CN104818330A - Kit for distinguishing and detecting bovine piroplasmosis and preparation and usage method - Google Patents

Abstract

The invention discloses a kit for differential diagnosis on bovine piroplasmosis infection situation of bovine animals and a preparation and usage method thereof. The kit for distinguishing and detecting bovine piroplasmosis comprises an SEQ ID No.1 primer, an SEQ ID No.2 primer and Mbo I enzyme. The situation of bovine infection of theileria and babesia can be preliminarily judged, the mixed infection situation of the theileria and babesia can be further detected, the specific species, mixed infection and other situations of infected piroplasma can be directly judged after further enzymatic detection, and a detection method is relatively simple, the time consumed by detection process is short, and the cost is low.

Description

For distinguishing and detect the test kit of ox pyriform worm and preparation and using method

Technical field

The present invention relates to the discriminating detection technique of a kind of zooparasite, Specifically the invention provides and a kind ofly whether infect the detection kit of piroplasmosis and preparation thereof and using method for differential diagnosis bovine animals.

Background technology

Ox piroplasmosis (equine piroplasmosis) is that ox Babesia and Taylor worm parasitize a kind of acute, the subacute or chronic anti-protozoal parasitosis caused in the red corpuscle of bovine animals, its communication media is tick, mainly to cause animal to generate heat (sometimes in periodicity), anaemia, jaundice, hepatosplenomegaly for feature, there is the symptom such as bilirubinuria and hemoglobinuria in course of disease later stage animals.Babesia (Babesia) is the Subkingdom Protozoa (Protozoa) of Protista (Protista), this genus (Babesia) of this section of BABEI (Babesiidae) BABEI pushed up in multiple door (Apicomplexa), sporozoa (Sporozoea), pyriform worm subclass (Piroplasmia), pyriform worm order (Piroplasmida).Comprise in the popular worm strain of the main Babesia of China's infected cattle: ox Babesia, two-pressure humidity generator, Babesia ovata, large Babesia, the strain of Babesia U sp Keshen.Babesia parasitizes in the red corpuscle of bovine animals, and caused disease is called Babesia Gibsoni.Taylor worm (Theileria) (old name burnt worm) is Taylor section (Theileriidae) in pyriform worm subclass (Piroplasmia), pyriform worm order (Piroplasmida), Theileria (Theileria).Taylor worm parasitizes in the scavenger cell of bovine animals, lymphocyte and red corpuscle, and caused parasitosis is called that babesia taylor is sick.Comprise in the popular worm strain of main Taylor worm of China's infected cattle: annular loop detector, Taylor Se Shi worm and Theileria sinensis.Ox piroplasmosis in the world many countries and regions popular, International Office of Epizootics (Office International Des Epizooties, OIE) babesiasis and babesia taylor disease are classified as B class epidemic disease (OIE. Bovine piroplasmosis. 2008), China is classified as two class epidemic diseases.In China, babesiasis Major Epidemic is in the area such as northwest, south, and the primary vehicle of ox Babesia and two-pressure humidity generator is boophilus microplus and the molecule Rhipilin-1 of hard tick genus; The primary vehicle of large Babesia and Babesia ovata is the haemaphysalis longicornis of Haemaphysalis; The primary vehicle of Babesia U sp Keshen strain is the hyalomma anatolicum anatolicum of Hyalomma.The sick Major Epidemic of babesia taylor of ox is in the area such as northwest, North, Northeast China, and annular loop detector primary vehicle is the tick of Hyalomma: comprise Hyalomma dctritum, hyalomma anatolicum anatolicum, hyalomma scupense etc.The primary vehicle of Taylor Se Shi worm is the haemaphysalis longicornis of Haemaphysalis; The primary vehicle of Theileria sinensis be Qinghai blood tick (Wang Ming edits. veterinary parasitology [M]. Beijing: Chinese agriculture press, 2008:366 – 369).The popularity in season of ox piroplasmosis is very strong, many in acute process, M & M is all very high, especially to introduce epidemic-stricken area external bovine animals, change the very harmful of good breed of cattle and beef cattle, be one of principal disease of restriction developing country bovine animals aquaculture industry development.At present, the diagnosis and detection of ox piroplasmosis mainly contains following a few class means: the traditional methods such as (1) blood smear dyeing microscopic examination, lymph node puncture test, vitro culture, clinical diagnosis and animal inoculation pvaccination test, this class methods recall rate is low, very high to the competency profiling of testing staff.(2) serological method, as: indirect fluorescent antibody test (IFAT), enzyme linked immunosorbent assay (ELISA), solid-phase enzyme-linked immunosorbent test (SELISA) and competition enzyme-linked immunosorbent adsorption test (C-ELISA) etc., see Dominguez M, Echaide I, de Echaide ST, Wilkowsky S, Zabal O, Mosqueda JJ, Schnittger L, Florin-Christensen M. 2012. Validation and field evaluation of a competitive enzyme-linked immunosorbent assay for diagnosis of babesia bovisinfections in Argentina. Clin Vaccine Immunol. 