CN104818225A - Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme - Google Patents

Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme Download PDF

Info

Publication number
CN104818225A
CN104818225A CN201510105290.0A CN201510105290A CN104818225A CN 104818225 A CN104818225 A CN 104818225A CN 201510105290 A CN201510105290 A CN 201510105290A CN 104818225 A CN104818225 A CN 104818225A
Authority
CN
China
Prior art keywords
enzyme
temperature
protease
low
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510105290.0A
Other languages
Chinese (zh)
Inventor
张会图
路福平
莫清珊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN201510105290.0A priority Critical patent/CN104818225A/en
Publication of CN104818225A publication Critical patent/CN104818225A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea

Abstract

The invention relates to a low temperature protease production strain, low temperature protease produced by the same and a gene of the enzyme. A strain of planococcussp. producing low temperature protease is separated from the southern Indian Ocean deep-sea sediment for the first time, the preservation number of the strain is CGMCC No.8088, the optimum growth temperature and the optimum enzyme production temperature are both 20DEG C, and the fermentation level protease yield can reach 280U/mL. The optimum operation temperature of the protease produced by the strain is 30-37DEG C, the optimum pH is 7.5-9.0, under the condition of 30DEG C, over 80% of the highest catalytic activity can be maintained, and in the range of 20-25DEG C, the protease still has high catalytic activity. The protease produced by the strain belongs to typical low temperature alkaline protease and has good catalytic activity at normal temperature, thus having high research value in food processing industry, cold water detergent development and other aspects.

