CN104805204A - Kit and method for detecting real-time fluorescent PCR (Polymerase Chain Reaction) detection of thottapalayam virus - Google Patents
Kit and method for detecting real-time fluorescent PCR (Polymerase Chain Reaction) detection of thottapalayam virus Download PDFInfo
- Publication number
- CN104805204A CN104805204A CN201510202837.9A CN201510202837A CN104805204A CN 104805204 A CN104805204 A CN 104805204A CN 201510202837 A CN201510202837 A CN 201510202837A CN 104805204 A CN104805204 A CN 104805204A
- Authority
- CN
- China
- Prior art keywords
- virus
- seq
- detection
- probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a kit for detecting real-time fluorescent PCR (Polymerase Chain Reaction) of thottapalayam virus. The kit comprises primer pairs used for performing specificity detection on a section of area including a thottapalayam virus S gene and a probe, wherein the sequences of the primer pairs and the gene are shown as SEQ.ID.NO.1, SEQ.ID.NO.2 and SEQ.ID.NO.3; the 5' end of the probe is connected with a fluorescent group, and the 3' end of the probe is connected with a quenching group. The invention further provides a method for detecting the real-time fluorescent RT (Reverse Transcription)-PCR of the thottapalayam virus in a soricidae sample. According to the method disclosed by the invention, the rapid detection of the thottapalayam virus in a shrew animal is realized, the detection rate of a positive sample under lower viral load is improved, the problem of difficulty in judgment of a false negative sample is solved, primer degeneracy and sensitivity are better improved, the detection rate of a pathogen is improved, and meanwhile, the pollution risk is reduced to the lowest degree; therefore, the method is very suitable for large-scale pathogen screening.
Description
Technical field
The present invention relates to field of virus detection, the real-time fluorescent RT-PCR detection reagent box of the rope Tuo Palaya virus of carrying in Shrew Murinus section and detection method.
Background technology
Rope Tuo Palaya virus (Thottapalayam virus, TPMV) Hantavirus of bunyaviridae is belonged to, for the sub-thread minus-stranded rna virus having coating segmented, genome is made up of S, M, L tri-gene fragments, encoding nuclear proteins, G1 and G2 surface glycoprotein and RNA polymerase respectively, wherein S gene size is 1530nt, and nucleoprotein is 430aa; M gene size is 3621nt, and glycoprotein is 1122aa; L gene size is 6575nt, and RNA polymerase is 2150aa.This virus is found in 1964 by people such as Carey DE in the smelly Shrew Murinus of the Shrew Murinus section of the rope Tuo Palaya Area distribution of India, and first time finds that Hantaan virus can be carried by Insectivorous Animals.
Although rope Tuo Palaya virus belongs to Hantaan virus on taxonomy, but analyze and find, the Hantaan virus otherness be separated with rodent is comparatively large, and the nucleotide homology as rope Tuo Palaya virus S gene and hantaan virus is 47.9%, and the amino acid identity of coding is 47.1%; Be 40.8% with the nucleotide homology of Seroul virus, amino acid identity is 45.7%; Be 43.7% with the nucleotide homology of puumala virus, amino acid identity is 44.6%.Meanwhile, Phylogenetic analysis finds, rope Tuo Palaya virus is distant on evolutionary relationship with the virus be separated in rodent, adheres to two different evolution branches separately.According to the criteria for classification of Hantaan virus, determine that rope Tuo Palaya virus is for novel species.
In recent years, along with the further investigation to natural focus small mammal particularly Insectivora Shrew Murinus section, Hantaan virus novel species is detected in increasing species, as the Lianghe virus be separated in short-tail Shrew, isolated Yakeshi virus in the Shrew Murinus of northeast, Tanganya virus in Ghana musk deer Shrew, Imjin virus, CBNV etc. in honest musk deer Shrew.These viruses are very high with the homology of rope Tuo Palaya virus, from molecular evolution, the isolated virus of Shrew Murinus section is more close on evolutionary relationship, is jointly gathered on an independent clade, and comparatively large with the virus evolution difference be separated in rodent, point in two are evolved bunch.