19,924-928., Altangerel K, Alhassan A, Iseki H, Sivakumar T, Boldbaatar D, Yokoyama N, Igarashi I. 2009. Evaluation of babesia bigemina200 kDa recombinant antigen in enzyme-linked immunosorbent assay. Parasitol Res. 105,249-254, Singh H, Mishra AK, Rao JR, Tewari AK. 2009. Comparison of indirect fluorescent antibody test (IFAT) and slide enzyme linked immunosorbent assay (SELISA) for diagnosis of babesia bigeminainfection in bovines. Trop Anim Health Prod. 41,153-159, Kim C, Alhassan A, Verdida RA, Yokoyama N, Xuan X, Fujisaki K, Kawazu S, Igarashi I. 2007. Development of two immunochromatographic tests for the serodiagnosis of bovine babesiosis. Vet Parasitol. 148,137-143, Barros SL, Madruga CR, Ara ú jo FR, Menk CF, de Almeida MA, Melo EP, Kessler RH. 2005. Serological survey of babesia bovis, babesia bigemina, and anaplasma marginaleantibodies in cattle from the semi-arid region of the state of Bahia, Brazil, by enzyme-linked immunosorbent assays. Mem Inst Oswaldo Cruz. 100,513-517, Salih DE, Ahmed JS, Bakheit MA, Ali EB, El Hussein AM, Hassan SM, Shariff OE, Fadl M, Jongejan F. 2005. Validation of the indirect TaSP enzyme-linked immunosorbent assay for diagnosis of theileria annulatainfection in cattle. Parasitol Res. 97,302-308, Goff WL, McElwain TF, Suarez CE, Johnson WC, Brown WC, Norimine J, Knowles DP. 2003. Competitive enzyme-linked immunosorbent assay based on a rhoptry-associated protein 1 epitope specifically identifies babesia bovis-infected cattle. Clin Diagn Lab Immunol. 10,38-43, Ruiz PM, Passos LM, Machado RZ, Lima JD, Ribeiro MF. 2001. Development of an enzyme-linked immunosorbent assay for detection of IgM antibodies to babesia bigeminain cattle. Mem Inst Oswaldo Cruz. 96,237-240.Although the infection of single ox pyriform worm can be diagnosed and differentiate to these class methods, but the antibody that the cross infection of different pyriform worm worm strain produces and antibody titers may judge to have an impact to final result, the phenomenons such as undetected, false positive may be there is, also very high to the requirement of testing staff.(3) molecular detection technology, as methods such as PCR, Chao Shi round pcr, multiplex PCR, real-time quantitative PCR, LAMP, reverse linear traces (RLB), specifically see Bilgi HB, Karagen T, Simuunza M, Shiels B, Tait A, Eren H, Weir W. 2013. Development of a multiplex PCR assay for simultaneous detection of theileria annulata, babesia bovisand anaplasma marginalein cattle. Exp Parasitol. 133,222-229; Liu A, Guan G, Du P, Gou H, Zhang J, Liu Z, Ma M, Ren Q, Liu J, Yang J, Li Y, Niu Q, Bai Q, Yin H, Luo J. 2013. Rapid identification and differentiation of theileria sergentiand theileria sinensisusing a loop-mediated isothermal amplification (LAMP) assay. Vet Parasitol. 191,15-22; Ros-Garc í a A; Juste RA; Hurtado A. 2012. A highly sensitive DNA bead-based suspension array for the detection and species identification of bovine piroplasms. Int J Parasitol. 42,207-214; Ramos CA, Ara ú jo FR, Souza II, Bacanelli G, Luiz HL, Russi LS, Oliveira RH, Soares CO, Rosinha GM, Alves LC. 2011. Real-time polymerase chain reaction based on msa2c gene for detection of babesia bovis. Vet Parasitol. 176,79-83; Silva MG; Marques PX; Oliva A. 2010. Detection of Babesia and Theileria species infection in cattle from Portugal using a reverse line blotting method. Vet Parasitol. 174,199-205; Hasle G, Bjune GA, Christensson D, R ed KH, Whist AC, Leinaas HP. 2010. Detection of babesia divergensin southern Norway by using an immunofluorescence antibody test in cow sera. Acta Vet Scand. 52:55; AbouLaila M, Yokoyama N, Igarashi I. 2010. Development and evaluation of two nested PCR assays for the detection of babesia bovisfrom cattle blood. Vet Parasitol. 172,65-70; Criado-Fornelio A, Buling A, Asenzo G; Benitez D; Florin-Christensen M, Gonzalez-Oliva A, Henriques G; Silva M; Alongi A, Agnone A, Torina A; Madruga CR. 2009. Development of fluorogenic probe-based PCR assays for the detection and quantification of bovine piroplasmids. Vet Parasitol. 162,200-206; Iseki H; Alhassan A; Ohta N; Thekisoe OM, Yokoyama N, Inoue N; Nambota A; Yasuda J, Igarashi I. 2007. Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of bovine Babesia parasites. J Microbiol Methods. 71,281-287; Kim C, Iseki H, Herbas MS, Yokoyama N, Suzuki H, Xuan X, Fujisaki K, Igarashi I. 2007. Development of TaqMan-based real-time PCR assays for diagnostic detection of babesia bovisand babesia bigemina. Am J Trop Med Hyg. 77,837-841..Compared with the method for routine, these class methods have that susceptibility is high, high specificity, recall rate advantages of higher, but some of them method is only for the specific detection that the 1-2 kind cause of disease of ox pyriform worm is carried out.Although reverse linear engram technology can detect the cause of disease of multiple ox Babesia and babesia taylor disease simultaneously, the plant and instrument because of its higher cost and complicated schedule of operation and costliness makes the method can not popularize the diagnosis of babesiasis in field and babesia taylor disease.Meanwhile, in these diagnostic methods, do not comprise the popular worm strain of Chinese distinctive ox pyriform worm.So need at present to set up a kind of simple method, the universal method of ox pyriform worm can be detected, can differentiate and distinguish again the concrete kind of the pyriform worm infecting bovine animals, in this diagnosis at ox piroplasmosis, treatment, prevention and control and epidemiology survey etc., have important meaning.