Description

The gene of the low-temperature protease that cold induced proteins enzyme-producing bacteria and this bacterium produce and this enzyme
Technical field
The present invention relates to microorganism and micro-organism enzyme preparation field, be specifically related to a strain derive from abyssal sediment low-temperature protease producing strains, produce proteolytic enzyme and utilize this bacterial strain to produce the method for low-temperature protease.
Background technology
Low-temperature protease refers to that the suitableeest catalytic temperature is below 40 DEG C, and between 20 ~ 30 DEG C, still can keep a proteinoid lytic enzyme of high enzyme (50 more than ﹪) alive, due to the temperature in its suitableeest catalytic temperature access expansion environment, therefore heating or process of cooling can be saved in application process, have compared with middle thermoase energy-conservation, the feature such as save time, be with a wide range of applications at food and washing industry.Low-temperature protease majority derive from the low temperature environments such as glacier, polar region, high mountain, deep-sea addicted to low temperature or low temperature resistant microorganism.These psychrophiles are in order to adapt to the low temperature environment residing for it, often can expression-secretion some still there is extracellular enzyme or the intracellular enzyme of higher catalytic activity under cryogenic, therefore from low temperature resistant or addicted to psychrophile, screening obtains low-temperature protease has become the main method of excavating infant industry cold-adapted enzyme preparation.
The product low-temperature protease bacterial strain found at present has and derives from Bacillus licheniformis (Bacilluslicheniformis) in dirt band and bacillus pumilis (Curtobacteriumluteum), derive from antarctic clostridium (Clostridiumsp.) and Psychrobacter (Psychrobacterproteolyticus), derive from the Colwell Bordetella (Colwelliasp.) in the floating ice of ocean, the Exiguobacterium sp (Exiguobacteriumsp.) deriving from cold desert area and the Serratia (Serratiasp.) derived from other cold environment, vibrios (Vibriosp.), Xanthomonas campestris (Xanthomonasmaltophilia), genus Shewanella (Shewanellasp.) Penicllium chrysogenum (Penicilliumchrysogenum) etc.These bacterial strains produce the suitableeest catalytic temperature major part of low-temperature protease all between 30 ~ 40 DEG C, only have a few the suitableeest catalytic temperature lower than 20 DEG C, but stability is very poor.
The domestic research to low-temperature protease and producing strains thereof is started late, and research object focuses mostly on and deriving from the genus of the Pseudomonas in glacier and frozen soil, Xanthomonas genus, Aeromonas genus etc.
Summary of the invention
The low-temperature protease that the object of the present invention is to provide a kind of cold induced proteins enzyme-producing bacteria and this bacterium to produce and the gene of this enzyme, this bacterium source is in southern Indian Ocean abyssal sediment, through 16SrRNA sequential analysis, be accredited as planococcus (Planococcussp.), this enzyme gene order is shown in sequence 1, this bacterial strain deposit number is: CGMCCNo.8088, this bacterial strain is produced bacterial strain as low-temperature protease and is had larger advantage, there is fermentation condition be easy to control, fermentation raw material is simple and easy to get, growth is fast, fermentation period is short, the ability of phage-resistance and living contaminants is stronger, the remarkable advantage that strain enzyme-producing is comparatively stable.
The technical scheme that the present invention realizes object is:
One strain cold induced proteins enzyme-producing bacteria, described bacterial strain preservation date is on 08 29th, 2013, depositary institution is: China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number is: CGMCCNo.8088, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Classification And Nomenclature is: planococcus Planococcussp..
And described bacterial strain can utilize glucose, fructose, starch as carbon source, ammonium sulfate, peptone, caseinhydrolysate can be utilized as nitrogenous source; Have oxydase, catalase activity, gelatine liquefication experiment is positive, and is producing obvious transparent circle containing on caseic 4 ~ 20 DEG C of low temperature flat boards.
A kind of low-temperature protease gene, the part expression regulation sequence of its mature polypeptide coding sequence, signal coding sequence and upstream of coding region is as shown in sequence 1.
A kind of low-temperature protease, produces bacteria strain fermentation by low-temperature protease and obtains.
A kind of low-temperature protease, obtains via the genetic expression described in sequence 1.
Produce a genetically engineered for low-temperature protease, containing the low-temperature protease gene described in sequence 1.
Advantage of the present invention and beneficial effect are:
1, this bacterial strain has larger advantage as low-temperature protease production bacterial strain: (1) fermentation condition is easy to control, the optimum growth temperature of this bacterial strain produces enzyme temperature all close to the temperature in physical environment with best, therefore the process of heating or cooling can be saved during the fermentation, in addition, the growth of this bacterial strain affects less by pH value, between pH6.0-8.0, equal Absorbable organic halogens grows and produces enzyme; (2) fermentation raw material is simple and easy to get, and proteinase production is high, and this bacterial strain can carry out quick growth and breeding on the substratum containing casein and sea salt, and shake flask fermentation 48h proteinase production can reach 280-360U/mL; (3) growth is fast, fermentation period is short, this bacterial strain under optimal growth conditions for time be about 30-40min, can compare favourably with the Fast-propagation such as intestinal bacteria, subtilis bacterial classification; (4) the ability of phage-resistance and living contaminants is stronger; (5) strain enzyme-producing is comparatively stable, and yield of enzyme is directly proportional to thalli growth amount substantially.