At present, the Hantaan virus carried by rodent can infect people, puumala virus as popular in In Eurasia, Sa tire out agate virus, hantaan virus and Seroul virus and cause hemorrhagic fever with renal syndrome, and the sin nombre virus that North America is popular, Men Anpaijila virus and new youk virus cause Hantavirus pulmonary syndrome.Whether the Hantaan virus that Shrew Murinus section animal is carried infects people, does not temporarily also have corresponding case, but along with the expansion of people's activity space day by day, the probability of the virus infection people carried in Shrew Murinus section animal increases day by day, there is potential threat to the hygienic safety of people.Along with deepening continuously to Shrew Murinus section's pathogenic agent Molecule Epidemiology Investigation, rope Tuo Palaya viral species is on the increase, and quantity increases increasingly.Not yet there is a kind of up to now for the quick detection kit of the rope Tuo Palaya virus in Shrew Murinus section animal.
From existing data, the discovery of Hantaan virus mainly relies on cell separation technology, immunofluorescence technique and Nested PCR Technique to realize.Though cell separation technology is virological gold standard in real work, length consuming time in real work, particularly cannot play its feature in rapid detection at the scene; Immunofluorescence technique time and effort consuming, and there is certain false positive, be unfavorable for carrying out extensive pathogenic agent examination; The appearance of round pcr, not only increase the accuracy rate of detection and the goal gene that can increase, but apply Nested PCR Technique in the detection of Hantaan virus, this technique improves the specificity of goal gene amplification, but the method needs to carry out at least 2 PCR, there is the risk polluted.
In the last few years, also find that there is new detection technique constantly to occur, as the degeneracy RT-PCR detection method of Hantaan virus group, this method is mainly for other Hantaan virus of the different shaped of carrying in rodent, disposable Classification Identification can be realized, but the carrying capacity of the Hantaan virus of the overwhelming majority is all lower, especially in the sample, can not detect completely or cause undetected.Meanwhile, the sensitivity of the degeneracy of primer its amplification higher can reduce.
Summary of the invention
For the deficiencies in the prior art, an object of the present invention is to provide a kind of rope Tuo Palaya virus real-time fluorescence RT-PCR detection kit.
Another object of the present invention is to provide a kind of real-time fluorescent RT-PCR detection reagent box to rope Tuo Palaya virus in Shrew Murinus section sample.
Another object of the present invention is to provide rope Tuo Palaya virus real-time fluorescence RT-PCR detection method.
For achieving the above object, the present invention is by the following technical solutions:
A kind of rope Tuo Palaya virus real-time fluorescence RT-PCR detection kit, this test kit comprises and carries out specific detection primer pair used and probe to one section of region of rope Tuo Palaya virus S gene, shown in the following SEQ ID No.1 of sequence of described primer pair and probe, SEQ ID No.2 and SEQ ID No.3, described probe 5 ＇ holds and connects fluorophor, and 3 ＇ ends connect quenching group.
Described fluorophor is any one in FAM, CY3, HEX, VIC, and described quenching group is any one in BHQ1, TAMARA, BHQ2.
Detection kit as above, preferably, also comprises: 2 × RT-PCR damping fluid, the Radioactive colloidal gold of the 0.01nmol/L of 10nm; 25 × RT-PCR enzyme Mix.
Detection kit as above, preferably, also comprises positive control, and described positive control is for containing, for example sequence shown in SEQ ID No.7.
A kind of real-time fluorescent RT-PCR detection reagent box to rope Tuo Palaya virus in Shrew Murinus section sample, preferably, except mentioned reagent, also comprise the inner quality control of the cytochrome b gene to Shrew Murinus section animal, described inner quality control comprises upper and lower primer and probe, and the nucleotide sequence of described upper and lower primer and probe is as shown in SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6.
Detect a detection method to the real-time fluorescence RT-PCR of rope Tuo Palaya virus in Shrew Murinus section sample, the method comprises the following steps:
(1) from sample, RNA is extracted;
(2) real-time fluorescence RT-PCR amplification is carried out to the RNA that step (1) is extracted; Wherein, during RT-PCR amplification, reaction system comprises: the upstream and downstream primer and the probe that detect rope Tuo Palaya virus and inner quality control, the nucleotide sequence of the upstream and downstream primer of described detection rope Tuo Palaya virus is as shown in SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of described detection rope Tuo Palaya Viral Probe is as shown in SEQ ID No.3; The nucleotide sequence of the upstream and downstream primer of described inner quality control as shown in SEQ ID No.4 and SEQ ID No.5, the nucleotide sequence of probe as shown in SEQ ID No.6, sample RNA;
(3) collect fluorescent signal, select the fluoroscopic examination pattern of above-mentioned fluorophor, baseline adjustment gets the fluorescent signal of 3 ~ 15 circulations, with the vertex setting threshold line of threshold line just above normal negative control;
(4) result judges: testing sample fluorescence growth curve exceedes threshold line, and presents good logarithm growth, be then judged as the positive, as without typical amplification curve, be judged as feminine gender.