Summary of the invention

The invention provides a kind of overcome prior art deficiency for detecting the test kit of ox pyriform worm and preparation thereof and using method.

SEQ ID No is included, 1 and SEQ ID No, 2 two primers in test kit for distinguishing and detect ox pyriform worm of the present invention.

Further, M is also had in the test kit for distinguishing and detect ox pyriform worm of the present invention boi enzyme.

The non-diseases diagnosis detecting method of test kit of the present invention is: the genomic dna extracted with animal blood to be detected is template, with primer SEQ ID No, obtains PCR primer after 1 and SEQ ID No, 2 amplifications; PCR primer after gel purification kit purifying, through M boi 37 DEG C of conditions lower 3 hours enzymes are cut, and digestion products is carried out detected through gel electrophoresis in the gel of 3%, whether occur whether band determination test sample suffers from ox pyriform worm at specific position according to PCR primer; The special endonuclease bamhi size produced according to Babesia and Taylor worm infers the concrete kind of suffered from ox pyriform worm.

The present invention has the following advantages:

The first, the present invention adopts the universal primer of ox pyriform worm and the conservative coding region of RPS8 gene and high variation non-coding region, utilize the difference causing babesiasis cause of disease and babesia taylor disease pathogen expanding fragment length, can the situation of preliminary judgement cattle infected Taylor worm and Babesia, can also detect the two polyinfection situation, this epidemiological survey for bovine animals mass-sending property piroplasmosis has great importance.

The second, based on the endonuclease bamhi length causing the former RPS8 gene specific of ox piroplasmosis, the present invention can determine the concrete kind of ox pyriform worm, and can find pyriform worm novel species or the strain (unknown species) of infecting bovine animals.

Three, when concrete enforcement is of the present invention, with the poba gene group DNA of tested animal for template, only with a pair pyriform worm universal primer, through a pcr amplification, if there is amplified production just can determine tested zoogenetic infection piroplasmosis, and tentatively can judge Babesia cause of disease and the former single or polyinfection of theileriosis; PCR primer, again after further enzyme cuts detection, directly can judge the situation such as concrete kind, polyinfection of infected pyriform worm, and this is the rapid detection of piroplasmosis, Species identification and epidemiology survey provide important instrument.

When four, adopting the present invention to detect, detect while can carrying out a large amount of sample, detection method is relatively simple, and testing process is consuming time less, with low cost.This has great advantage when carrying out fairly large, macrocyclic ox piroplasmosis epidemiology survey, can save time, and saves a large amount of manpower and materials.

Accompanying drawing explanation

Fig. 1 is ox pyriform worm RPS8 gene and M boi endonuclease bamhi length distribution table, therefrom visible different pyriform worm and M bothe corresponding relation of I endonuclease bamhi length.

Fig. 2 is the electrophorogram with ox pyriform worm universal primer amplification RPS8 gene, wherein: Lane 1,2000 bp marker gene; Lane 2: Se Shi Taylor worm; Lane 3, annular loop detector; Lane 4, ox Babesia; Lane 5, large Babesia; Lane 6, two-pressure humidity generator; Lane 7, Theileria sinensis; Lane 8, Babesia ovata; Lane 9, the strain of Babesia U sp Keshen; Lane 10, Trypanosoma evansi; Lane 11, clean cow genome group DNA.

Fig. 3 is for carry out M with ox pyriform worm RPS8 gene boi enzyme cut after electrophorogram, wherein: Lane 1,2000 bp marker gene; Lane 2, ox Babesia; Lane 3, Se Shi Taylor worm; Lane 4, large Babesia; Lane 5, annular loop detector; Lane 6, the strain of Babesia U sp Keshen; Lane 7, two-pressure humidity generator; Lane 8, Theileria sinensis; Lane 9, Babesia ovata.

Embodiment

One, the foundation of ox pyriform worm PCR-RFLP detection method:

Specified operational procedure is as follows:

1, the Design and synthesis of pyriform worm universal primer

A pair pyriform worm universal primer of the conservative region design at pyriform worm RPS8 gene order two ends, can amplify the goal gene of 707bp ~ 855bp size.Universal primer carries out synthetic by Sangon Biotech (Shanghai) Co., Ltd. by design requirements.The concrete sequence of universal primer is as follows:

Upstream primer RPS8-F:(5 '-ATGGGTATTTCACGTGACAG-3 ');

Downstream primer RPS8-R:(5 '-GCGTTTCTTCTTATCCATACG-3 ').

2, for detecting the PCR-RFLP detection method (detection method of non-diseases diagnosis) of ox pyriform worm

Determine that the optimum amount of universal primer in damping fluid is 10 pmol/ μ l and best PCR condition and is through trial test: 94 DEG C/3min; 94 DEG C/45 s, 54 DEG C/1.0 min, 72 DEG C/1.0min, 40 circulations; 72 DEG C/10min; 4 DEG C/preserve.Primer used in the present invention is: SEQ ID No, 1:ATGGGTATTTCACGTGACAG and SEQ ID No, 2:GCGTTTCTTCTTATCCATACG; The optimum amount scope of enzyme is 1U M bothe isogenic PCR primer of I/ μ l RPS8.

Concrete operations are as follows:

1) the poba gene group DNA of extracting ox;

2) regular-PCR method is adopted to increase from the poba gene group DNA of ox RPS8 gene;

3) with the 50 μ l RPS8 gene PCR product that DNA gel Purification Kit obtains;

4) by the PCR primer of purifying through 30 U M boi cuts through 37 DEG C of conditions lower 3 hours enzymes;

5) PCR primer of being cut by enzyme carries out detected through gel electrophoresis in the gel of 3%.

Two, the concrete detection example of ox pyriform worm PCR-RFLP detection method is used

1, the extraction of animal blood genomic dna

1) 300 μ L blood are added in the 1.5mL centrifuge tube of the BRC Lysis Solution filling 900 μ L, put upside down 10 times, in incubated at room 1 to 3 minute (namely making the complete cracking of red corpuscle, liquid clear) as far as possible

2) centrifugal 2 minutes of 2000 × g, careful supernatant discarded, retains visible white precipitate and about 10 ~ 20 μ L liquid bottom centrifuge tube, and vortex mixes or mixes with suction nozzle piping and druming for 20 seconds.

3) often 300 μ L Cell Lysis Solution are added in pipe, piping and druming mixing.

4) add 100 μ L Protein Preciptation Solution, spiral mixes or blows and beats, until there is brown precipitation particle with suction nozzle for 20 seconds.

5) 13000 × g is after centrifugal 3 minutes, is moved to by supernatant liquor in labeled new centrifuge tube, adds 300 μ L Virahols, puts upside down 50 times.

6) centrifugal 5 minutes of 13000 × g, inhales and abandons supernatant, the filter paper of cleaning is carefully inverted, is blotted by residual liquid.

7) 300 μ L 70% ethanol are added.Centrifugal 3 minutes of 13000 × g, carefully removes supernatant liquor, blots residual liquid with thieving paper.

8) room temperature or 37 DEG C of dry airs 3 ~ 5 minutes.

9) add 100 μ L DNA Hydration Solution, spiral mixes or blows and beats repeatedly with suction nozzle for 5 seconds.

10) 65 DEG C of incubations 5 minutes are to dissolve genomic dna.

11) then room temperature is shaken a few hours or is spent the night, and-20 DEG C save backup.

2, standard Babesia genomic dna detects the acquisition of sample

With through identified and the blood inoculation experiments bovine animals respectively of the Babesia preserved in liquid nitrogen (two-pressure humidity generator, ox Babesia, Babesia ovata, large Babesia and Keshen strain of ox Babesia U sp) single worm kind alive, when erythrocytic Infestation rat reaches more than 0.1%, using 20% Sodium Citrate as antithrombotics, by venous collection blood sample, by centrifugal 10 minutes of 1000 × g under gathered anticoagulated blood 4 DEG C of conditions, supernatant discarded, inhales upper strata white corpuscle as far as possible and abandons.Wash three times (same to pre-treatment, centrifugal 10 minutes of 1000 × g) with 2% Sodium Citrate, finally removed by supernatant, red corpuscle is distributed in 1.5mL centrifuge tube, and-20 DEG C save backup.The Animal genome DNA that blood extracts thus is standard Babesia genome DNA sample.

3, standard Taylor molitor genomic dna detects the acquisition of sample

With through identified and the blood of the Taylor worm preserved in liquid nitrogen (annular loop detector, Taylor Se Shi worm and Theileria sinensis) single worm kind alive respectively inoculation experiments bovine animals, when erythrocytic Infestation rat reaches more than 0.1%, the same process.The Animal genome DNA that blood extracts thus is standard Niu Taile molitor genomic dna sample.

4, standard female genomic dna detects the acquisition of sample

With through identified and preserve in liquid nitrogen containing the blood inoculation experiments mouse species of the single worm kind alive of Trypanosoma evansi, when Infestation rat reaches more than 0.1%, gather blood sample by the mode of Culling heart blood, be distributed into by gathered anticoagulated blood in 1.5mL centrifuge tube ,-20 DEG C save backup.The Animal genome DNA that blood extracts thus is standard negative control sample gene group DNA.

5, the pcr amplification of goal gene

Respectively with the genomic dna of animal to be checked for template, carry out the pcr amplification of goal gene with pyriform worm universal primer (RPS8-F/RPS8-R), result is positive PCR primer is after testing exactly the PCR primer wanting enzyme to cut.

The buffer system of PCR reaction is as follows:

Mix add each reagent according to the above ratio in reaction tubes after, brief centrifugation is placed in PCR amplification instrument and carries out pcr amplification reaction, and amplification program is: 94 DEG C/3min; 94 DEG C/45 s, 54 DEG C/1.0 min, 72 DEG C/1.0min, 40 circulations; 72 DEG C/10min; 4 DEG C/preserve.

Get the sepharose (ethidium bromide containing 0.5 μ g/mL) that 3 μ L PCR primer are placed in 1.5%, under the voltage conditions of 120 volts, carry out electrophoretic analysis, observe amplification.Test positive, goal gene size are exactly the PCR primer wanting enzyme to cut in the PCR primer of about 700bp-855bp, utilize the method for pvuii restriction fragment to carry out further enzyme cut qualification for next step.

6, pvuii restriction fragment method (RFLP) is utilized to detect and qualification ox pyriform worm

PCR primer after the DNA gel Purification Kit of precious biotech firm, with the M of precious biotech firm boi enzyme cuts the PCR primer of purifying in 37 DEG C of conditions lower 3 hours enzymes, and different ox Babesias and the strain of Taylor worm worm produce the fragment of respective natural length.The situation of tested zoogenetic infection pyriform worm can be judged according to PCR primer endonuclease bamhi length polymorphism.

Concrete operation step is as follows:

1) according to the positive RPS8 PCR primer that the DNA gel Purification Kit amplification of precious biotech firm obtains;

2) the PCR purified product, the 30 U M that add 30 μ L are cut in system at the enzyme of 50 μ L boi enzyme, 5 μ L10 × K buffer and 12 μ L deionized waters;

3) digestion products of mixing enzyme under 37 DEG C of conditions is cut 3 hours;

4) sepharose (ethidium bromide containing 0.5 μ g/mL) of 3% is prepared;

5) get the sepharose (ethidium bromide containing 0.5 μ g/mL) that 40 μ L digestion products are placed in 3%, under the voltage conditions of 120 volts, carry out electrophoretic analysis, observe enzyme and cut result.

7, result judges

According to the sequence information of the RPS8 gene (coding region and non-coding region) of the pyriform worm obtained, annular loop detector institute expanding fragment length is 709bp, Se Shi Taylor worm is 713bp, and Theileria sinensis is 707bp; And two-pressure humidity generator is 849bp, large Babesia is 847bp, and Babesia ovata is 849bp, and ox Babesia is 820bp, and the strain of Babesia U sp Keshen is 855bp.The clip size produced between the strain of Taylor worm worm is basically identical, the clip size produced between the strain of same Babesia worm is also basically identical, but the clip size produced between Taylor worm and Babesia is different, tentatively can judge from PCR primer clip size the situation infecting Babesia and Taylor worm Animal genome DNA to be checked; The specific fragment cutting generation according to PCR primer enzyme further directly can judge the situation such as concrete kind, polyinfection of infected pyriform worm, and namely Taylor Se Shi worm produces endonuclease bamhi length is 464 and 249 bp; Theileria sinensis is 430,182 and 95 bp; Annular loop detector is 227,203,182 and 97 bp; Two-pressure humidity generator is 506,243, and 100bp; The strain of Babesia U sp Keshen is 476,274,99 and 37 bp; Ox Babesia is 341,243,99,90 and 37 bp; Large Babesia is 274,243,231 and 99 bp; Babesia ovata is 233-244,98,35bp.The detected result of the present invention after implementing is see accompanying drawing 3 and Fig. 1.

In order to detect the specificity of pyriform worm PCR universal primer, when the present invention specifically implements, also use the genomic dna of the Trypanosoma evansi of infected cattle as negative control simultaneously; With the normal gene group DNA of ox as blank.The detected result of the present invention after implementing is see accompanying drawing 2.

 

<110> Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences

<120> is for distinguishing and detect the test kit of ox pyriform worm and preparation and using method

<160> 2

 

<210> 1

<211> 20

<212> DNA

<213> artificial sequence (RPS8-F)

<400>

atgggtattt cacgtgacag 20

 

<210> 2

<211> 21

<212> DNA

<213> artificial sequence (RPS8-R)

<400>

gcgtttcttc ttatccatac g 21

Claims (3)

1. for distinguishing and detect the test kit of ox pyriform worm, it is characterized in that in test kit, including SEQ ID No, 1 and SEQ ID No, 2 two primers.

2. the test kit for distinguishing and detect ox pyriform worm according to claim 1, is characterized in that also having M in test kit boi enzyme.

3. the detection method of the test kit non-diseases diagnosis described in claim 1 or 2, is characterized in that the genomic dna extracted with animal blood to be detected is for template, with primer SEQ ID No, and 1 and SEQ ID No, obtain PCR primer after 2 amplifications; PCR primer after DNA gel Purification Kit, through M boi 37 DEG C of conditions lower 3 hours enzymes are cut, and digestion products is carried out detected through gel electrophoresis in the gel of 3%, whether occur whether band determination test sample suffers from ox pyriform worm at specific position according to PCR primer; The special endonuclease bamhi size produced according to Babesia and Taylor worm further infers the concrete kind of suffered from ox pyriform worm.