2, to this bacterial strain produce the characterization analysis result of proteolytic enzyme, proteolytic enzyme that this bacterial strain produces should belong to typical serine protease, and its suitableeest catalytic temperature is about 37 DEG C, can keep higher catalytic activity between 25-30 DEG C; Because the normal temps of human body is also between 36-37 DEG C, in toothpaste or makeup, therefore adds this enzyme be expected to play best catalytic effect; This enzyme belongs to typical low-temperature protease, and compared with medium/high proteolytic enzyme, thermostability is poor, and 50 DEG C are only incubated 1.0min, then enzyme is lived and completely lost; Although this characteristic is unfavorable for storage and the transport of enzyme, but in food, beer and dairy industry, there is larger application prospect, because in its course of processing, often need the deactivation of proteolytic enzyme to ensure local flavor and the quality of food, beer and milk preparation; The deactivation of middle thermoase is very difficult often needs higher temperature and longer time, larger on product impact; And low-temperature protease, then only need lower temperature (50 DEG C) and shorter time (1-5min) just can make proteolytic enzyme complete deactivation, therefore the use of low-temperature protease not only energy-conservation, save time, also fully can ensure the peculiar flavour in food, beer and milk preparation and quality.
Accompanying drawing explanation
Fig. 1 is the optimum temperature of proteolytic enzyme of the present invention;
Fig. 2 is the suitableeest action pH of proteolytic enzyme of the present invention;
Fig. 3 is the thermostability of proteolytic enzyme of the present invention.
Embodiment
Below by specific embodiment, the invention will be further described, and following examples are descriptive, is not determinate, can not limit protection scope of the present invention with this.
One, bacterial strain state description: the invention provides a kind of can the marine bacteria planococcus TCCC11813 (CGMCCNo.8088) of high-yield of low-temperature proteolytic enzyme.This bacterium source, in southern Indian Ocean abyssal sediment, through 16SrRNA sequential analysis, is accredited as planococcus (Planococcussp.).This bacterial strain gramstaining is positive, spherical or oval, diameter about 0.5 ~ 2.5 μm, two spherical or beaded arrangement; Colonial morphology is circular, color is orange-yellow, and smooth surface, edge are neat.Can the comparatively carbon source such as good utilisation glucose, fructose, starch, the nitrogenous sources such as ammonium sulfate, peptone, caseinhydrolysate can be utilized; Have oxydase, catalase activity, gelatine liquefication experiment is positive, and can produce obvious transparent circle containing (4 ~ 20 DEG C) on caseic low temperature flat board.This bacterial strain was stored in China Committee for Culture Collection of Microorganisms of Institute of Microorganism, Academia Sinica common micro-organisms center on 08 29th, 2013, and deposit number is: CGMCCNo.8088, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City.Low-temperature protease producing strains involved in the present invention can be the original strain of Natural Selection, also can be the low-temperature protease that this bacterial strain of variation made a variation by natural variation or artificial induction is produced.
Two, strain enzyme-producing behavioral illustrations: planococcus TCCC11813 of the present invention can ferment generation low-temperature protease, its zymetology is characterized as: optimal reactive temperature is between 35 ~ 37 DEG C, and between 25-40 DEG C, all there is good catalytic activity (more than 50% of the highest katalaze enzyme work), temperature is higher than 50 DEG C, enzyme is lived and is substantially lost, and shows obvious low-temperature protease characteristic; The THERMAL STABILITY of enzyme shows: this bacterial strain to produce the thermostability of proteolytic enzyme lower, 45 DEG C of insulation 60min, then enzyme lives 10%, 50 DEG C of insulation 1min only surplus original, then catalytic activity completely loses, and less than 10 DEG C are incubated 1h, and enzyme is lived and still remained on more than 90%.This enzyme all has catalysis activity within the scope of pH4.0-10.0pH, and its suitableeest action pH is about 8.0; When pH value rises to 9.0, its enzyme live be about the highest enzyme live about 70%, when pH value rises to 10.0, enzyme live declines to a great extent, be only the highest enzyme live 25%; When pH value is down to 7.0, enzyme activity is about 82% of the highest vigor.Therefore proteolytic enzyme that this bacterial strain produces is low-temperature alkaline protease.Metallic ions Ca 2+activation is had, Mn to proteolytic enzyme that this bacterial strain produces 2+it is not affected substantially; Mg2+, Ba 2+, Fe 3+, Zn 2+, Co 2+, Zn 2+then there is certain restraining effect to it, Ni 2+the strongest to its restraining effect, concentration is the Ni of 1.0mmol/L 2+the enzyme of more than 90% can be suppressed to live, and therefore Histidine may be one of active centre of this enzyme; EDTA has certain restraining effect to this enzyme, and some metal ion may play an important role to the three-dimensional structure maintaining enzyme molecule; This enzyme is by DEPC, PMSF, EDAC strongly inhibited in addition, therefore this bacterial strain produce proteolytic enzyme avtive spot should comprise His, Ser and carboxyamino acid.Infer from above-mentioned analytical results, proteolytic enzyme that this bacterial strain produces should belong to serine protein hydrolase, and containing the catalytic active center be typically made up of His, Ser and Asp.
Three, produce low-temperature protease genetic characteristics illustrate: from the genome of this planococcus TCCC11813 bacterial strain, obtain a kind of cold induced proteins enzyme coding gene, the part expression regulation sequence of its mature polypeptide coding sequence, signal coding sequence and upstream of coding region is as shown in sequence 1; The sequencing results shows: this gene is novel protein enzyme coding gene, and the aminoacid sequence of its coding is compared with the protein sequence delivered in current database, and highest homology is only about 75%.From original strain, clone cold induced proteins enzyme coding gene by Protocols in Molecular Biology, and its practical function in specific host is expressed.
16srDNA sequencing primer:
16SrDNAF：5’-AGAGTTTGATCCTGGCTCAG-3’
16SrDNAR：5’-GGTTACCTTGTTACGACTT-3’
16srDNA sequencing result:
Through NCBIBlast comparison, this sequence (1451bp) is 99% with the 16SrDNA similarity of planococcus PlanococcusantarcticusDSM14505, and combining form characteristic sum physio-biochemical characteristics, are accredited as Planococcus.
Four, strain culturing behavioral illustrations: the cultivation of planococcus TCCC11813 bacterial strain of the present invention, preservation and rejuvenation method can refer to the operation of following method:
1, bacterial strain can adopt regular bevel to go down to posterity preservation, specifically by the planococcus TCCC11813 strain inoculation that the present invention relates on the slant medium of applicable thalli growth, cultivate 24h for 10 ~ 20 DEG C, 4 DEG C of cryopreservations, can preserve 3 months; Also Vacuum Freezing & Drying Technology can be utilized to be made as dry powder bacterium, and low temperature or normal temperature are preserved and can be reached more than 1 year; Also thalline can be made the glycerine pipe of 15 ~ 35 ﹪ simultaneously, and preserve more than 1 year in-80 DEG C.Conventional solid training
Foster based formulas is: peptone 5g, yeast extract paste 1g, agar 15g, and artificial seawater constant volume, to 1.0L, regulates pH to 7.5-8.0.
2, the rejuvenation of bacterial strain: low-temperature protease producing strains is coated after suitably diluting dull and stereotyped upper (the casein 20g of casein screening, agar 15g, artificial seawater constant volume is to 1L, regulate pH to 7.5-8.0), and cultivate 48h in 16 DEG C, determine that the low-temperature protease of bacterial strain produces ability according to the ratio (dH/dc) of proteolysis loop diameter dH and colony diameter dc, and the strong bacterial strain of picking protease-producing ability is as subsequent fermentation bacterial strain.
Planococcus TCCC11813 strain fermentation of the present invention produces the method for low-temperature protease
3, bacterial strain activation: identical with rejuvenation of spawn process.
4, ferment: bacterial classification is directly inoculated in fermention medium and ferments, or bacterial strain is first carried out liquid increment cultivation, then press the inoculum size (V/V) of 2 ﹪, be inoculated in fermention medium and ferment; Leavening temperature is 4-30 DEG C, pH is 6.0-9.0, and rotating speed is 150-250 rev/min, and fermentation period is 48-72h.As the C source of fermention medium, can widely use nutritional sources for microbial culture as glucose, sucrose, starch, wort, Semen Maydis powder, glycerine and other hydrolysis sugar etc., its consumption is different according to the kind in C source and the difference of culture condition; The N source of fermention medium also can widely use the N source for microbial culture, as: yeast extract paste, corn steep liquor, casein, peptone, gelatin, urea, ammonium salt, nitrate etc.N source preferred yeast cream in fermention medium of the present invention and casein.Add a small amount of product enzyme promotor (tensio-active agent as TWEEN Series) in addition and can increase proteinase production.
Five, the preparation method of low-temperature protease crude product
Low-temperature protease that this bacterial strain produces is secreted protein, is mainly present in fermented liquid supernatant.First adopt and filter or centrifugal method, from nutrient solution, obtain supernatant or filtrate, then adopt saltout, conventional desalination, lyophilize or spray-dired method obtain low-temperature protease crude product.
Six, following verification method and the associated verification result adopting the mode of specific embodiment that strain fermentation method of the present invention and Enzymatic characteristic are described.
Embodiment 1
The fermentation culture of low-temperature protease producing strains planococcus TCCC11813
By fermentation with bacterial strain inclined plane inoculating in 50mL (250mL triangular flask) 2216E liquid nutrient medium (peptone 5 grams, yeast extract paste 1 gram, high ferric phosphate 0.01 gram, 1000 milliliters, seawater, pH value 7.6-7.8), 20 DEG C, 200rpm concussion cultivate 24h,
(2) be seeded to 50mL (500mL triangular flask) fermention medium (peptone 5g with the volume ratio of 2% again, yeast extract paste 1g, seawater 1000mL, pH value 7.0-8.0), respectively at different temperatures (15 DEG C, 20 DEG C, 25 DEG C), 200r/min shaking culture 72h, timing sampling, measures enzyme and lives.
Result shows: the optimum growth temp of this bacterial strain is consistent with the suitableeest product enzyme temperature, is 20 DEG C about+5, and fermentation culture is about 48h can reach product enzyme peak, and yield of enzyme is about 280U/mL.
Embodiment 2
Low-temperature protease enzyme activity determination method
Get enzyme liquid (the Tris ﹒ HCl of 50mmol/L of 1mL through suitably dilution, pH8.0), 37 DEG C of insulation 2min, add the substrate of same temperature (with the Tris ﹒ HCl of 50mmol/L, the buffer of pH8.0 1.0% casein) 1mL, in 37 DEG C of reaction 10min, add 2mL10% trichoroacetic acid(TCA) termination reaction.Leave standstill centrifugal, get 1mL supernatant liquor, add 5mL0.4mol/LNa 2cO 3solution, 1mL forint phenol reagent, mixing, 40 DEG C of insulation 20min, measure absorbance A 680.With inactivator liquid reaction system for blank.
Enzyme unit definition alive is: every milliliter of enzyme liquid, and at 37 DEG C, under the condition of pH8.0, the enzyme amount required for per minute reaction generation 1 μ g tyrosine is 1 enzyme activity unit (U/mL)
Embodiment 3
The optimum temperuture of low-temperature protease
Respectively 1mL crude enzyme liquid and 1mL caseinhydrolysate solution (1%, pH8.0) are mixed, measure enzyme activity at 4 DEG C-50 DEG C respectively, for 100% time the highest with enzyme activity, calculate the enzyme activity under other conditions.
Result shows: this bacterial strain produce proteolytic enzyme the suitableeest catalytic temperature be about 37 DEG C, and between 25-37 DEG C, all there is good catalytic activity (more than 50% of the highest katalaze enzyme work), therefore, this bacterial strain the temperature of producing in the optimum temperature of proteolytic enzyme and physical environment basically identical, in use can save the process of heating and cooling, there is the apply properties such as energy-conserving and environment-protective.
Embodiment 4
The optimal pH of low-temperature protease
With Sodium.alpha.-hydroxypropionate damping fluid (pH2.0,3.0,4.0,5.0) phosphate buffered saline buffer (pH6.0,7.0,7.5, the 8.0) borate buffer solution (pH9.0,10.0) of different pH value, enzyme liquid to be measured is carried out suitable dilution, under 37 DEG C and corresponding pH condition, measure enzyme live, enzyme numerical value the maximum alive counts 100%, corresponding pH is enzyme optimal reaction pH to be measured, and the ratio of the value that the enzyme under other pH is alive and the highest enzyme is alive is its relative enzyme and lives.
Result shows: this enzyme all has catalysis activity within the scope of pH4.0-10.0pH, and its suitableeest action pH is about 8.0; When pH value rises to 9.0, its enzyme live be about the highest enzyme live about 70%, when pH value rises to 10.0, enzyme live declines to a great extent, be only the highest enzyme live 25%; When pH value is down to 7.0, enzyme activity is about 82% of the highest vigor.
Embodiment 5
The thermostability of low-temperature protease
Crude enzyme liquid is measured remnant enzyme activity after 10 DEG C, 37 DEG C, 45 DEG C insulations 30min, 60min, 90min, 120min, not carry out the enzyme activity value of isothermal holding in contrast, setting its enzyme activity is 100%, draws the curve that enzyme activity changes with soaking time.
Result shows: this bacterial strain to produce the thermostability of proteolytic enzyme lower, 37 DEG C of insulations 60min or 45 DEG C of insulation 20min, then enzyme is lived and is only remained 10%, 50 DEG C of original insulation 1min, then catalytic activity completely loses, and this proteolytic enzyme only could preserve the longer time below 10 DEG C; This characteristic is similar to most of low-temperature protease.
Embodiment 6
The impact that various inhibitor is lived on enzyme
Under low-temperature protease optimal reaction temperature and optimal ph condition, different inhibitor and different metal ion is added in enzymatic reaction system, measure low-temperature protease enzyme according to the proteinase activity measuring method in embodiment 2 to live, and with the enzyme activity of non-inhibiting or metal ion for 100%, calculate the remnant enzyme activity after adding chemical composition.
Result shows: metallic ions Ca 2+activation is had, Mn to proteolytic enzyme that this bacterial strain produces 2+it is not affected substantially; Mg2+, Ba 2+, Fe 3+, Zn 2+, Co 2+, Zn 2+then there is certain restraining effect to it, Ni 2+the strongest to its restraining effect, concentration is the Ni of 1.0mmol/L 2+the enzyme of more than 90% can be suppressed to live, and therefore Histidine may be one of active centre of this enzyme; EDTA has certain restraining effect to this enzyme, and some metal ion may play an important role to the three-dimensional structure maintaining enzyme molecule; This enzyme is by DEPC, PMSF, EDAC strongly inhibited in addition, therefore this bacterial strain produce proteolytic enzyme avtive spot should comprise His, Ser and carboxyamino acid.
Sequence of the present invention is as follows:
Sequence 1: low-temperature protease gene coding region and expression regulation district, upstream thereof
cagtggaagtgaatagccctgagcgccaggaattccagaagttatattcggcttatgaccagattgagcaggaatacttcgaggaagtggaacaggaagaattaatca atggtgccatcaatggc
Wherein: the base pair of double underline grey mark is respectively-35th district and-10th district of promotor; Wave underline grey base portion is ribosome bind site (RBS); In square frame, base portion is this low-temperature protease gene coding region.
The aminoacid sequence of sequence 2. low-temperature protease
megisssfegigaevqerngyvtvvspiknspaekagvlpndqilevdgesiqgfstteavmlirgekgtevtltiqrgenadpieitivrdeipietvyaemvndqvahinitsfsentydelqkaiaemeeqgmeaavldvrqnpggllntaldisnlfieegkemfevqakgeepevylatggdkldipvtllidggsasaseilagamsesadvtlvgektfgkgtvqtandlsdgsnlkfttakwltpdgnwiheegiepdevvpypeyaslpfldpsvelkdgsiseqvqtaekmldalgyevgeidgvfeeemeqavtefqeandleadgvltedttyavmdqlrekintedpqlqeatdilmeqaglateepadeeadtee。
Blocked portion is signal peptide sequence.

Claims (6)

1. a strain cold induced proteins enzyme-producing bacteria, it is characterized in that: described bacterial strain preservation date is on 08 29th, 2013, depositary institution is: China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number is: CGMCC No.8088, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Classification And Nomenclature is: planococcus Planococcus sp..
2. cold induced proteins enzyme-producing bacteria according to claim 1, is characterized in that: described bacterial strain can utilize glucose, fructose, starch as carbon source, and ammonium sulfate, peptone, caseinhydrolysate can be utilized as nitrogenous source; Have oxydase, catalase activity, gelatine liquefication experiment is positive, and is producing obvious transparent circle containing on caseic 4 ~ 20 DEG C of low temperature flat boards.
3. a low-temperature protease gene, is characterized in that: the part expression regulation sequence of its mature polypeptide coding sequence, signal coding sequence and upstream of coding region is as shown in sequence 1.
4. a low-temperature protease, is characterized in that: obtained by strain fermentation according to claim 1.
5. a low-temperature protease, is characterized in that: obtain via genetic expression according to claim 3.
6. produce a genetically engineered for low-temperature protease, it is characterized in that: containing low-temperature protease gene according to claim 3.
CN201510105290.0A 2015-03-10 2015-03-10 Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme Pending CN104818225A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510105290.0A CN104818225A (en) 2015-03-10 2015-03-10 Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510105290.0A CN104818225A (en) 2015-03-10 2015-03-10 Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme

Publications (1)

Publication Number Publication Date
CN104818225A true CN104818225A (en) 2015-08-05

Family

ID=53728706

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510105290.0A Pending CN104818225A (en) 2015-03-10 2015-03-10 Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme

Country Status (1)

Country Link
CN (1) CN104818225A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111019868A (en) * 2019-12-31 2020-04-17 浙江亿丰海洋生物制品有限公司 Thermophilic deep-sea micro bacillus and application thereof
CN111534451A (en) * 2020-01-13 2020-08-14 江苏大学 Planococcus fermentation agent for improving fermentation quality of low-salt fish gravy
CN111893067A (en) * 2020-08-05 2020-11-06 曲阜师范大学 Microbacterium siberia for producing low-temperature protease and application thereof
CN116179519A (en) * 2023-01-18 2023-05-30 天津科技大学 Pediococcus-derived proteases and uses thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101054242A (en) * 2007-04-05 2007-10-17 中国科学院微生物研究所 Application of planococcus psychrotoleratus in treating sewage at low temperature
CN101597615A (en) * 2009-07-10 2009-12-09 天津科技大学 Low-temperature alkaline protease gene, the engineering bacteria that contains this gene and construction process of the two and low-temperature alkaline protease
CN102277344A (en) * 2011-08-03 2011-12-14 天津科技大学 Low-temperature alkaline protease and preparation method thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101054242A (en) * 2007-04-05 2007-10-17 中国科学院微生物研究所 Application of planococcus psychrotoleratus in treating sewage at low temperature
CN101597615A (en) * 2009-07-10 2009-12-09 天津科技大学 Low-temperature alkaline protease gene, the engineering bacteria that contains this gene and construction process of the two and low-temperature alkaline protease
CN102277344A (en) * 2011-08-03 2011-12-14 天津科技大学 Low-temperature alkaline protease and preparation method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
NCBI: "Carboxyl-terminal protease [Planococcus halocryophilus]", 《NCBI REFERENCE SEQUENCE: WP_008497521.1》 *
NCBI: "peptidase S41 [Planococcus donghaensis]", 《NCBI REFERENCE SEQUENCE: WP_008431859.1》 *
杨祥胜: ""南极沉积物宏基因组文库构建及蛋白酶筛选和性质分析"", 《厦门大学博硕士论文摘要库》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111019868A (en) * 2019-12-31 2020-04-17 浙江亿丰海洋生物制品有限公司 Thermophilic deep-sea micro bacillus and application thereof
CN111019868B (en) * 2019-12-31 2021-10-01 浙江亿丰海洋生物制品有限公司 Thermophilic deep-sea micro bacillus and application thereof
CN111534451A (en) * 2020-01-13 2020-08-14 江苏大学 Planococcus fermentation agent for improving fermentation quality of low-salt fish gravy
CN111534451B (en) * 2020-01-13 2021-10-12 江苏大学 Planococcus fermentation agent for improving fermentation quality of low-salt fish gravy
CN111893067A (en) * 2020-08-05 2020-11-06 曲阜师范大学 Microbacterium siberia for producing low-temperature protease and application thereof
CN116179519A (en) * 2023-01-18 2023-05-30 天津科技大学 Pediococcus-derived proteases and uses thereof

Similar Documents

Publication Publication Date Title
CN102517235B (en) Bacillus subtilis
CN103451121B (en) Bacillus licheniformis and application thereof
CN104818225A (en) Low temperature protease production strain, low temperature protease produced by the same and gene of enzyme
Matpan Bekler et al. Isolation and production of thermostable α-amylase from thermophilic Anoxybacillus sp. KP1 from Diyadin hot spring in Ağri, Turkey
CN109439601A (en) One plant of method for producing the bacterial strain of protease and its preparing alkali protease
CN101333519B (en) Process for extracting bilesalt hydrolase and exopolysaccharide from lactococcus lactis and streptococcus thermophilus
CN103555594A (en) Aspergillus oryzae and application thereof
CN103829166A (en) Preparation method for fibrinolytic fermented soya beans
CN101603017B (en) Acinetobacter johnsonii LP28 and method for preparing low-temperature alkali lipase by using acinetobacter johnsonii
CN103614313B (en) A kind of bacterial strain and screening method thereof of producing high temperature resistant beta-galactosidase enzymes of fermenting
CN105255771A (en) Staphylococcus succinus for generating collagenase and application thereof
CN103740605B (en) Bacillus aquimaris and application thereof
CN100497593C (en) Low-temperature amylase strain, low-temperature amylase, and production therefor
CN103468612B (en) Halophilic Bacterium strain and by this bacterial strain produce addicted to salt esterase and application thereof
CN102120974A (en) Low-temperature alkaline proteinase marine bacteria strain, low-temperature alkaline proteinase and production method thereof
KOMAGATA et al. Characteristics of Erwinia herbicola
CN108192848B (en) Lactobacillus acidophilus strain for producing lactase and method for preparing low-temperature lactase by using same
CN102174439B (en) Marine halomonas for producing low-temperature beta-galactosidase and application thereof
CN101906391B (en) S.thermophilus grx90 for fermenting soya-bean milk products and application thereof
CN104988197A (en) Fermentation medium and cultivation method of starch hydrolysis bacilli HP60 for hydrolyzing rice residue protein
CN105969694A (en) Providencia for synthesizing ethanol-resistant urethanase and urease
CN101130757B (en) Low-temperature lipase mycopremna, low-temperature lipase and method of preparing the same
CN116286474B (en) Microbial strain for degrading hemicellulose at low temperature
CN107058168B (en) A kind of bacillus megaterium and its method and product for producing Pullulanase
CN104651283A (en) Bacillus cereus and applications thereof in production of aminopeptidase

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20150805

RJ01 Rejection of invention patent application after publication