Detection method as above, preferably, 5 ＇ ends of described detection rope Tuo Palaya Viral Probe connect FAM fluorophor and are connected BHQ1 quencher with 3 ＇ ends; 5 ＇ ends of described inner quality control probe connect VIC fluorophor and are connected TAMARA quenching group with 3 ＇ ends.
Detection method as above, preferably, also includes in described reaction system: the Radioactive colloidal gold of the 0.01nmol/L of 10nm, 1 × RT-PCR damping fluid; 1 × RT-PCR enzyme Mix.
Detection method as above, preferably, the reaction conditions of described real-time fluorescence RT-PCR amplification is: 45 DEG C, reverse transcription 30min; 95 DEG C, denaturation 10min; Pre-amplification phase: 95 DEG C, sex change 10sec, 50 DEG C, annealing 15sec, extends 15sec, carries out 5 circulations altogether by 72 DEG C; The amplification stage: 95 DEG C, 10sec, 55 DEG C, 40sec, and fluorescent signal is gathered 55 DEG C time, carry out 40 circulations altogether.
Detection method as above, preferably, also comprises the detection to positive control in described detection method, the nucleotide sequence of described positive control is as shown in SEQ ID No.7.
The invention provides a kind of real-time fluorescent RT-PCR detection reagent box of rope Tuo Palaya virus.This test kit detects based on real-time fluorescence quantitative RT-PCR, devise pair of primers and probe carries out real-time qualitative detection by quantitative for rope Tuo Palaya virus in Shrew Murinus section sample, further, in order to reduce the false-negative detection probability of sample, devise in test kit a set of can specificity identification Shrew Murinus section animal internal contrast reaction.This reaction can extract the examination criteria of success or failure in reality detects as sample rna, also can be used as the foundation that sample feminine gender judges.A kind ofly can to realize in Shrew Murinus section animal rope Tuo Palaya virus rapid detection to the real-time fluorescent RT-PCR detection reagent box of rope Tuo Palaya virus in Shrew Murinus section sample, improve the recall rate of positive sample under lower virus load, solve the problem of the judgement difficulty of false negative sample.This test kit is only for the detection of carrying rope Tuo Palaya virus in Shrew Murinus section animal, and its specificity is good, highly sensitive.
Real-time fluorescence RT-PCR to rope Tuo Palaya virus in Shrew Murinus section sample provided by the invention detects detection method, greatly accelerate the speed detecting pathogenic agent, shorten detection time, and well improve the problem of primer degeneracy and sensitivity, improve the recall rate of pathogenic agent, 30min can be realized the soonest and obtain experimental result, Pollution risk is reduced to minimum simultaneously, be very applicable to extensive pathogenic agent examination.
Accompanying drawing explanation
Fig. 1 is the homology region schematic diagram in the rope Tuo Palaya virus S full length gene sequence for being separated in Shrew Murinus section animal.
Fig. 2 is the conservative section schematic diagram of the cytochrome b gene for Shrew Murinus section animal.
Fig. 3 is the typical curve that test kit of the present invention detects rope Tuo Palaya virus real-time fluorescence RT-PCR.
Fig. 4 is test kit detection specificity result of the present invention.
Embodiment
The invention provides a kind of acquisition and detect the primer of rope Tuo Palaya virus and the method for probe, the method comprises: (1) selects the S full length gene sequence of the rope Tuo Palaya virus of Shrew Murinus section middle acquisition not of the same race, carry out sequence analysis, at its conserved regions design primer; (2) according to the nucleotide sequence design specificity degeneracy probe in pcr amplification region, and specificity and the degeneracy of GENEBANK detection probes is submitted to; (3) real-time quantitative analysis is carried out to thing to be detected; (4) select the cytb gene order of the Shrew Murinus section animal of announcing in Genebank, further sequence analysis, and design a pair specific primed probe combination.(5) above-mentioned reaction is carried out be optimized design to main reaction liquid in reaction system.
Below in conjunction with specific examples, the present invention is described in further details; not limitation of the invention; embodiments of the present invention are not limited to this; the complementary sequence of nucleotide sequence provided by the invention also can realize the present invention; if no special instructions; agents useful for same is conventional reagent, and therefore all equivalent replacements according to this area done by present disclosure, all belong to protection scope of the present invention.
Embodiment 1 detects the primer of rope Tuo Palaya virus and the design of probe
The rope Tuo Palaya virus that the present invention screens is all rope Tuo Palaya virus S full length gene sequences be separated from Shrew Murinus section animal that NCBI announces.LASEGENE software is utilized to carry out the sequence analysis of sequence.S gene order high conserved region comparison result is shown in Fig. 1.
In primer of the present invention and probe design, first at the sequence conservation of comparison design upstream and downstream primer, according to design of primers principle, utilize Beacon Designer 7.7 software at conserved regions design primed probe, upstream and downstream primer is designed between conserved regions, wherein there is degeneracy at the 17th, 20 of upstream primer TPS2-F, the 24th of downstream primer TPS2-R exists degeneracy, design is positioned at the special probe of amplification region, wherein there is degeneracy respectively at the 22nd, 23 and 25 of probe TPS2-P.Primer and probe are when synthesizing, and probe 5 ＇ holds connection fluorophor to be connected quencher with 3 ＇ ends.Described fluorophor is any one in FAM, CY3, HEX, VIC, and described quenching group is any one in BHQ1, TAMARA, BHQ2, and preferably, probe 5 ＇ holds connection FAM fluorophor to be connected BHQ1 quencher with 3 ＇ ends.The specificity of primer strengthens, and the sequence information of synthesis is in table 1, and sequential parameter is in table 2.
Table 1 increases the primer of rope Tuo Palaya virus and probe sequence
Table 2 increases the primer of rope Tuo Palaya virus and probe parameter information
The design of embodiment 2 inner quality control
The representational Shrew Murinus section animal selecting NCBI to announce, comprising: America mole (Scalopusaquaticu), North America Shrew mole (Neurotrichus gibbsii), Europe mole (Talpa europaea), Japan Shrew mole (Urotrichus talpoides), Sichuan short-tail Shrew (Anourosorex squamipes), North America Shrew mole (Neurotrichus gibbsii), Europe mole (Talpa europaea), Japan Shrew mole (Urotrichus talpoides), large musk deer Shrew (Crocidura lasiura) northern crocidura suaveoleris Shandong subspecies (Crocidura shantungensis), smelly Murinus Shrew (Suncus murinus), black dull Shrew Murinus (Sorexmonticolus), line back of the body Shrew Murinus (Sorex cylindricauda), Shrew Murinus (Sorex araneus), Altay Shrew Murinus (Sorex roboratus), northeast Shrew Murinus (Sorex isodon), marsh Wu (Sorexpalustris), whether the cytochrome b gene in the chondriogen of middle Shrew Murinus (Sorex caecutiens), as the inner quality control of test kit, successfully extract for the RNA controlling detected sample.The intact cell pigment b gene of LASEGENE software to above-mentioned Shrew Murinus section animal can be utilized in the present invention to carry out sequence analysis and find more conservative section, comparison result is shown in accompanying drawing 2.
In the present invention, select the more conservative section of the cytochrome b gene of above-mentioned cited Shrew Murinus section animal, according to design of primers principle, utilize Beacon Designer 7.7 software at conserved regions design primed probe, design upstream and downstream primer between conserved regions, primer CY-F/R and XCY-P does not all have degeneracy base.Primer and probe are when synthesizing, probe 5 ＇ holds and connects fluorophor, 3 ＇ ends connect quenching group, fluorophor is any one in FAM, CY3, HEX, VIC, described quenching group is any one in BHQ1, TAMARA, BHQ2, preferably, probe 5 ＇ holds connection VIC fluorophor to be connected TAMARA quenching group with 3 ＇ ends.The specificity of primer strengthens, and the sequence information of synthesis is in table 3, and detailed parameter information is in table 4.
The primer probe sequence information of table 3 inner quality control
The primer of table 4 inner quality control and probe parameter information
The reaction system proportioning of embodiment 3 detection kit
(1) the system proportioning of real-time fluorescence RT-PCR main reaction liquid in test kit:
Real-time fluorescence RT-PCR main reaction liquid (Master Mix Reaction Buffer, MMRB) following composition is comprised in: Radioactive colloidal gold 0.5 μ L, TPS2-F (25 μMs) of the 0.01nmol/L of 2 × RT-PCR damping fluid 12.5 μ L, nuclease free water 4.3 μ L, increased response agent 10nm 0.2 μ L, TPS2-R (25 μMs) 0.2 μ L, TPS2-P (10 μMs) 0.5 μ L, CY-F (20 μMs) 0.2 μ L, CY-R (20 μMs) 0.2 μ L, CY-P (10 μMs) 0.4 μ L.
Present invention employs the Radioactive colloidal gold of the 0.01nmol/L of increased response agent 10nm, can the non-specific band of suppression PCR amplification system produce, and this optimization ability in very wide temperature range effectively, can improve positive rate simultaneously.
Real-time fluorescence RT-PCR reaction system in test kit:
MMRB is 19 μ L, 25 × RT-PCR enzyme Mix 1 μ L, and detecting sample rna is 5 μ L.
(2) real-time fluorescence RT-PCR amplification condition in test kit:
45 DEG C of reverse transcription 30min;
95 DEG C of deactivations and denaturation 10min;
Pre-amplification phase:
Sense channel is two channels, and selection FAM is reporter group, and selection none is quenching group, as the fluorescent signal passage detecting virus; Selection VIC is reporter group, and selection TAMARA is quenching group, as the fluorescent signal passage of inner quality control; Selection ROX is reference fluorescent.
In method of the present invention, probe is connected with fluorophor, and wherein the fluorophor of TPS2-P mark is FAM-BHQ1, the fluorescent probe of CY-P mark is VIC-TAMARA, other fluorophor is suitable for too, such as, and CY3-BHQ, TEXXASRED-TAMARA etc.
Described RT-PCR reaction must select the real-time fluorescence RT-PCR instrument with reference fluorescent signal passage to comprise ABI real-time PCR system (such as 7000,7300,7500,7900 and Viia7 etc.); BioRad Real Time PCR Detection System, Stratagene quantitative polumerase chain reaction instrument (such as MX4000, MX3000, MX3005) etc.
Embodiment 4 primer sensitivity technique
High conserved region fragment in the S gene of rope Tuo Palaya virus is selected as standard substance, its concentration to be diluted to 10 successively from 10-3
-12;
1) RNA of NTC: Shrew Murinus section animal;
2) PTC: the RNA that the S gene fragment of the virus of synthetic is transcribed; Its nucleotide sequence is as SEQID NO:7, and (5 '-3 ') is specially:
TCATCATTTTACCAGTCTTATGTTAGAAGGACACAATCAATGGGTGTGAACTGTGACCAAAAAATTATACATATTTTTATGGATTACTTGGGTTCATACTGTGTTGACCACTTCAACCTCGGTGATGACATGGATCCAGAGCTTAAGGCTAAAGCTCAGGCATTACTTGAGAAAAAAGTGAAAGAGATATCAAGCCAGGAACCTATTAAATTGTAACCTGGTAAAATAGCTAACCTTGTA
3) reaction system is prepared according to the system of the embodiment of the present invention 3.
4) reaction conditions is that test kit condition in the embodiment of the present invention 3 is carried out:
Detected result is in table 5, and the minimum detectability of test kit to above-mentioned positive criteria product is 10 as can be drawn from Table 5
-9, TPMV is at extent of dilution 10 simultaneously
-9time copy number be 6.7copies/ μ L, visible, the detection sensitivity of test kit of the present invention to rope Tuo Palaya virus is 6.7copies/ μ L.
Wherein positive control detects the setting of (PTC), judge whether seminal plasma fructose detection kit lost efficacy or reacted the whether correct a kind of verification method of amplification condition, if positive control can detect, illustrate reagent in test kit and amplification condition all no problem, detected result accurately and reliably, if the detected result of positive control is negative, illustrates that this detected result is insincere, should detection be re-started.
Table 5 primer sensitivity technique result
Embodiment 5 test kit is to the making of the real-time fluorescence PCR typical curve of Viral diagnosis
Select rope Tuo Palaya virus as standard substance, by its concentration from being diluted to 10 successively
-12, select 10
-4~ 10
-10as template, with the Ct value of real-time fluorescence RT-PCR amplification for Y-axis, with the extent of dilution of-Lg for X-coordinate production standard curve.As shown in Figure 3, the typical curve of real-time fluorescence PCR is result: y=-2.8729x+49.971, R
2=0.9981.By this typical curve, the content of rope Tuo Palaya virus in measuring samples can be obtained.
Embodiment 6 specificity and non-specific test
Hantaan virus (HTNV), Seroul virus (SEOV) and puumala virus (PUUV) virus that the TPMV carried in selection Shrew Murinus section and Muridae are carried, the specific amplification situation of examination test kit; Detected result is as Fig. 4, test kit of the present invention can detect the TPMV carried in Shrew Murinus section specifically, and HTNV, SEOV and PUUV of carrying in Muridae can not be detected, test kit of the present invention can not increase for the Animal genome of host Shrew Murinus section simultaneously, this illustrates test kit of the present invention only for the rope Tuo Palaya virus that the animal of Shrew Murinus section is carried, specificity is good, simultaneously and there is not the phenomenon of non-specific amplification between host genome.
Embodiment 7 test kit of the present invention is to the detection of rope Tuo Palaya virus in unknown Shrew Murinus section sample
1) the test Shrew Murinus section animal lung sample gathered is detected, investigate the detectivity of test kit reality;
2) detect collection 2011-2013 years 104 parts of Shrew Murinus section animal lung samples, the reliability of investigation method, selects common RT-PCR to contrast simultaneously.
3) prepare reaction system and reaction conditions to carry out according to the method for embodiment in the present invention 3 and condition.
Interpretation of result:
Utilize the lung sample 104 parts gathering Shrew Murinus section animal, carry out RNA extraction, the latter, as template, joins in test kit of the present invention, utilizes conventional RT-PCR method to carry out in contrast simultaneously, carries out simultaneously.
Result shows in 104 parts of experiment lung samples has 8 increments originally to have obvious typical amplification curve, and Ct value is all in the scope of positive interpretation, and detected result is in table 6.Remaining 96 increments originally all have amplification curve at VIC passage simultaneously, do not have detection curve at FAM passage, can be judged to be that rope Tuo Palaya is viral and negative; And utilize conventional RT-PCR method to carry out amplification to only have 5 increments to be originally shown as amplified band.
Can find out that the verification and measurement ratio of common RT-PCR to rope Tuo Palaya virus is lower from experimental result, easily cause the undetected situation in rope Tuo Palaya virus monitor.
Table 6 unknown sample positive test symbol
Claims (10)
1. a rope Tuo Palaya virus real-time fluorescence RT-PCR detection kit, it is characterized in that, this test kit comprises and carries out specific detection primer pair used and probe to one section of region of rope Tuo Palaya virus S gene, shown in the following SEQ ID No.1 of sequence of described primer pair and probe, SEQ IDNo.2 and SEQ ID No.3, described probe 5 ＇ holds and connects fluorophor, and 3 ＇ ends connect quenching group.
2. detection kit as claimed in claim 1, it is characterized in that, described fluorophor is any one in FAM, CY3, HEX, VIC, and described quenching group is any one in BHQ1, TAMARA, BHQ2.
3. detection kit as claimed in claim 1, it is characterized in that, this test kit also comprises: 2 × RT-PCR damping fluid, the Radioactive colloidal gold of the 0.01nmol/L of 10nm; 25 × RT-PCR enzymeMix.
4. detection kit as claimed in claim 1, it is characterized in that, this test kit also comprises positive control, and described positive control is for containing, for example sequence shown in SEQ ID No.7.
5. the real-time fluorescent RT-PCR detection reagent box to rope Tuo Palaya virus in Shrew Murinus section sample, it is characterized in that, the reagent comprising arbitrary described test kit in claim 1-4 and the inner quality control that the cytochrome b gene of Shrew Murinus section animal is detected, described inner quality control comprises upper and lower primer and probe, and the nucleotide sequence of described upper and lower primer and probe is as shown in SEQ ID No.4, SEQ IDNo.5 and SEQ ID No.6.
6. detect a detection method to the real-time fluorescence RT-PCR of rope Tuo Palaya virus in Shrew Murinus section sample, the method comprises the following steps:
(1) from sample, RNA is extracted;
(2) real-time fluorescence RT-PCR amplification is carried out to the RNA that step (1) is extracted; Wherein, during RT-PCR amplification, reaction system comprises: the upstream and downstream primer and the probe that detect rope Tuo Palaya virus and inner quality control, the nucleotide sequence of the upstream and downstream primer of described detection rope Tuo Palaya virus is as shown in SEQ ID No.1 and SEQ ID No.2, and the nucleotide sequence of described detection rope Tuo Palaya Viral Probe is as shown in SEQ ID No.3; The nucleotide sequence of the upstream and downstream primer of described inner quality control as shown in SEQ ID No.4 and SEQ ID No.5, the nucleotide sequence of probe as shown in SEQ ID No.6, sample RNA;
(3) collect fluorescent signal, select the fluoroscopic examination pattern of above-mentioned fluorophor, baseline adjustment gets the fluorescent signal of 3 ~ 15 circulations, with the vertex setting threshold line of threshold line just above normal negative control;
(4) result judges: testing sample fluorescence growth curve exceedes threshold line, and presents good logarithm growth, be then judged as the positive, as without typical amplification curve, be judged as feminine gender.
7. detection method as claimed in claim 6, is characterized in that, 5 ＇ ends of described detection rope Tuo Palaya Viral Probe connect FAM fluorophor and are connected BHQ1 quencher with 3 ＇ ends; 5 ＇ ends of described inner quality control probe connect VIC fluorophor and are connected TAMARA quenching group with 3 ＇ ends.
8. detection method as claimed in claim 6, is characterized in that, also include in described reaction system: the Radioactive colloidal gold of the 0.01nmol/L of 10nm, 1 × RT-PCR damping fluid; 1 × RT-PCR enzymeMix.
9. detection method as claimed in claim 6, is characterized in that, the reaction conditions of described real-time fluorescence RT-PCR amplification is: 45 DEG C, reverse transcription 30min; 95 DEG C, denaturation 10min; Pre-amplification phase: 95 DEG C, sex change 10sec, 50 DEG C, annealing 15sec, extends 15sec, carries out 5 circulations altogether by 72 DEG C; The amplification stage: 95 DEG C, 10sec, 55 DEG C, 40sec, and fluorescent signal is gathered 55 DEG C time, carry out 40 circulations altogether.
10. detection method as claimed in claim 6, it is characterized in that, also comprise the detection to positive control in described detection method, the nucleotide sequence of described positive control is as shown in SEQ ID No.7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510202837.9A CN104805204B (en) | 2015-01-20 | 2015-04-24 | The real-time fluorescence PCR assay kit and detection method of rope Tuo Palaya viruses |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2015100293079 | 2015-01-20 | ||
| CN201510029307 | 2015-01-20 | ||
| CN201510202837.9A CN104805204B (en) | 2015-01-20 | 2015-04-24 | The real-time fluorescence PCR assay kit and detection method of rope Tuo Palaya viruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104805204A true CN104805204A (en) | 2015-07-29 |
| CN104805204B CN104805204B (en) | 2017-08-25 |
Family
ID=53690398
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510202837.9A Active CN104805204B (en) | 2015-01-20 | 2015-04-24 | The real-time fluorescence PCR assay kit and detection method of rope Tuo Palaya viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104805204B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113801962A (en) * | 2021-09-16 | 2021-12-17 | 浙江省农业科学院 | Real-time fluorescent quantitative PCR primer probe set, kit and detection method for detecting African swine fever virus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102382907A (en) * | 2011-11-10 | 2012-03-21 | 中华人民共和国大榭出入境检验检疫局 | Degenerate reverse transcription-polymerase chain reaction (RT-PCR) detection reagent and kit for hantavirus group |
| CN102409109A (en) * | 2011-11-25 | 2012-04-11 | 浙江省疾病预防控制中心 | Novel orthobunyavirus fluorescence quantitative detection kit and detection method of virus |
| CN102634609A (en) * | 2012-04-28 | 2012-08-15 | 中国人民解放军第四军医大学 | Method for quantitatively detecting hantaan virus load through one-step fluorescence probe real-time quantitative reverse transcription polymerase chain reaction |
| CN103484566A (en) * | 2013-09-11 | 2014-01-01 | 浙江省医学科学院 | Primer, kit and method for conducting genetic typing on hantavirus by means of PCR direct sequencing method |
-
2015
- 2015-04-24 CN CN201510202837.9A patent/CN104805204B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102382907A (en) * | 2011-11-10 | 2012-03-21 | 中华人民共和国大榭出入境检验检疫局 | Degenerate reverse transcription-polymerase chain reaction (RT-PCR) detection reagent and kit for hantavirus group |
| CN102409109A (en) * | 2011-11-25 | 2012-04-11 | 浙江省疾病预防控制中心 | Novel orthobunyavirus fluorescence quantitative detection kit and detection method of virus |
| CN102634609A (en) * | 2012-04-28 | 2012-08-15 | 中国人民解放军第四军医大学 | Method for quantitatively detecting hantaan virus load through one-step fluorescence probe real-time quantitative reverse transcription polymerase chain reaction |
| CN103484566A (en) * | 2013-09-11 | 2014-01-01 | 浙江省医学科学院 | Primer, kit and method for conducting genetic typing on hantavirus by means of PCR direct sequencing method |
Non-Patent Citations (2)
| Title |
|---|
| MEGUMI OKUMURA ET AL: "Development of Serological Assays for Thottapalayam Virus, an Insectivore-Borne Hantavirus", 《CLINICAL AND VACCINE IMMUNOLOGY》 * |
| 陈阳等: "汉坦病毒及其相关疾病", 《海峡预防医学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113801962A (en) * | 2021-09-16 | 2021-12-17 | 浙江省农业科学院 | Real-time fluorescent quantitative PCR primer probe set, kit and detection method for detecting African swine fever virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104805204B (en) | 2017-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| Hosmillo et al. | Development of universal SYBR Green real-time RT-PCR for the rapid detection and quantitation of bovine and porcine toroviruses | |
| CN103642945B (en) | A kind of highly sensitive Epstein-Barr FLuorescent quantitative PCR kit containing internal reference | |
| CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
| CN102634604B (en) | Reagent kit for detecting new Bunyavirus by real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN103627816B (en) | A kind of multiple RT-PCR detection kit of porcine reproductive and respiratory syndrome virus and application thereof | |
| CN110735006A (en) | African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit | |
| CN105002298B (en) | A kind of fluorescent quantitative PCR detection method of huichun viremia virus | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| CN103725793A (en) | Multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and application thereof | |
| CN106636454A (en) | Real-time fluorescence multi-RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for simultaneously detecting human coronaviruses 229E, OC43, NL63 and HKU1 | |
| CN102433392B (en) | Primers and probe for detecting fragment S of rift valley fever virus | |
| CN107338328B (en) | Method for quantitatively detecting GII norovirus in fruits and vegetables by one-step droplet digital PCR (polymerase chain reaction) | |
| CN102071247B (en) | Detection method for distinguishing non-pneumophilia legionella and legionella pneumophilia and kit | |
| CN106119421B (en) | QYYZ plants of pig blue-ear disease of fluorogenic quantitative detection primer, probe and kit | |
| CN103103287B (en) | Multigene-based influenza C virus real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection reagent | |
| CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
| CN107937610A (en) | For differentiating the triple real-time fluorescence PCR primers of highly pathogenic H7N9 influenza viruses and probe | |
| CN104805204A (en) | Kit and method for detecting real-time fluorescent PCR (Polymerase Chain Reaction) detection of thottapalayam virus | |
| CN102154523B (en) | Primer for detecting human BK viral nucleic acid, fluorescent probe and application thereof | |
| CN112662811A (en) | Novel coronavirus 4 gene segment multiplex nucleic acid detection kit and application thereof | |
| CN109576394A (en) | It is a kind of detect Nebovirus SYBR Green fluorescence quantitative RT-PCR primer and application | |
| CN105132418A (en) | Duplex fluorescent quantitative RT-PCR detection method for mouse encephalomyelitis viruses and rat Taylor viruses, and kit of detection method | |
| CN105002299B (en) | Detect specific primer, probe and the kit of Echovirus30 viruses | |
| CN109609699A (en) | A kind of kit for HSV-2 detection of nucleic acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |