene and 3 exons of TTTY15 gene
It is identical as TMPRSS2-ERG to merge the USP9Y-TTTY15 frequency (3/14=21.4%) formed.But RT-PCR discovery 54
19 have USP9Y-TTTY15 in a prostate cancer tissue.It is not reported before the fusion, but its frequency in our current research
It plays an important role the higher prompt of rate in the generation of Chinese human prostata cancer, these are expected to be explained in subsequent research
It is bright.It is interesting that finding turning for the fusion with open reading frame (ORF) forecasting tool Six-Frame Translation
Record product does not appear to open reading frame, and prompting it may be non-coding RNA.It has been found that the fusion may cause USP9Y
The missing of function and the fusion transcription product of a new non-coding.The fusion is in sequencing sample and verifying sample
In the higher frequency of occurrences prompt it to play an important role in prostate cancer.
In 54 pairs of prostate cancer samples, we also demonstrate other 3 (CTAGE5-KHDRBS3, SDK1-AMACR
And RAD50-PDLIM4) Gene Fusion, their frequency is 37%, 20%, 33.3% respectively.
The discovery and verifying of 3. prostate cancer long-chain non-coding RNA of embodiment
(1) downloads ncRNA database from http://www.ncrna.org/frnadb/download, then deletes piece
Section ncRNA, zRNA less than 200nt and non-human RNA simultaneously obtains 2981 long-chain non-coding RNAs.Next we, which use, is somebody's turn to do
The expression of database calculating long-chain non-coding RNA.Match the long-chain non-coding RNA differential expression of sample by cancer and cancer
Standard are as follows: False discovery rate≤0.001, multiple change >=2.What selection was unanimously raised or was lowered in more than 50% sample
Long-chain non-coding RNA exercises supervision clustering (using cluster 3.0 to gene and the progress of long-chain non-coding RNA express spectra
Hierarchical cluster analysis).The further correlation analysis of row long-chain non-coding RNA and gene.We select more than 50% prostate
The long-chain non-coding RNA that unanimously raises or lower in cancer sample is simultaneously analyzed them and all is found in prostate cancer tissue
The correlation of gene.The expression (RPKM) of long-chain non-coding RNA and gene, which is used as, calculates coefficient R.
(2) (our .qRT-PCR verifying long-chain non-coding RNA existed using Power SYBR Green Mastermix reagent
Applied Biosystems Step One Plus is qRT-PCR.GAPDH primer is used as internal reference.One group 40 as described above right
Prostate cancer and cancer beside organism are derived from Shanghai Changhai Hospital, and another group takes respectively for 15 tumor samples and 15 BPH samples
From Jiangsu provincial hospital and Shanghai Changhai Hospital, verified for long-chain non-coding RNA.Use two-step method PCR amplification standard journey
Sequence: Stage1: initial denaturation (Reps:1；95 DEG C 30 seconds)；Stage2:PCR reacts (Reps:40；95 DEG C 5 seconds；60 DEG C 34 seconds)；
Dissociation Stage (dissociation stage).
Devise primer such as the following table 7 for 4 long-chain non-coding RNAs:
The primer of 7.4 long-chain non-coding RNAs of table
All experiments all use two or three holes to carry out parallel repetition and test, as a result with being averaged relative to GAPDH
Multiple, which changes, draws (Fig. 5).We have found that there have 137 long-chain non-coding RNAs all to present in 50% prostate cancer to be consistent
Up-regulation or downward.The correlation discovery that we analyze each long-chain non-coding RNA and all gene expression amounts has 23 long
Chain non-coding RNA and genes hundreds of in full-length genome are significant related, and other most of genes only with several gene-correlations,
Or it is not related.
Interpretation of result part
We are in 40 pairs of prostate cancers and cancer beside organism, 15 normal human prostate tissues and 15 prostate cancer tissues
Middle verifying discovery, PCA3 (also known as DD3), MALAT1 and FR0348383 are overexpressed in most of prostate cancer samples, and
FR0257520 expression quantity reduces (Fig. 5).The result and think that it is likely to become new diagnosis marker before that PCA3 is overexpressed
Research it is similar, but we find for the first time MALAT1 be overexpressed frequency it is very high in prostate cancer.
The present invention provides 137 long-chain non-coding RNAs can be used for diagnosing, judges patient's prognosis and drug response, and
The target spot for the treatment of, referring to table 2.
The discovery and verifying of 4. single nucleotide polymorphism of embodiment and point mutation
(1) we using SOAPsnp detect single nucleotide polymorphism.The software is with repetition sequencing approach by that will survey
The consensus sequence that sequence sequence and known array compare the individual that will be newly sequenced is assembled into genome.By by consensus sequence and ginseng
It examines sequence to compare, single nucleotide polymorphism can be found.
(2) we made a variation with the candidate base-pair that filters out of RT-PCR joint Sanger sequence verification RNA-Seq.PCR item
Part is: 95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；38-43 circulation.Sample is from Shanghai Changhai Hospital 14 to prostate cancer
And cancer beside organism.We randomly choose 30 encoding histone mutation and verify.Wherein 27 exist only in cancerous tissue (cDNA
With have in DNA), and be not found in Carcinoma side normal tissue (cDNA and DNA in equal nothing).2 rarely seen and cancerous tissue cDNA that make a variation,
And it is not found in normal tissue cDNA.1 variation does not have in cancerous tissue and Carcinoma side normal tissue.
Have verified that 30 mutation of table 8., wherein the template that a most right column are is CDNA and DNA respectively, S representative at
Function, F represent failure.
9.30, table are mutated used primer
(3) all samples of are all mutated without P53 and PTEN, and the two genes be in COSMIC database with prostate
The highest gene of the cancer degree of correlation.Although not being reported in prostate cancer before the gene of most numerical mutation, wherein 118
It was found in other tumours, and prompted the mutation of these genes that may also lead to prostate cancer.
The present invention provides 183 mutation, these mutation can be used as diagnosis marker, Index for diagnosis, curative effect of medication judgement
And therapy target, referring specifically to table 3.
The discovery and verifying of 5. alternative splicing of embodiment
Our methods for the shearing of detecting and selecting property mainly include two steps:
1) reading is navigated to people's reference sequences using SOAPsplice 1.1 by us, then according to tie point reading (with
The corresponding reading of the two or more independent segments of reference sequences is separated by introne between the two segments) comparison knot
Fruit finds shearing site.We use the default parameters of SOAPsplice as far as possible, allow 3 mistakes for the reading completely compared
Match, each segment of reading compared for segmentation only allows 1 mispairing.
2) according to alternative splicing mechanism, we detect four kinds of basic selectivity using shearing site and comparing result
Shearing, including exon skipping, 5 ' shearing sites of selectivity, 3 ' shearing sites of selectivity and introne retain.
After finding out four kinds of alternative splicings, we, which select, is present in cancerous tissue selection in Carcinoma side normal tissue may be not present
Property shearing.To each cancerous tissue sample, we calculate separately 3 kinds of alternative splicings of support, and (exon skipping, selectivity 5 ' are cut
3 ' shearing sites of enzyme site and selectivity) corresponding connection site tie point number of readings per taken and introne reservation event in protect
The mean depth of the introne stayed.Because of every kind of alternative splicing enormous amount, we by take 0.99 percentile come
The alternative splicing of high confidence level is obtained, and passes through picture circos figure to disclose some common patterns.By taking 1T as an example, have
2047 3 ' shearing sites of selectivity.The tie point reading of 3 ' shearing sites of selectivity is supported to differ from 1 to 609,0.99 hundred
Quantile is 69.Therefore, we retain the 3 ' shearing site of selectivity of tie point reading >=69.In addition, we also delete
The alternative splicing also having in Carcinoma side normal tissue.Finally, we obtain one group of high confidence corresponding with each sample
The shearing of cancer specific selectivity.RT-PCR verifies alternative splicing.We extract total serum IgE from frost cancerous tissue and cancer beside organism,
Then taking 5 μ gRNA reverse transcriptions is cDNA (Qiagen QuantiTect Reverse Transcription kit).We
Alternative splicing is verified with RT-PCR in 40 pairs of cancerous tissues and Carcinoma side normal tissue.
PCR condition is: 95 DEG C 10 seconds；60 DEG C 30 seconds；72 DEG C 90 seconds；33-36 circulation.Wherein particularly two genes
Primer is as follows:
The amplimer of table 10.PSA and AMACR alternative splicing
Invention provides the alternative splicing of tumour-specific as shown in table 4, these alternative splicings can be used as blood
The diagnosis marker of liquid, urine and tissue also can be used as the marker of judging prognosis, therapeutic effect, is also used as tumour and controls
The target spot for the treatment of.
Discovery has the introne of KLK3 (being also PSA) gene to retain in the prostate cancer sample for being more than half, at one
Discovery has the exon skipping of AMACR gene in point prostate cancer sample.Both alternative splicing modes all use RT-PCR to exist
Sequencing group is verified.We are carried out in 40 pairs of samples (40 samples from Changhai hospital) with RT-PCR simultaneously
Verifying finds there is the reservation of PSA introne in most cancerous tissue samples, and in cancer beside organism almost without.40 cancerous tissues
In sample only 9 have AMACR gene extron jump.
Although a specific embodiment of the invention has obtained detailed description, it will be understood to those of skill in the art that.Root
According to all introductions having disclosed, those details can be carry out various modifications and be replaced, these change in guarantor of the invention
Within the scope of shield.Full scope of the invention is given by the appended claims and any equivalents thereof.
Claims (14)
1. being used for the biological markers of prostate cancer comprising alternative splicing PSA shown in table 4；
Wherein, the alternative splicing of PSA is introne reservation, and corresponding gene I/D is 354, is located on No. 19 chromosomes, with people
Genoid group UCSC hg18 is compared, and corresponding introne retains site are as follows: 56051468-56053096,56053664-
56054597,56051468-56053225,56053664-56055039 and/or 56050070-56051307.
It further comprise fusion as shown in Table 1, shown in table 2 2. biological markers according to claim 1
Long-chain non-coding RNA, one of alternative splicing shown in gene mutation, table 4 shown in table 3 or a variety of.
3. biological markers according to claim 1 further comprise in 83 fusions as shown in table 6
It is one or more.
4. biological markers according to claim 1 further comprise 35 fusions as shown in underscore in table 6
One of gene is a variety of.
5. biological markers described in any one of -4 according to claim 1 can be used as the early diagnosis mark of prostate cancer
Will object, drug therapy Effective judgement marker or patient's prognostic marker.
6. the biological markers according to any one of claim 2-4, wherein the fusion includes USP9Y-
One of TTTY15, CTAGE5-KHDRBS3, RAD50-PDLIM4, SDK1-AMACR or a variety of.
7. biological markers according to claim 6, wherein fusion USP9Y-TTTY15, CTAGE5-
KHDRBS3, RAD50-PDLIM4, SDK1-AMACR primer described in table 5 are expanded.
8. the biological markers according to any one of claim 2-4, wherein the long-chain non-coding RNA include DD3,
One of MALAT1, FR0257520, FR0348383 or a variety of.
9. biological markers according to claim 8, wherein the long-chain non-coding RNA: DD3, MALAT1,
FR0257520, FR0348383 primer described in table 7 are expanded.
10. the biological markers according to any one of claim 2-4, wherein the gene mutation includes such as 8 institute of table
One of 30 gene mutations shown are a variety of.
11. biological markers according to claim 10, shown in 30 gene mutation primers described in table 9
It is expanded.
12. biological markers described in any one of -4 according to claim 1, wherein the primer of the alternative splicing PSA
Nucleic acid sequence it is as follows:
Forward primer: CCAAGTTCATGCTGTGTGCT；
Reverse primer: TGCCTAGTAACCGTGTGCTG.
13. use of the biological markers of any of claims 1-12 in the reagent of preparation diagnosis of prostate cancer
On the way.
14. purposes according to claim 13, the purposes is used as the early diagnosis marker of prostate cancer, drug therapy
Effective judgement marker or patient's prognostic marker.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510134196.8A CN104846072B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201180073445.7A CN103797120B (en) | 2011-09-16 | 2011-09-16 | Prostate cancer biomarkers, therapeutic targets and uses thereof |
| CN201510134196.8A CN104846072B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201180073445.7A Division CN103797120B (en) | 2011-09-16 | 2011-09-16 | Prostate cancer biomarkers, therapeutic targets and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846072A CN104846072A (en) | 2015-08-19 |
| CN104846072B true CN104846072B (en) | 2018-12-07 |
Family
ID=53835753
Family Applications (6)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134198.7A Active CN104846073B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134173.7A Active CN104846070B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134196.8A Active CN104846072B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134199.1A Active CN104845992B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134100.8A Active CN104830972B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134175.6A Active CN104846071B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134198.7A Active CN104846073B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134173.7A Active CN104846070B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Family Applications After (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510134199.1A Active CN104845992B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134100.8A Active CN104830972B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
| CN201510134175.6A Active CN104846071B (en) | 2011-09-16 | 2011-09-16 | The biological markers of prostate cancer, therapy target and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (6) | CN104846073B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107362353A (en) * | 2016-05-11 | 2017-11-21 | 上海长海医院 | A kind of related drug target of prostate cancer of castration resistance and its application |
| CN109762905A (en) * | 2019-03-11 | 2019-05-17 | 天津脉络医学检验有限公司 | It is a kind of for assist detection prostate cancer ddPCR Primer composition and its application |
| CN111518908B (en) * | 2020-05-18 | 2023-10-17 | 奥尔文泰生物科技(杭州)有限公司 | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050259483A1 (en) * | 2002-09-30 | 2005-11-24 | Oncotherapy Science, Inc. | Genes and polypeptides relating to prostate cancers |
| US20100143247A1 (en) * | 2004-11-24 | 2010-06-10 | St. George's Enterprises Limited | Diagnosis of prostate cancer |
| ZA200803021B (en) * | 2005-09-12 | 2010-09-29 | Univ Michigan | Recurrent gene fusions in prostate cancer |
| CA2712772A1 (en) * | 2008-01-22 | 2009-07-30 | Veridex, Llc | Detection of gstp1 hypermethylation in prostate cancer |
| CN101999002A (en) * | 2008-02-04 | 2011-03-30 | 彼帕科学公司 | Methods of diagnosing and treating PARP-mediated diseases |
| EP2285979B2 (en) * | 2008-05-27 | 2020-02-19 | Dako Denmark A/S | Hybridization compositions and methods |
| CN101386889A (en) * | 2008-10-31 | 2009-03-18 | 芮屈生物技术（上海）有限公司 | Kit for AMACR gene hybridization in situ, detection method and use thereof |
-
2011
- 2011-09-16 CN CN201510134198.7A patent/CN104846073B/en active Active
- 2011-09-16 CN CN201510134173.7A patent/CN104846070B/en active Active
- 2011-09-16 CN CN201510134196.8A patent/CN104846072B/en active Active
- 2011-09-16 CN CN201510134199.1A patent/CN104845992B/en active Active
- 2011-09-16 CN CN201510134100.8A patent/CN104830972B/en active Active
- 2011-09-16 CN CN201510134175.6A patent/CN104846071B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Alternative splicing and biological heterogeneity in prostate cancer;Prabhakar Rajan,et al;《urology》;20090831;第6卷;454-460页 * |
| Complex alternative splicing of the hKLK3 gene coding for the tumor marker PSA (prostate-specific-antigen);Nathalie Heuze -Vourc"h,et al;《Eur.J.Biochem》;20031231;706-714页 * |
| Identification of a novel prostate cancer susceptibility variant in the KLK3 gene transcript;Z. Kote-Jarai，et al;《Hum Genet》;20111231;687-694页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104830972A (en) | 2015-08-12 |
| CN104846071B (en) | 2019-03-15 |
| CN104845992B (en) | 2018-09-14 |
| CN104846070A (en) | 2015-08-19 |
| CN104846073A (en) | 2015-08-19 |
| CN104846070B (en) | 2018-02-09 |
| CN104830972B (en) | 2019-03-15 |
| CN104846073B (en) | 2018-04-13 |
| CN104845992A (en) | 2015-08-19 |
| CN104846072A (en) | 2015-08-19 |
| CN104846071A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103797120B (en) | Prostate cancer biomarkers, therapeutic targets and uses thereof | |
| Guffanti et al. | A transcriptional sketch of a primary human breast cancer by 454 deep sequencing | |
| CN113286883A (en) | Methods for detecting disease using RNA analysis | |
| CN109415763A (en) | Capture the cell-free method of methylate DNA and application thereof | |
| Gnanapragasam | Unlocking the molecular archive: the emerging use of formalin‐fixed paraffin‐embedded tissue for biomarker research in urological cancer | |
| De Paoli-Iseppi et al. | Comparison of whole-exome sequencing of matched fresh and formalin fixed paraffin embedded melanoma tumours: implications for clinical decision making | |
| CA2858581A1 (en) | Cancer diagnostics using non-coding transcripts | |
| EA035451B1 (en) | Method to diagnose cancer using genomic sequencing | |
| CN116631508B (en) | Detection method for tumor specific mutation state and application thereof | |
| CN109666745A (en) | The detection method and kit of chromosome 1p/19q joint loss of heterozygosity | |
| JP2023523002A (en) | Structural variant detection in chromosomal proximity experiments | |
| Zhang et al. | Intratumor heterogeneity and clonal evolution revealed in castration-resistant prostate cancer by longitudinal genomic analysis | |
| CN105779432A (en) | Kit and applications thereof | |
| CN104846072B (en) | The biological markers of prostate cancer, therapy target and application thereof | |
| Liu | The context of prostate cancer genomics in personalized medicine | |
| WO2017196133A1 (en) | Method for predicting prognosis of breast cancer patients by using gene deletions | |
| US10443102B2 (en) | Recurrent SPOP mutations in prostate cancer | |
| KR101977976B1 (en) | Method for increasing read data analysis accuracy in amplicon based NGS by using primer remover | |
| CN108342483B (en) | Group of genes for molecular typing of non-hyper-mutant colorectal cancer and application thereof | |
| CN110564851A (en) | Group of genes for molecular typing of non-hyper-mutant rectal cancer and application thereof | |
| Dunn et al. | Molecular profiling of indolent human prostate cancer: tackling technical challenges to achieve high-fidelity genome-wide data | |
| CN117965734B (en) | Gene marker for detecting hard fibroid, kit, detection method and application | |
| EP0873424B1 (en) | Metastasis inducing dna's | |
| Badalamenti et al. | Cell-free/circulating tumor DNA profiling: from next-generation sequencing-based to digital polymerase chain reaction-based methods | |
| Xu et al. | Altered expression spectrum and target gene prediction of tRNA-derived small RNAs in clear cell renal cell carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20151214 Address after: 200433 Shanghai city Yangpu District Changhai Road No. 168 Applicant after: Shanghai Changhai Hospital Applicant after: BGI SHENZHEN CO LTD Address before: 200433 Shanghai city Yangpu District Changhai Road No. 168 Applicant before: Shanghai Changhai Hospital Applicant before: BGI-Shenzhen Co., Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |