CN104805184B - A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability - Google Patents

A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability Download PDF

Info

Publication number
CN104805184B
CN104805184B CN201510148635.0A CN201510148635A CN104805184B CN 104805184 B CN104805184 B CN 104805184B CN 201510148635 A CN201510148635 A CN 201510148635A CN 104805184 B CN104805184 B CN 104805184B
Authority
CN
China
Prior art keywords
hybrid strain
genotype
measured
rice varieties
hybrid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510148635.0A
Other languages
Chinese (zh)
Other versions
CN104805184A (en
Inventor
彭海
张静
陈红
方治伟
冯涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agriculture Ministry Technology Development Center
Jianghan University
Original Assignee
Agriculture Ministry Technology Development Center
Jianghan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agriculture Ministry Technology Development Center, Jianghan University filed Critical Agriculture Ministry Technology Development Center
Priority to CN201510148635.0A priority Critical patent/CN104805184B/en
Publication of CN104805184A publication Critical patent/CN104805184A/en
Application granted granted Critical
Publication of CN104805184B publication Critical patent/CN104805184B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of method of specificity for testing pure lines new rice variety, uniformity and stability, specifically include：Obtain variant sites；Determine the test zone of rice varieties to be measured；Build database；After determining amount of sampling, random sampling mixes and extracts the DNA of mixing sample；Prepare primer；Expanded using the DNA of primer pair mixing sample, amplified production is used to build high-throughput sequencing library；High-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced；Analysis sequencing fragment group, obtains rice varieties genotype and hybrid strain genotype to be measured；Compare and obtain approximate kind, variant sites and variant sites rate；By hybrid strain genotype compared with the genotype in database, after obtaining hybrid strain kind, hybrid strain rate is calculated；Using variant sites, variant sites rate and hybrid strain rate, rice varieties specificity, uniformity and stability to be measured are judged.This method can accurately, intactly judge the specificity, stability and uniformity of rice varieties to be measured.

Description

A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability
Technical field
The present invention relates to biological technical field, more particularly to a kind of specificity, uniformity for testing pure lines new rice variety With the method for stability.
Background technology
As a kind of intellectual property of specialization, new variety of plant has become a company and competing to a national core Strive power.The solution that new variety of plant authorizes account and relative legal problems is tested dependent on DUS, i.e. the specificity to rice varieties to be measured (Distinctness), the field trapping test or molecules inside of uniformity (Uniformity) and stability (Stability) Marker Identification.Field trapping test flow is：Rice varieties to be measured and approximate kind are planted in field simultaneously, in 2 years and more than The season of growth in, observe their multiple characters, difference of the rice varieties to be measured with approximate kind judged according to trait expression Conspicuousness, i.e., it is specific, while judge hybrid strain ratio in colony, i.e. uniformity and stability；The stream of molecules inside Marker Identification Cheng Wei：Individual plant is divided to extract DNA of the rice varieties to be measured with each sample in approximate kind, and each survey to each sample respectively Performing PCR (Polymerase Chain Reaction, polymerase chain reaction) is entered in examination region, and carries out electrophoresis to each PCR primer Or generation sequencing detection, according to testing result, the difference site ratio of rice varieties to be measured and approximate kind is obtained, according to difference Site ratio, judge the specificity of rice varieties to be measured.
The shortcomings that field trapping test is：Cycle is long, workload is big, environmental impact shape, causes to judge inaccuracy.It is indoor The shortcomings that molecular markers for identification is：Need to handle each test zone of each sample respectively, workload is big, it is impossible to sample with Test zone bulk sampling, hybrid strain rate can not be calculated, thus the test of stability and uniformity can not be carried out.Field trapping test Common drawback with molecules inside Marker Identification is：Due to workload, can not from existing kind objective selection it is near Like kind, applicant can only be weighed by kind and provided, and the approximate kind provided based on the motivations such as commercial interest, kind power applicant May be untrue, so as to cause the legal consequence of wrong kind mandate.
The content of the invention
In order to solve the problems of the prior art, the embodiments of the invention provide a kind of spy for testing pure lines new rice variety The method of the opposite sex, uniformity and stability.The technical scheme is as follows：
The embodiments of the invention provide the side of a kind of specificity for testing pure lines new rice variety, uniformity and stability Method, methods described include：
Obtain the variant sites between different rice varieties；
The test zone of rice varieties to be measured is determined by the variant sites, the test zone includes universal test area Domain, at least partly described variant sites are included in the universal test region；
Structure includes database of the rice varieties to be measured in the genotype of all test zones；
After the amount of sampling SN for determining the rice varieties to be measured, random sampling mixes and extracts the DNA of mixing sample；
The primer for expanding the test zone is prepared, the primer includes universal test region primer；
Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, institute Amplified production is stated to be used to build high-throughput sequencing library；
High-flux sequence is carried out to the high-throughput sequencing library, obtains that fragment group is sequenced；
The sequencing fragment group is analyzed, obtains rice varieties genotype and hybrid strain genotype to be measured；
By the rice varieties genotype to be measured compared with the genotype of the different cultivars in the database, obtain Approximate kind, variant sites and the variant sites rate of the rice varieties to be measured；
By the hybrid strain genotype compared with the genotype of the different cultivars in the database, hybrid strain kind is obtained Afterwards, hybrid strain rate is calculated；
Using the variant sites, the variant sites rate and the hybrid strain rate, judge that the rice varieties to be measured are special Property, uniformity and stability.
Specifically, the amount of sampling SN meets following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV is the function in excel 2010, and M is described to take out to judge threshold value selected when the uniformity and stability Sample amount SN formula implication is：Even if 15% of judgment threshold M when the hybrid strain rate only exceeds uniformity and stability, it is described Amount of sampling can correctly judge the stability and uniformity of the rice varieties to be measured in the case where 95% probability ensures.
Specifically, the depth CF of the high-flux sequence meets following condition：BINOM.DIST(10,10,BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BINOM.DIST (10000, 10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, CF is The depth of the high-flux sequence, to judge threshold value selected when the uniformity and stability, BINOM.DIST is M Function in excel 2010, the implication of the depth CF of high-flux sequence formula are：In the hybrid strain rate as little as 0.1%th, the hybrid strain kind averagely only has 20 difference positions between 10 and the hybrid strain kind and the rice varieties to be measured Under conditions of point, probability >=99.9% of the whole hybrid strain kinds of detection determined by the depth CF of the high-flux sequence； Averagely only have 20 differences between 10000 and the hybrid strain kind and the rice varieties to be measured in the kind of the database Under conditions of site, probability≤0.1% of the hybrid strain kind is judged in the presence determined by the depth CF of the high-flux sequence by accident； When the hybrid strain kind is that 10 and true hybrid strain rate exceed only the 10% of threshold value selected when judging specific, by described Correct probability >=95.0% of the judgement conclusion to stability and uniformity that the depth CF of high-flux sequence is determined.
Specifically, the test zone also includes non-universal test zone, and the primer also includes non-universal test zone Primer.
Further, the non-universal test zone primer includes the first primer and the second primer, the first primer bag The first forward primer and the first reverse primer are included, second primer includes the second forward primer and the second reverse primer, described First primer and second primer carry out individually amplification and obtain the amplified production of two non-universal test zones respectively, will The amplified production mixed in equal amounts of two non-universal test zones is used to build the high-throughput sequencing library individually expanded；
5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first 5 ' end connections in reverse primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；
5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second 5 ' end connections of reverse primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.
Further, using the variant sites, the variant sites rate and the hybrid strain rate, the kind to be measured is judged The method of specificity, uniformity and stability includes：
When the variant sites be present in the variant sites rate >=non-universal test zones of SD or described, the water to be measured Rice varieties have specificity, when the variant sites rate ＜ SD and the variant sites are not present in the non-universal test zone When middle, the rice varieties to be measured do not have specificity, wherein, SD is threshold value selected when judging specific；
As the hybrid strain rate≤M of the rice varieties to be measured, the rice varieties to be measured have uniformity and stably Property, when the hybrid strain rate of the rice varieties to be measured is more than ＞ M, the rice varieties to be measured do not have uniformity and stability, M Selected threshold value during to judge the uniformity and stability；
The hybrid strain rate R=R1+R2-R3-R4, wherein：
Wherein, n1 is the number of nucleus hybrid strain kind, and t1 is all special hybrid strains of the i-th 1 nucleus hybrid strain kinds The number of karyogene type, i1j1 are that all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds press frequency After sorting from low to high, the special hybrid strain karyogene type of jth 1, R1i1j1 is the i-th 1j1 special hybrid strain karyogenes The frequency of type, R1 are the summation of the hybrid strain rate of the nucleus hybrid strain kind calculated by hybrid strain karyogene type, described thin The hybrid strain rate of karyon hybrid strain kind is to remove the institute of 80% and highest 10% minimum in the nucleus hybrid strain kind After the frequency for stating special hybrid strain karyogene type, 2 times of the average value of the frequency of the remaining special hybrid strain karyogene type；
Wherein, t2 is described in addition to the hybrid strain karyogene type that the nucleus hybrid strain kind possesses and frequency >=0.17% The number of hybrid strain karyogene type, i2 are all institutes in addition to the hybrid strain karyogene type that the nucleus hybrid strain kind possesses State after hybrid strain karyogene type sorts from low to high by frequency, the i-th 2 hybrid strain karyogene types, R2i2 is described miscellaneous for the i-th 2 The frequency of strain karyogene type；R2 is to utilize to remove the described of the hybrid strain karyogene type calculating that the nucleus hybrid strain kind possesses Hybrid strain rate, R2 are 80% He minimum in the frequency for remove the hybrid strain karyogene type possessed except the nucleus hybrid strain kind After the value of highest 10%, 2 times of the average value of surplus value；
Wherein,N2 is the number of cytoplasm hybrid strain kind, and R3i3 is the i-th 3 The hybrid strain rate of the cytoplasm hybrid strain kind, R3i3 value when R3ic is i3=ic, ic are when the kind to be measured is core When matter interaction type sterile line or maintainer, the cytoplasm hybrid strain kind of the corresponding maintainer or the sterile line, t3 For the number of all special hybrid strain matter genotype of the i-th 3 cytoplasm hybrid strain kinds, i3j3 is described thin for the i-th 3 After all special hybrid strain matter genotype of kytoplasm hybrid strain kind sort from low to high by frequency, the special hybrid strain of jth 3 Matter genotype, R3i3j3 are the frequency of the i-th 3j3 special hybrid strain matter genotype, and R3ic, which refers to, to be mixed into the sterile line The hybrid strain rate of the hybrid strain rate of the maintainer or the sterile line being mixed into the maintainer；R3 is by hybrid strain matter genotype meter The summation of the hybrid strain rate for the cytoplasm hybrid strain kind calculated, the hybrid strain rate of the cytoplasm hybrid strain kind are described to remove In cytoplasm hybrid strain kind after the frequency of the special hybrid strain matter genotype of minimum 80% and highest 10%, remaining institute State the average value of the frequency of special hybrid strain matter genotype；
Wherein, t4 is in addition to the hybrid strain matter genotype that the cytoplasm hybrid strain kind possesses and frequency >=0.17% The number of the hybrid strain matter genotype, i4 are the institute in addition to the hybrid strain matter genotype that the cytoplasm hybrid strain kind possesses After having the hybrid strain matter genotype to be sorted from low to high by frequency, the i-th 4 hybrid strain matter genotype, R4i4 is the i-th 4 institutes State the frequency of hybrid strain matter genotype；R4 is to utilize the hybrid strain matter genotype possessed except the cytoplasm hybrid strain kind to calculate The hybrid strain rate, R4 are minimum in the frequency for remove the hybrid strain matter genotype possessed except the cytoplasm hybrid strain kind 80% and highest 10% value after, the average value of surplus value；
Int () is bracket function；
The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm merely with karyogene type Hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to All hybrid strain karyogene types of one nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only one All hybrid strain matter genotype of the cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is The karyogene type, the karyogene type refer to the genotype and are located on nuclear genome；The hybrid strain matter genotype refers to The hybrid strain genotype is the matter genotype, and the matter genotype refers to that the genotype is located on cytoplasmic skeleton；Base Because the frequency of type refers in the sequencing fragment group that the sequencing segments for representing the genotype is accounted for described in where the genotype The ratio of the sequencing fragment sum of test zone.
Further, methods described also includes the uniformity and stably for judging the rice varieties to be measured in the following ways The correct probability of conclusion of property is：When the rice varieties to be measured have uniformity and stability, the correct probability of conclusion >= BINOM.DIST(M*SN,SN,R,TRUE)*BINOM.DIST(∑SeN*M,∑SeN,R,TRUE)；When the rice product to be measured When kind not having the uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M) * SN, SN, (1-R), TRUE)*BINOM.DIST(∑SeN*(1-M),∑SeN,1-R,TRUE)；Wherein, M is when judging the uniformity and stability Selected threshold value, ∑ SeN are all frequency place test zones for being used to calculate the genotype of the hybrid strain rate R Sequencing fragment summation, BINOM.DIST (M*SN, SN, R, TRUE) be the rice varieties to be measured carried out SN time sample, The hybrid strain rate R being actually pumped is less than the probability of the threshold value M, and BINOM.DIST (∑ SeN*M, ∑ SeN, R, TRUE) is pair The rice varieties to be measured have carried out SeN sampling of ∑, and the hybrid strain rate R being actually pumped is less than threshold value M probability.
Further, when the variant sites are not present in the non-universal test zone, if judging the rice to be measured Kind has specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TRUE)；If judge institute State rice varieties to be measured and do not have specific, the correct probability >=BINOM.DIST (SD*TRN, TRN, OD, TRUE) of conclusion, its In, TRN is the number for detecting successful test zone, and OD is the variant sites rate, and BINOM.DIST is in excel 2010 Function, the correct probability of conclusion is expressed as when judging that the rice varieties to be measured have specific, the change dystopy Point rate is more than SD probability, and when judging that the rice varieties to be measured do not have specific, the variant sites rate is less than SD's Probability, the successful test zone of detection after analyzing the sequencing fragment group by obtaining.
Specifically, obtaining the method for the hybrid strain kind includes：The hybrid strain kind is to be present in the database Kind, and the potential hybrid strain genotype of the hybrid strain kind is with there is the test section of phase homogenic type between the hybrid strain genotype The number in domain accounts for total ratio >=60% that the hybrid strain kind has the test zone of the potential hybrid strain genotype； The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；
Quantity >=2 of distinguishing base between all genotype of the potential hybrid strain genotype and the kind to be measured or There are insertion or the missing of discontinuous base in the distinguishing base.
Specifically, the method for determining the universal test region by the variant sites is：Pass through discrimination The value of discrimination is calculated, wherein, a is the kind sum being detected in variation window area, and bi is the variation window area In i-th kind of genotype kind number, and bi>1, k be the genotype comprising more than a kind number, the variation window region Domain is centered on each single nucleotide variations site, respectively extends survey sequence length to the both sides in the single nucleotide variations site 1/2 as detection window；
The universal test region is the area on the region that discrimination is big on cytoplasmic skeleton or nuclear genome Index big and equally distributed region.
The beneficial effect that technical scheme provided in an embodiment of the present invention is brought is：Method provided in an embodiment of the present invention passes through High-flux sequence and the amplification of more sites, realize the big of the large sample sampling of rice varieties to be measured and the internal test zone of inter-species Sample is sampled, and is recycled and is defined hybrid strain genotype, defines cytoplasm hybrid strain kind and define the comprehensive hand such as hybrid strain rate calculation formula Section, successfully realizes the target of specificity that is accurate, intactly judging rice varieties, stability and uniformity, and tests speed Degree faster, can be completed within 10 days.
Embodiment
To make the object, technical solutions and advantages of the present invention clearer, embodiment of the present invention will be made into one below It is described in detail on step ground.
Specificity, uniformity and the stability of embodiment measure new rice varieties ' R7723 '
Rice varieties to be measured provided in an embodiment of the present invention are rice varieties " R7723 ", and rice varieties " R7723 " are pure lines Rice and authorize kind, grant number CNA20100474.1 to be open.The source of rice varieties " R7723 " is rice varieties " R8377 " is with after " IRBB23 " hybridization, with " R8377 " for recurrent parent, wanting objective trait based on bacterial blight-resisting character, pressing The method of back cross breeding is cultivated and formed.Then determine the method for the specificity of the rice varieties, uniformity and stability include it is following Step.
First, the variant sites between different rice varieties are obtained.
The variant sites of different rice varieties can obtain from the documents and materials announced, but the knot that this method is obtained Fruit is more fragmentary, in the present embodiment, can by by the genome sequence of different rice with reference to rice varieties genome Sequence is compared, and obtains the variant sites between substantial amounts of different rice varieties, wherein can be " Japan with reference to rice varieties Eyeball " rice, " Japanese eyeball " rice could alternatively be other known and refer to rice varieties.
Further, the method for obtaining the genome sequence of different rice varieties is as follows：
The genome sequence of the different rice varieties of the present embodiment shows three kinds of sources, and the first is Han Bin to 1082 rice The high-flux sequence sequence of the genome of kind, pertinent literature information are as follows：Huang XH et al.A map of rice genome variation reveals the origin of cultivated rice.Nature.2012；7:497–503. The genome sequence of 1082 rice varieties is published in European NucleotideArchive (http:// Www.ebi.ac.uk/ena/), reception number is ERP001143, ERP000729 and ERP000106；Second be Xu Xun to 50 The high-flux sequence sequence of the genome of rice varieties, pertinent literature information are as follows：Xun X et al.Resequencing 50accessions of cultivated and wild rice yields markers for identifying agronomically important genes.Nat Biotechnol.2011,30(1):105-11,50 rice varieties Genome sequence be published in NCBI Short Read Archive (http://www.ncbi.nlm.nih.gov/sra), connect Collect the digits for SRA023116；The third be by the method provided in the above-mentioned articles delivered of Han Bin to " R8377 ", " Jin Ke 1A ", " " D excellent 527 " has carried out high-flux sequence to Jin Ke 1A/R7723 " with hybrid strain kind for " IRBB23 ", cenospecies.The present embodiment obtains altogether The high-flux sequence sequence of the genome of 1137 rice varieties.
Further, variant sites are obtained using the genome sequence of different cultivars.
Specifically, because the sequencing depth of this 1137 rice varieties is not high, it is only capable of identifying single nucleotide variations (SNP) Site, other variation types are as repeated number variation, due to a low credibility, without identification.Utilize Frederick Sanger ratios " Japan is compared respectively by the high-flux sequence sequence of the genome of this 1137 rice varieties to software (version number 0.4) (version is IRGSP 4.0 to eyeball " rice, download address：http://www.ncbi.nlm.nih.gov) nucleus reference gene group In cytoplasm reference gene group, the cytoplasm reference gene group includes mitochondria reference gene group and chloroplaset reference gene Group, it is in NCBI (National Center for Biotechnology Information, US National biotechnology letter Breath center) on reception number be respectively NC_011033 and NC_001320.During contrast, Insert Fragment length is set to 500bp, other Parameter setting is default value.The Ssaha Pileup software kits (version number 0.5) used identify the SNP positions of each rice varieties Point.The SNP site is defined as base-pair, the insertion of single base or the missing of single base of difference determination.The alkali that the difference determines For base to referring to not include the uncertain base-pair of difference, the uncertain base-pair of difference refers to the base between some degeneracy bases It is right, as R represents A or G, therefore, difference is there may be between A and R, it is also possible to which, in the absence of difference, therefore, difference is failed to understand between A and R Really, SNP it is not mutually.Therefore, the SNP site in the embodiment of the present invention is not include the uncertain base-pair of above-mentioned difference.By with The definition of upper SNP site, the embodiment of the present invention obtain 7236888 SNP sites altogether between all 1137 rice varieties, wherein 59503 SNP sites are located on cytoplasmic skeleton, and remaining SNP site is located on nuclear genome.Base referred to hereafter Because type is to refer to the combination of multiple SNP sites in test zone, karyogene type refers to genotype and is located on nuclear genome, matter base Because type refers to that genotype is located on cytoplasmic skeleton.For example, the 8th test zone is located on nuclear genome in table 1, it is Karyogene type, the test zone share 9 SNP sites, and the genotype of the test zone is the combination of this 9 SNP sites.
2nd, the test zone of rice varieties to be measured is determined by variant sites, the test zone includes universal test region, At least part variant sites are included in universal test region, and its method includes：
Determine universal test region
Universal test region be on cytoplasmic skeleton on the big region of discrimination or nuclear genome discrimination it is big and Equally distributed region, wherein, discriminationWherein, a is that the kind being detected in variation window area is total Number, bi are the kind number of i-th kind of genotype in variation window area, and bi>1, k is the genotype comprising more than a kind Number, variation window area are centered on each single nucleotide variations site (SNP site), to single nucleotide variations site Both sides respectively extend 1/2 window as detection for surveying sequence length；Test zone is the area that discrimination is big on cytoplasmic skeleton Discrimination is big on domain or nuclear genome and equally distributed region.The Computing Principle of discrimination is as follows：It is all interracial Number of combinations isWherein, the combination between the different cultivars in same gene type is undistinguishable, and its number isThat , the ratio for the breed combination that can not be distinguished isThe ratio for the breed combination that can be distinguished i.e. discriminationAs can be seen here, discrimination is bigger, can more distinguish different cultivars, the big variation window area of discrimination It is more effective to DUS tests.If the variation window area skewness on nuclear genome, can cause some regions adjacent, So as to linkage inheritance, information is easily overlapping, and therefore, the principle of compositionality in universal test region is selected on nuclear genome is：Area Indexing is big and SNP site is uniformly distributed.Cytoplasmic skeleton without linkage inheritance problem, so, on cytoplasmic skeleton only need The big region of selective discrimination degree.
High-flux sequence is carried out using Proton high-flux sequences instrument in the embodiment of the present invention, the test section of detection is sequenced in it Length of field can reach 200bp, and in order to obtain maximum fault information, the most long test zone in the present embodiment is also 200bp.Therefore, The variant sites that the present embodiment is mentioned are located in whole test zone, and the variant sites may include multiple SNP sites.
First, centered on each SNP site of acquisition, respectively extend 99bp and 100bp to the left and right, form 200bp change Different window.According to the 7236888 of acquisition SNP sites, 7236888 variation windows can be obtained, calculate these variation windows The discrimination in regionFor example, in the 1st variation window area, a=520 kind is detected altogether, is shared K=3 kind genotype ACCT, CGTT, ACCC, their kind number are respectively b1=10, b2=30 and b3=431, because This,It is meant that：, can be by 520 kinds by the 1st variation window area In 31% breed combination distinguish, in addition 79% breed combination cannot be distinguished by out, it is necessary to more make a variation window ability Distinguish.After the same method, calculate to obtain all discriminations of 7236888 variation windows and therefrom choose and be located at cell 6800 maximum variation windows of discrimination and 200 maximum variations of discrimination in cytoplasmic skeleton in Matrix attachment region Window.Check one by one in 6800 variation windows of nuclear genome, each window and next variation window of making a variation Between distance, if distance exceed 100K (1K=1000 base), abandon wherein discrimination it is less make a variation window afterwards again Check, untill the adjacent distance for looking into variation window is all higher than 100K.Selection 100K criterion distance is because paddy gene Group size is about 500M (ten thousand bases of 1M=100), by final selected 2000 universal test areas for being located at nuclear genome Domain is counted, and the interregional distance of average universal test is 250K, but due to few change dystopys such as some specific regions such as centromere Point, therefore, average distance should be less than 250K.By the above process, 4061 variation windows for being located at nuclear genome be have selected Mouthful, they are located at together with 200 maximum variation windows of discrimination in cytoplasmic skeleton totally 4261 variation windows with acquisition Mouth passes through test zone as selected.Wherein, 200 maximum variation windows of selective discrimination degree, are empirical value, the quantity can To modify as the case may be.
The test zone can also include non-universal test zone.
Determine non-universal test zone
Non-universal test zone refers to the non-universal test zone site that special kinds needs detect.DUS tests need to examine The special site of measuring point transformation, fixed point transformation is the technological means commonly used in modern breeding, such as back cross breeding, transgenic breeding Deng, fixed point transformation kind can also because its have specificity and turn into new varieties.It is former based on the specific judgement of New variety protection Then, non-universal test zone should not be included in universal test region and the site of qualitative character is controlled for known to.
In the present embodiment, by way of back cross breeding, by the gene Xa23 of high bacterial leaf spot resistant from parent's IRBB23 transfers The rice varieties to be measured that the present embodiment provides have been cultivated after having entered parent R8377.Therefore, rice varieties to be measured and parent R8377 Genetic background is identical, and only bacterial leaf spot resistance is different.The bacterial leaf spot resistance that Xa23 genes control is qualitative character, and Xa23 sources In wild rice, it is not included in universal test region.For the above-mentioned reasons, it is subject to Xa23 genes as non-universal test zone Detection, Xa23 genes have been cloned, and its resistance is caused by the missing of 7 bases, therefore, the special detection area of rice varieties to be measured Domain is the base of this 7 missings, and it is located at 24046820 to 24046825 of the 11st chromosome in Japanese eyeball reference gene group Position, the more detailed information on Xa23 genes are shown in：Wang,C.,X.Zhang,et al.(2014)."XA23is an executor R protein and confers broad-spectrum disease resistance in rice." Molecular plant:ssu132.
3rd, the primer in amplification assay region is prepared, the primer includes universal test region primer, specific as follows：
Universal test region primer is prepared, the universal test region primer is directed to all kinds, specifically：
Universal test region is detected using multiple PCR technique, and multiple PCR technique refers in same PCR reacts Add multiple PCR primers, while multiple sites in amplification gene group.The key of the technology is to design and synthesize multiplex PCR to draw Thing, the present embodiment use the multiple PCR technique that LifeTechnology companies of the U.S. provide, and it can set up to 12000 weights PCR primer.
Primer acquisition process is as follows：Log in LifeTechnology companies multiple PCR primer Photographing On-line webpage https://ampliseq.com/protected/help/pipelineDetails.action, related letter is submitted by its requirement Breath.Wherein, in the present embodiment, " Application type " options select " DNA Hotspot designs (single-pool)”.If selecting multi-pool, multiplex PCR will divide multitube to carry out, and cost can increased, and Single-pool primer only needs a multiplex PCR, saves cost, shortcoming is that some universal test regions primer is set Meter may fail, but the alternative universal test region on genome is more, therefore, abandons some alternative universal test regions Have no effect on result.The nucleus reference gene group of kind to be measured and cytoplasm reference gene group are permeated file, and " after selecting " Custom " in Select the genome you wish to use " options, uploading the file conduct of fusion Design reference gene group during multiple PCR primer.The selection of DNA type options " Standard DNA ", is selected in Add Hotspot Xiang Zhong, the positional information for the SNP site in universal test region that addition needs design, including chromosome information, SNP's The end locus of initiation site and SNP, its certain embodiments are shown in Table 1." Submit targets " buttons are submitted and obtained for finally click To the multiple PCR primer of design.In the present embodiment, from the above-mentioned 4261 universal test regions obtained, design and successfully test 2231 pairs of multiple PCR primers are demonstrate,proved, for expanding corresponding 2231 universal test regions.The method for verifying multiple PCR primer By method provided by the invention, to extract the leaves genomic DNA on same strain rice, and utilize the multiple PCR primer of design The genomic DNA of acquisition is expanded, storehouse, high-flux sequence is built and analyzes sequencing fragment group, removes following test zone phase The primer answered：The sequencing segments of the test zone is less than 1000 or hybrid strain genotype be present, and the primer remained is to test Demonstrate,prove successful multiple PCR primer.Because genomic DNA source is in same strain rice leaf, it is impossible to hybrid strain kind be present, because This, hybrid strain genotype is PCR or sequencing Preference mistake as caused by the special construction of test zone, removes these test zones Avoid such system mistake.The multiple PCR primer being proved to be successful is supplied in fluid form after also being mixed by the said firm Client uses.2231 universal test regions of above-mentioned successful design multiple PCR primer are to be examined eventually for kind to be measured The universal test region of survey, meanwhile, each kind in the database of structure also contains above-mentioned 2231 universal test regions, Wherein, 100 universal test regions are located on cytoplasmic skeleton, and remaining 2131 universal test regions are located at nucleus base Because in group.
It should be noted that：The number requirement >=900 in universal test region, reason is as follows：If less than 900, exist The probability of the hybrid strain kind of erroneous judgement will be more than 1%, and the projectional technique of the threshold value is shown in Table 2.Due to there may be the survey of detection failure Region is tried, therefore, test zone number is general >=and 1000.
Test zone can also include non-universal test zone, and test zone primer can also include non-universal test zone Primer, it is specific as follows：
The primer of non-universal test zone includes the first primer and the second primer, the first primer include the first forward primer and First reverse primer, the second primer include the second forward primer and the second reverse primer, and the first primer and the second primer enter respectively Individually amplification obtains the amplified production of two non-universal test zones to row, by the amplified production equivalent of two non-universal test zones It is mixed for building the high-throughput sequencing library individually expanded.5 ' end connections of the first forward primer are just like SEQ ID in sequence table NO:Sequence 1 shown in 1,5 ' end connections in the first reverse primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；The 5 ' end connections of two forward primers are just like SEQ ID NO in sequence table:Sequence 2 shown in 2,5 ' end connections of the second reverse primer Just like SEQ ID NO in sequence table:Sequence 1 shown in 1.
The design process of non-universal test zone primer is as follows：The first step, it is no more than 200bp and comprising non-by amplification length The requirement of all SNP sites in universal test region, by common PCR primers design method, design expands non-universal test zone PCR forward primer and reverse primer；Second step, 5 ' ends of designed forward primer and reverse primer are connected into sequence respectively SEQ ID NO in list:1 and sequence table in SEQ ID NO:2, the forward primer and first primer of the first primer are obtained respectively Reverse primer；3rd step, by SEQ ID NO in 5 ' ends of designed forward primer and reverse primer respectively catenation sequence table:2 With SEQ ID NO in sequence table:1, the forward primer of the second primer and the reverse primer of the second primer are obtained respectively.In sequence table SEQ ID NO:1 and sequence table in SEQ ID NO:2 be the joint sequence used in high-flux sequence, thereby using PCR primer band There is the joint sequence of high-flux sequence, after establishing sequencing library after directly being mixed with the product in the general sequencing region of amplification Together be sequenced, without by fragmentation, jointing etc. it is cumbersome build storehouse step, improve operating efficiency and reduce into This.It is to be sequenced from the both ends of non-universal test zone simultaneously to make two pairs of only different primers of joint.
Specifically, in the present embodiment, it is designed to be used to expand rice varieties to be measured non-universal test zone (Xa23 bases Cause) the forward primer sequences of common PCR primers be：TGCGGCATCACTAACATCAG, reverse primer sequences are： TGTTAGTGATGCGGGAGGAA.SEQ ID NO in sequence table are added respectively to its both ends:1 and sequence table in SEQ ID NO:2 The forward primer of the first primer formed afterwards is：5’-CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCGGCATCACTAAC SEQ ID NO in ATCAG such as sequence table:3；The reverse primer of first primer is：5’-CCTCTCTATGGGCAGTCGGTGATTGT SEQ ID NO in TAGTGATGCGGGAGGAA such as sequence table:4；The forward primer of second primer is：5’- SEQ ID NO in CCTCTCTATGGGCAGTCGGTGATTGCGGCATCACTAACATCAG such as sequence table:5；Second primer it is anti- It is to primer：SEQ in 5 '-CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTTAGTGATGCGGGAGGAA such as sequence table ID NO:6.Designed non-universal test zone primer is synthesized by LifeTechnology companies of the U.S..
4th, structure is as follows in the method for the database of the genotype of all test zones comprising rice varieties：
Specifically, on the test zone of kind to be measured, obtain different cultivars to should be on test zone genotype And composition data storehouse.This example obtains 2231 universal test region primers and 1 non-universal test zone primer, and they are right Test zone of the amplification region answered collectively as rice varieties to be measured.2232 test zones of the structure comprising 1137 kinds The database of genotype and its SNP positional information, partial results are shown in Table 1.
Table 1 is database variety and genetype and its position, rice varieties genotype to be measured, hybrid strain genotype and its frequency Certain embodiments
'-' represents the position of the SNP site and lacked in reference gene group in table 1；"/" represents that the test zone is heterozygosis Genotype, the different genotype of "/" both front and back be present；In addition to ATGC, other letters represent degeneracy base.If genotype entirely by Degeneracy base N is formed, and claims corresponding test zone genotype and SNP shortage of data, genotype or SNP and any genotype of missing Or SNP makees indifference processing when comparing.Can be by the method testing number of detection rice varieties genotype to be measured provided by the invention According to storehouse kind and the genotype of completion missing.
The present embodiment does not list all database content completely as space is limited, only lists wherein 5 kinds The information of 10 test zones.Equally limited based on length, also have some areas also only to list part in the present embodiment related real Example, remaining unlisted data can be according to the method completion of the present embodiment.
5th, after the amount of sampling SN for determining rice varieties to be measured, random sampling mixes and extracts the DNA of mixing sample, method It is as follows：
Calculate rice varieties amount of sampling to be measured
Amount of sampling SN should meet following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein, BINOM.INV For the function in excel 2010, its application method is identical with the definition in excel 2010, and its implication is so that accumulation binomial The functional value of distribution is more than or equal to the smallest positive integral of critical value.Amount of sampling SN meet condition implication be：Even if hybrid strain rate is only Beyond the 15% of threshold value M, the amount of sampling can correctly judge the stability and one of rice varieties to be measured in the case where 95% probability ensures Cause property.M values artificially determine according to conditions such as crop species, type, specific requirements.In the Ministry of Agriculture, New variety protection is done In public room issue《New variety of plant specificity, uniformity and stability test guide-rice》Middle regulation：Selfed seed sample size For 356~818 plants when, at most allow for 2 plants of special-shaped strains, equivalent to M values be 0.24%~0.56%, therefore, this implementation In example, M values are used as from median 0.40%.After progressively increasing SN values, above-mentioned formula discovery is calculated, as SN >=29783, BINOM.INV (SN, 0.40%, 0.95)/SN≤1.15*0.40% is set up.Therefore, the rice varieties to be measured in the present embodiment are taken out Sample amount answers >=29783.
Random sampling mixes and extracts the DNA of mixing sample
In the present embodiment, 50000 germinations are have chosen, 30000 buds being substantially equal to the magnitudes is randomly selected and mixes It is placed in after conjunction in mortar, powder is fully ground into after adding liquid nitrogen into mortar.Given birth to using Beijing Tiangeng biochemical technology Co., Ltd The article No. of production is that DP305 plant genome DNA extracts kit is extracted and obtains the DNA of rice varieties mixing sample to be measured, DNA extraction method is carried out by the operation manual of the kit.Utilize the production of Invitrigen companies of the U.S.dsDNA HS Assay Kit (article No. Q32852) and its specification quantify to the DNA of acquisition, the rice product to be measured after quantifying Kind DNA is diluted to 10.00ng/ μ l.
6th, expanded using the DNA of primer pair mixing sample, obtain the amplified production of test zone, amplified production is used In structure high-throughput sequencing library, wherein primer includes universal test region primer and the high-flux sequence text in universal test region Storehouse, specific method are as follows：
High-throughput sequencing library includes：The high pass of the high-throughput sequencing library in universal test region and non-universal test zone Sequencing library is measured, in the present embodiment, the two is mixed, the high-throughput sequencing library of all test zones can be obtained, wherein, The amplified production obtained by universal test region primer is used for the high-throughput sequencing library for building universal test region, by logical The amplified production obtained with test zone is used for the high-throughput sequencing library for building non-universal test zone.
The method for building the high-throughput sequencing library in universal test region is as follows：
It is multiple using library construction Kit 2.0 (being produced by LifeTechnology companies of the U.S., article No. 4475345) Behind PCR amplification universal tests region, high-throughput sequencing library is built using amplified production.The kit includes following reagent：5× Ion AmpliSeqTMHiFi Mix, FuPa reagents, transferring reagent, sequence measuring joints solution and DNA ligase.The side of library construction Method presses the operation manual of the kit《Ion AmpliSeqTMLibrary Preparation》(publication number：MAN0006735, Version：A.0) carry out.It is as follows by 2231 universal test regions of multiplexed PCR amplification, the amplification system of multiplex PCR：5×Ion AmpliSeqTMμ l of HiFi Mix 4, μ l of universal test region primer mixed liquor 4, the DNA 10ng of rice varieties to be measured prepared With without the μ l of enzyme water 11.The amplification program of multiplex PCR is as follows：99 DEG C, 2 minutes；(99 DEG C, 15 seconds；60 DEG C, 4 minutes) × 25 follow Ring；10 DEG C of insulations.After primer unnecessary in multiplexed PCR amplification product is digested using FuPa reagents, then phosphorylation is carried out, specifically Method is：2 μ L FuPa reagents are added into the amplified production of multiplex PCR, after mixing, are reacted in PCR instrument by following program： 50 DEG C, 10 minutes；55 DEG C, 10 minutes；60 DEG C, 10 minutes；10 DEG C of preservations, obtain mixture a, and mixture a is containing by phosphorus The amplified production solution of acidifying.By the upper sequence measuring joints of amplified production connection of phosphorylation, specific method is：Add into mixture a Enter μ L of transferring reagent 4, the μ L of sequence measuring joints solution 2 and the μ L of DNA ligase 2, after mixing, reacted in PCR instrument by following program：22 DEG C, 30 minutes；72 DEG C, 10 minutes；10 DEG C of preservations, obtain mixed liquor b.Utilize the ethanol precipitation methods purifying mixed liquor b of standard After be dissolved in 10 μ L without in enzyme water.Utilize the production of Invitrigen companies of the U.S.DsDNA HS Assay Kit (goods Number be Q32852) and be measured according to its specification, and after obtaining mixed liquor b mass concentration, will after purification mixed liquor b it is dilute Release to 15ng/ml, obtain the high-throughput sequencing library in concentration about 100pM universal test region.
The method for building the high-throughput sequencing library of non-universal test zone is as follows：
Using the DNA of rice varieties to be measured as template, the first primer and the second primer that are prepared using the above method are entered respectively The independent PCR of row is expanded, and the high-throughput sequencing library of non-universal test zone is obtained after mixed in equal amounts amplified production.Concrete operations are pressed 《Ion Amplicon Library Preparation(Fusion Method)》(publication number：4468326) carry out, substantially mistake Journey is as follows：After the forward primer of the first primer and reverse primer are dissolved as into 10 μM of concentration with water, isometric mixing, the is obtained One primer solution.It is formulated as follows PCR reaction systems：μ L of first primer solution 1,30ng rice varieties DNA to be measured and PCR high-fidelities Mixture (invirtrigen companies of the U.S. produce, article No. 12532016) 45 μ L, after mixing, press following program in PCR instrument Reaction：94 DEG C, 3 minutes；(94 DEG C, 30 seconds；58 DEG C, 30 seconds；68 DEG C, 1 minute) × 40 circulations；4 DEG C of insulations.PCR amplification productions Thing is dissolved in 10 μ L water after purification by the method for the ethanol precipitation of standard, utilizes the kits of DNA 1000 (article No. 5067- 1504) on the biological analyser (model 2100) of Agilent company of the U.S. production, determined and obtained by the kit specification After the molar concentration for obtaining amplified production, 200pM, as the first primer amplified production are diluted to.Using identical method, obtain Concentration is the amplified production of 200pM the second primer.By bodies such as the amplified productions of the amplified production of the first primer and the second primer Product mixing, obtain the non-universal test zone high-throughput sequencing library that concentration is 100pM.
Obtain the high-throughput sequencing library of all test zones
In universal test region number and non-universal test zone number ratio mixing equimolar concentration it is general The high-throughput sequencing library of the high-throughput sequencing library of test zone and non-universal test zone, obtained mixture are all The high-throughput sequencing library of test zone.In the present embodiment, the high-throughput sequencing library in the universal test region of acquisition is taken After the high-throughput sequencing library of 2231 μ L and the 1 non-universal test zones of μ L mixes, all test zones that concentration is 100pM are obtained High-throughput sequencing library.
7th, high-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced, method is as follows：
Determine the principle of high-flux sequence depth：The depth of high-flux sequence meets following condition：BINOM.DIST(10, 10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1- BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, CF is the depth of high-flux sequence, namely averagely the capped multiple of each test zone, M are Judge threshold value selected when uniformity and stability, BINOM.DIST is the function in excel 2010, its application method with Definition in excel 2010 is identical, and what it was returned is the probability of binomial distribution.The meaning of three functions is：In hybrid strain rate As little as 0.1%, the hybrid strain condition wide in variety up to average only 20 difference sites between 10 and hybrid strain kind and rice varieties to be measured Under, probability >=99.9% of the whole hybrid strain kinds of detection determined by high-flux sequence depth；In database kind up to 10000 It is individual and between hybrid strain kind and rice varieties to be measured under conditions of average only 20 difference sites, determined by high-flux sequence depth In the presence of probability≤0.1% of erroneous judgement hybrid strain kind；It is wide in variety up to 10 and true hybrid strain rate exceeds only judgement specificity in hybrid strain When selected threshold value 10% when, the judgement conclusion to stability and uniformity determined by high-flux sequence depth is correct Probability >=95.0%.Conditions above is very strict, and therefore, true effect is better than above-mentioned threshold value.The projectional technique of above probability is shown in Table 2.
Table 2 is the computational methods of the present embodiment dependent probability
Table 2 is that the tables of data of Excel 2010, its function, cell etc. is identical with Excel 2010 definition.Wherein, " judging threshold value selected when uniformity and stability (M) " for cell B2, other cell numberings are pressed using B2 as reference Excel 2010 rule defines, such as the cell where " hybrid strain rate (R) " adds 4 rows 1 on the basis of B2 and arranged, therefore Numbering is C6, and other cell coding rules are identical with this.
The determination method of the present embodiment high-flux sequence depth is：After M=0.40% is substituted into above three formula, progressively It when increasing sequencing depth CF to 7096, can set up above three equation, therefore, the present embodiment sequencing depth is defined as >=7096 Times.
High-flux sequence is carried out using high-throughput sequencing library
Utilize the high-throughput sequencing library and kit Ion PI Template OT2 200 of all test zones of acquisition Kit v2 (invirtrigen companies of the U.S. produce, article No. 4485146) be sequenced before ePCR (Emulsion PCR, breast Change polymerase chain reaction) expand, operating method is carried out by the operation manual of the kit.Utilize ePCR products and kit Ion The Kit v2 of PI Sequencing 200 (invirtrigen companies of the U.S. produce, article No. 4485149) are high in the generations of Proton bis- High-flux sequence is carried out on flux sequenator, operating method is carried out by the operation manual of the kit.In the present embodiment, high pass Amount sequencing throughput is arranged to average 30000 times of coverage test region.
High-flux sequence result is pre-processed
First determine whether high-flux sequence the quality of data whether >=Q20, if<Q20 (this situation is few), then as stated above High-flux sequence is re-started, until quality requirement reaches Q20 standards, Q20 standards, which are met in table 2, " to be sequenced wrong to be specific The requirement of the probability of base "≤0.33%.The high-flux sequence fragment for being up to quality requirement is compared to all 2232 tests Region, remove after comparing the unsuccessful and infull sequencing fragment of genotype detection, remaining all sequencing fragments are referred to as piece is sequenced Section group.The incomplete sequencing fragment of genotype detection refers to could not be by table 1 shown in " positions of the SNP in reference gene group " The reason for all SNP sites in sequencing region where the sequencing fragment detect, genotype detection is not complete is sequencing fragment Too short, it is that sequencing fragment is mostly non-specific amplification product to compare unsuccessful reason.
8th, analysis sequencing fragment group, it is as follows to obtain rice varieties genotype and hybrid strain genotype, method to be measured：
Sequencing fragment group is compared and arrives all test zones, and counts the sequencing segments in each test zone, is removed The test zone of segments≤1000 is sequenced, remaining test zone is the successful test zone of detection.In the present embodiment, 2030 successful test zones of detection are obtained altogether.The fragment for comparing test zone is referred to as the sequencing fragment of the test zone, The base composition that the position in table 1 shown in " positions of the SNP in reference gene group " is extracted from sequencing fragment is referred to as the sequencing The genotype of fragment.The frequency of genotype refers to be sequenced in fragment group, and the sequencing segments for representing the genotype accounts for the genotype The ratio of the sequencing fragment sum of place test zone.The maximum genotype of frequency is referred to as rice varieties genotype to be measured.Hybrid strain Genotype refers to the potential hybrid strain genotype of frequency >=0.02%, wherein, potential hybrid strain genotype is all with rice varieties to be measured There are insertion or the missing of discontinuous base in quantity >=2 of distinguishing base between genotype or distinguishing base.Hybrid strain genotype The principle of definition is：In high-flux sequence, insertion or missing errors are extremely rare, and the 2 fixed difference caused by mistake is sequenced The probability of base as little as (1%/3) 2=0.0011%, and require hybrid strain genotype frequency >=0.02%, limited in these conditions Under, even 30000 sequencing depth, because the probability that sequencing mistake produces certain hybrid strain genotype is only 0.0001% (calculating 2) method is shown in Table, it is desirable to which hybrid strain genotype is identical with some genotype of database kind to be eliminated because the systems such as PCR amplifications are wrong Wrong hybrid strain genotype caused by by mistake.It should be noted that：When database kind is few, it is impossible to represent different rice varieties extensively During genotype, this requirement of some genotype identical of hybrid strain genotype and database kind should be cancelled, and its function is by this reality The standard sample realization in example is applied, conversely, when database kind can represent different rice varieties extensively, the mark in the present embodiment Quasi- sample detection can be cancelled.In the present embodiment, database kind number reaches 1137, contains the base of test zone extensively Because of type, so, the requirement that hybrid strain genotype comes from wherein certain genotype is rational, even if small part genotype is very dilute Have, so that all not having in the kind of mass data storehouse, nor affect on hybrid strain rate R calculating, because all hybrid strain genes of same hybrid strain The expectation average of the frequency of type is identical, and in hybrid strain rate R calculation formula, its effect completely can be by other hybrid strain bases of the hybrid strain Because type replaces.0.02% frequency meets that most strict DUS testing standards, i.e., as little as 2 detected from 10,000 seeds are miscellaneous at present Seed.If distinguishing base quantity=1, whole test zones can all produce wrong hybrid strain genotype, and (computational methods are shown in Table 2), if during distinguishing base quantity >=3, hybrid strain genotype quantity is drastically reduced, it is difficult to accurate to calculate hybrid strain rate R, therefore, difference The threshold value of base quantity >=2 is optimal.
For example, in fragment group is sequenced, the sequencing fragment sum in the 1st sequencing region is 33320 articles, have ACCC, CGTT, CCCC, GCCC ... totally 42 kinds of genotype, represent these genotype sequencing segments distinguish 33001,16,1,2 Bar ..., the frequency of these genotype is 33301/33320=99.04%, 16/33320=0.05%, 1/33320= 0.003%th, 2/33320=0.006% ....By the definition of rice varieties genotype to be measured and hybrid strain genotype, ACCC should To be measured rice varieties genotype of the rice varieties to be measured in the 1st test zone, and CGTT frequency more than 0.02% and with Rice varieties genotype ACCC to be measured relatively has the difference of 4 >=2 bases, and with first kind " Jin Ke in database 1A " genotype is identical, therefore CGTT is hybrid strain genotype, and other genotype are genotype caused by sequencing mistake.Hybrid strain core Genotype refers to that hybrid strain genotype is karyogene type, and hybrid strain matter genotype refers to that hybrid strain genotype is matter genotype.Defined by this, The hybrid strain genotype CGTT of first test zone is also hybrid strain karyogene type.By identical method, judge and obtain whole Rice varieties genotype to be measured, hybrid strain genotype and its frequency of 2030 successful test zones of detection, and judge what is obtained Hybrid strain genotype is hybrid strain karyogene type or hybrid strain matter genotype.As a result show：109 hybrid strain genotype are obtained altogether, wherein, 108 are hybrid strain karyogene type, and 1 is hybrid strain matter genotype.
The standard sample detection method in the present embodiment is following is a brief introduction of, a kind is taken from rice varieties to be measured Son, after sowing and growing up to seedling, pressed using the blade of seedling and extract genomic DNA with rice varieties identical method to be measured, should DNA is referred to as the standard sample of rice varieties to be measured.With rice varieties to be measured simultaneously and by the parallel structure standard sample of same procedure High-throughput sequencing library and high-flux sequence.Wherein, the maximum genotype of frequency is referred to as standard sample genotype, standard sample In quantity >=2 or distinguishing base of frequency >=0.02% of hybrid strain genotype and the distinguishing base between standard sample genotype There are insertion or the missing of discontinuous base.Successful test section is each detected by with rice varieties identical method to be measured, acquisition Standard sample genotype and standard sample hybrid strain genotype in domain.If standard sample genotype and rice varieties genotype to be measured Identical test zone accounts for ratio that standard sample and rice varieties to be measured detect successful test zone more than 90%, then marks Quasi- sample is correct, otherwise, takes 1 seed from rice varieties to be measured again, repeats above procedure, until obtaining correct standard Sample.By the hybrid strain genotype of correct standard sample compared with the hybrid strain genotype of the corresponding test zone of rice varieties to be measured, Identical hybrid strain genotype is obtained, removes identical hybrid strain genotype in rice varieties to be measured, correct rice varieties to be measured are miscellaneous Pnca gene type is retained and is used for subsequent analysis.Above measure eliminates the hybrid strain gene caused by Systematic selection mistake Type, Systematic selection mistake are mainly the PCR selectivity mistake amplifications caused by the special construction of gene order.In the present embodiment As a result it is：From the 109 hybrid strain genotype obtained, 12 hybrid strain genotype are eliminated altogether, wherein 11 are hybrid strain karyogene Type, 1 is hybrid strain matter genotype, and the 97 hybrid strain genotype remained are used for subsequent analysis, and all of which is hybrid strain core Genotype, partial results are shown in Table 1.
9th, by rice varieties genotype to be measured compared with the genotype of the different cultivars in database, obtain approximate kind, Variant sites and variant sites rate, method are as follows：
If in the test, rice varieties to be measured claim the test zone with the genotype of database kind without missing For rice varieties to be measured and the shared test zone of the database kind.In shared test zone, if rice varieties to be measured with The genotype of database kind is incomplete same, then the test zone where the incomplete same genotype is referred to as rice to be measured The difference site of kind and the database kind, corresponding genotype Differential genotype each other, difference site rate=difference site Number/shared test zone number.The minimum kind of difference bit rate is obtained from database and is referred to as rice varieties to be measured Approximate kind, corresponding difference site are referred to as variant sites, number/shared test zone of variant sites rate=variant sites Number.
In the present embodiment, the 1st kind " Jin Ke 1A " the shared test zone number of rice varieties and database to be measured For 2025.In the 1st shared test zone, rice varieties to be measured with " Jin Ke 1A " genotype is respectively ACCC and CGTT, The two is incomplete same, and therefore, the 1st shared test zone is rice varieties to be measured and " Jin Ke 1A " difference site, CGTT It is rice varieties to be measured and " Jin Ke 1A " Differential genotype with ACCC.By identical method, by all shared test zones, Rice varieties to be measured are with " compared with Jin Ke 1A " genotype, finding to share 153 difference sites, difference site rate=153/2030= 7.56%.By identical method, rice varieties to be measured and all 1137 interracial difference sites rate in database are obtained, and It is " R8377 ", only 1 difference site to obtain the minimum kind of difference site rate, and it is the non-universal test zone of numbering 10 (being shown in Table 1), difference site rate are 0.05%.Therefore, " R8377 " be rice varieties to be measured approximate kind, rice varieties to be measured Variant sites rate be 0.05%.
Tenth, by hybrid strain genotype compared with the genotype of the different cultivars in database, after obtaining hybrid strain kind, calculate miscellaneous Strain rate, method are as follows：
Obtain hybrid strain kind：The kind that hybrid strain kind is present in database, and the potential hybrid strain genotype of hybrid strain kind Having the number of the test zone of phase homogenic type to account for hybrid strain kind between hybrid strain genotype has the test of potential hybrid strain genotype Total ratio >=60% in region, wherein, the difference between all genotype of potential hybrid strain genotype and rice varieties to be measured There are insertion or the missing of discontinuous base in quantity >=2 of base or distinguishing base.Hybrid strain kind is divided into nucleus hybrid strain product Kind and cytoplasm hybrid strain kind, wherein, nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained merely with karyogene type, carefully Kytoplasm hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype.For example, it is assumed that the base of the kind in database When because of type being respectively AA, AA, AA/TT, AA/TT, AA/TT, AA/TT and AA, the corresponding genotype of rice varieties to be measured is respectively AA, AA/TT, TT, AA, TT/CC, GG/CC and during-A, corresponding potential hybrid strain genotype is：Nothing, nothing, AA, TT, AA, AA/TT And AA.Heterozygous genotypes are not present in general pure line cultivar, but only a few site there may be, in addition, hybrid strain is mostly cenospecies, Heterozygous sites are more typical, therefore list various possible situations.Parameter 60% can ensure that whole hybrid strain kind detection probabilities are 100% and exist erroneous judgement hybrid strain kind probability be 0%, the determination method of the parameter value is shown in Table 2.
In the 1st test zone of the present embodiment, first kind " Jin Ke 1A " and rice varieties to be measured in database Genotype be respectively GGTT and ACCC, be that GGTT is potential hybrid strain therefore in the presence of the difference of the base of more than 2 between the two Genotype, and the potential hybrid strain genotype is identical with the hybrid strain genotype GGTT in the 1st test zone, by identical method, In the test zone for judging all karyogene types one by one, " whether Jin Ke 1A " genotype is potential to first kind in database Hybrid strain genotype, if potential hybrid strain genotype, then judge whether there is identical base between potential hybrid strain genotype and hybrid strain genotype Because of type, the results showed that, " Jin Ke 1A " share 97 test zones with potential hybrid strain genotype, all of which and same test There is phase homogenic type between the hybrid strain genotype in region, its ratio is 97/97=100%>60%, therefore, judge that " Jin Ke 1A " are Nucleus hybrid strain kind, in a similar manner, using the test zone of all matter genotype, judge that " Jin Ke 1A " are not as cytoplasm Hybrid strain kind.By identical method, judge whether all other kind is that nucleus hybrid strain kind or cytoplasm are miscellaneous in database Strain kind, the results showed that：Only " Jin Ke 1A " are nucleus hybrid strain kind, do not find cytoplasm hybrid strain kind.Result above is said It is bright：" Jin Ke 1A " are by flyings pollination rather than mechanical admixture, genotype have been mixed into rice varieties to be measured, due to " Jin Ke 1A " fertile pollens are seldom, and " Jin Ke 1A " with " Jin Ke 1B " karyogene types are identical, and therefore, mixed pollen is and " Jin Ke Identical " Jin Ke 1B " the pollen of 1A " karyogene types.
Obtain special hybrid strain genotype：Special hybrid strain genotype refers to the hybrid strain gene that only a hybrid strain kind is all Type, it includes special hybrid strain karyogene type and special hybrid strain matter genotype；Special hybrid strain karyogene type refers to an only cell All hybrid strain karyogene types of core hybrid strain kind, special hybrid strain matter genotype refer to that only a cytoplasm hybrid strain kind is all Hybrid strain matter genotype.In the present embodiment, 97 hybrid strain genotype, and all hybrid strain karyogene types, first hybrid strain are obtained altogether Karyogene type CGTT be only nucleus hybrid strain kind " Jin Ke 1A " are all, so, CGTT is " Jin Ke 1A " special hybrid strain core base Because of type.By identical method, in 97 hybrid strain genotype for judging all acquisitions one by one, all " spies that Jin Ke 1A " are possessed Different hybrid strain karyogene type.In the present embodiment, due in 97 hybrid strain genotype, no matter genotype, so, also without special hybrid strain matter Genotype.
Hybrid strain rate R principles are calculated, it is specific as follows：
Hybrid strain rate R=R1+R2-R3-R4, wherein：Wherein, N1 is the number of nucleus hybrid strain kind, and t1 is the number of all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds Mesh, i1j1 be after all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds sort from low to high by its frequency, the J1 special hybrid strain karyogene types, R1i1j1 are the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is by hybrid strain karyogene The summation of the hybrid strain rate for the nucleus hybrid strain kind that type calculates, the hybrid strain rate of nucleus hybrid strain kind are to remove nucleus hybrid strain product In kind after the frequency of the special hybrid strain karyogene type of minimum 80% and highest 10%, remaining special hybrid strain karyogene type 2 times of the average value of frequency；Wherein, t2 is except nucleus hybrid strain kind is gathered around The number of outside some hybrid strain karyogene types and frequency >=0.17% hybrid strain karyogene type, i2 are except nucleus hybrid strain kind After all hybrid strain karyogene types outside the hybrid strain karyogene type possessed sort from low to high by its frequency, the i-th 2 hybrid strain core bases Because of type, R2i2 is the frequency of the i-th 2 hybrid strain karyogene types；R2 is to utilize the hybrid strain karyogene possessed except nucleus hybrid strain kind The hybrid strain rate that type calculates, it is 80% He minimum in the frequency for remove the hybrid strain karyogene type possessed except nucleus hybrid strain kind After the value of highest 10%, 2 times of the average value of surplus value；Wherein,N2 is the number of cytoplasm hybrid strain kind, and R3i3 is the i-th 3 cells The hybrid strain rate of matter hybrid strain kind, R3i3 value when R3ic is i3=ic, ic are when rice varieties to be measured are nucleo_cytoplasmic interaction infertility System or during maintainer, the cytoplasm hybrid strain kind of corresponding maintainer or sterile line, t3 are the i-th 3 cytoplasm hybrid strain kinds The number of all special hybrid strain matter genotype, i3j3 are that all special hybrid strain matter genotype of the i-th 3 cytoplasm hybrid strain kinds are pressed After its frequency sorts from low to high, the special hybrid strain matter genotype of jth 3, R3i3j3 is the i-th 3j3 special hybrid strain matter genotype Frequency；The hybrid strain rate of sterile line that R3ic refers to the hybrid strain rate for the maintainer being mixed into sterile line or is mixed into maintainer；R3 is The summation of the hybrid strain rate of the cytoplasm hybrid strain kind calculated by hybrid strain matter genotype, the hybrid strain rate of cytoplasm hybrid strain kind are to remove It is remaining special miscellaneous in cytoplasm hybrid strain kind after the frequency of the special hybrid strain matter genotype of minimum 80% and highest 10% The average value of the frequency of strain matter genotype；Wherein, t4 is except cytoplasm hybrid strain The number of outside the hybrid strain matter genotype that kind possesses and frequency >=0.17% hybrid strain matter genotype, i4 are except cytoplasm is miscellaneous After all hybrid strain matter genotype outside the hybrid strain matter genotype that possesses of strain kind sort from low to high by its frequency, the i-th 4 miscellaneous Strain matter genotype, R4i4 are the frequency of the i-th 4 hybrid strain matter genotype；Int () is bracket function, return bracket in number it is whole Number part；R4 is the hybrid strain rate for utilizing the hybrid strain matter genotype possessed except cytoplasm hybrid strain kind to calculate, and it is to remove except cell In the frequency for the hybrid strain matter genotype that matter hybrid strain kind possesses after the value of minimum 80% and highest 10%, surplus value is averaged Value；Int () is bracket function, returns to the integer part of the number in bracket.
The flyings pollination that hybrid strain in rice varieties to be measured comes from reproductive process mixes and mechanical admixture, wherein, fly Flower pollination mix be hybrid strain variet complexity main source.Flyings pollination, which mixes, refers to that the pollen of hybrid strain kind is passed by wind-force etc. To rice varieties to be measured and the hybrid seed for formation of pollinating, flyings pollination can not possibly introduce cytoplasm, therefore can only cause hybrid strain Karyogene type, its hybrid strain rate are 2 times of hybrid strain karyogene type frequency.It is to be measured that mechanical admixture refers to that hybrid strain variety seeds are directly mixed in In rice varieties, while nucleus and cytoplasm are introduced, while form hybrid strain karyogene type and hybrid strain matter genotype, its hybrid strain Rate should be the frequency of hybrid strain matter genotype.In hybrid strain rate R calculation formula, R1+R2 over-evaluates the hybrid strain rate of mechanical admixture 1 times, need to correct, the R=R1+R2-R3-R4 after correction.It is a technical barrier to distinguish mechanical admixture with flyings pollination to mix, The present invention solves this problem.
In hybrid strain rate R calculation formula, the hybrid strain rate of nucleus hybrid strain kind is all 2 × hybrid strain karyogene type frequency, Its reason is as follows：Diploid or allopolyploid rice are 2 in the test zone of nuclear genome to be copied, therefore, hybrid strain Rate is 2 times of corresponding hybrid strain karyogene type frequency.If the test zone of the nuclear genome of N parts copy must be selected, Then coefficient should be adjusted to N, if copy number is indefinite, make N=2 processing, if wrong, it will when calculating R, by removing 80% The mode of low extremum excludes them.
In hybrid strain rate R calculation formula, merely with 10% of hybrid strain genotype frequency value in centre count Calculate, its principle is：The different hybrid strain genotype of same hybrid strain kind are determined by the hybrid strain rate of the hybrid strain kind, so the phase of frequency Prestige value is equal, and the difference between frequency is expanded by PCR, the error during high-flux sequence causes.Pass through hybrid strain gene The definition of type and rice varieties standard sample to be measured, substantially eliminate these improper values, remove 10% extremum and are enough Remove the test zone that very small amount deviates true hybrid strain rate.Why remove the 80% of minimum, and it is maximum then only remove 10%, Principle is as follows：(1) worst error source is sequencing mistake, and it is very low that hybrid strain genotype frequency caused by mistake is sequenced；(2) except In the frequency of hybrid strain genotype outside hybrid strain kind, high level is more likely the common hybrid strain genotype of different hybrid strains, is represent Real hybrid strain rate.
When rice varieties to be measured are nucleo_cytoplasmic interaction sterile line, if being wherein mixed with maintainer hybrid strain corresponding to the sterile line Kind, then, because the cytoplasm of the maintainer hybrid strain kind and rice varieties to be measured are different,
Cytoplasm hybrid strain kind will be detected as, but because the nucleus of sterile line and maintainer is just the same, will not Nucleus hybrid strain kind is detected as, therefore, R3ic value is not calculated in R1+R2, but is calculated in R3i3 , therefore imitated just, it is necessary to subtract 2 × R3ic in R3.Same reason, when rice varieties to be measured are protected for nucleo_cytoplasmic interaction Hold when being, it is also desirable to which 2 × R3ic of sterile line hybrid strain kind is imitated just corresponding to being subtracted in R3.Obviously, when rice to be measured When kind is neither nucleo_cytoplasmic interaction sterile line nor is nucleo_cytoplasmic interaction maintainer, R3ic=0.
In R2 and R4 calculation formula, it is desirable to which frequency >=0.17% of hybrid strain genotype, its principle are as follows：Work as database In kind number and detection site when reaching 10000,149 hybrid strain genotype erroneous judgements will be averagely produced, when setting hybrid strain During genotype frequency >=0.17%, probability >=99.98% (projectional technique is shown in Table 2) of the hybrid strain genotype of no erroneous judgement just can be accurate Really calculate the value to R2 and R4.It has been the limit in reality that kind number in database and detection site, which reach 10000, because This, the threshold value of frequency >=0.17% of hybrid strain genotype goes for various situations.R2 and R4 introducing so that energy of the present invention It is 0 enough in database kind, i.e., in the case that no database is supported, calculates hybrid strain rate R.
Especially, if hybrid strain kind A all hybrid strain genotype are possessed by hybrid strain kind B and other hybrid strain kinds, because And hybrid strain kind A is without special hybrid strain genotype.Now, when calculating hybrid strain rate R, hybrid strain kind A and hybrid strain kind B are not calculated Hybrid strain rate, and calculate hybrid strain kind AB hybrid strain rate.Hybrid strain kind AB hybrid strain VDA genotypes are：Hybrid strain kind A with it is miscellaneous Hybrid strain genotype common to strain kind B.
Hybrid strain rate R calculation formula is general formula, and rice varieties to be measured typically only mix a kind of hybrid strain product in reality Kind.
Calculate hybrid strain rate R hypothesis example.
Table 3 assumes a hybrid strain rate calculated examples, to become apparent from illustrating hybrid strain rate R calculating process.
Table 3 assumes example to calculate one of hybrid strain rate R
In table 3, nucleus hybrid strain kind common A and B two, so n1=2, cytoplasm hybrid strain kind number only C mono-, so N2=1.By the definition of special hybrid strain karyogene type, the special hybrid strain karyogene type for obtaining hybrid strain kind A is that numbering is No. 1-10 Hybrid strain karyogene type AA, TT, TCC, GG, AC, TTC, TCCC, GGC, ACC and AG, so, t1=10, they frequency difference For 0.10%, 1.20%, 0.10%, 0.10%, 0.02%, 0.10%, 0.10%, 0.10%, 0.10% and 0.10%, to this It is R11111=0.02%, R11121=0.02%, R11131 after 10 special hybrid strain karyogene type frequencies sort from low to high =0.10%, R11141=0.10%, R11151=0.10%, R11161=0.10%, R11171=0.10%, R11181= 0.10%th, R11191=0.10% and R111101=1.20%.From j1=Int (0.8 × t1)+1=Int (0.8 × 10)+1= 9 to j 1=t1-Int (0.1 × t1)=10-Int (0.1 × 10)+1=9 R111j1 values are R11191=0.10%, institute Using nucleus hybrid strain kind A hybrid strain rate asIn the same way, it is miscellaneous to obtain nucleus Strain kind B hybrid strain rate isThus, nucleus hybrid strain kind is obtained In a similar manner, R2=0.02%, cytoplasm hybrid strain are obtained The hybrid strain rate of kindR4=0.04%.Therefore, hybrid strain rate R=in the hypothesis example R1+R2-R3-R4=0.60%+0.02%-0.10%-0.04%=0.48%.
With reference to above-mentioned hypothesis example, the hybrid strain rate R in the present embodiment is calculated：In the present embodiment, hybrid strain kind is only " gold Section 1A " and be nucleus hybrid strain kind, R2, R3 and R4 are 0, thus, R=R1=R111." Jin Ke 1A " share 97 specifically Hybrid strain karyogene type, frequency are：0.05%th, 0.05%, 0.06%, 0.05%...... (certain embodiments are shown in Table 1), based on R Rule is calculated, after the frequency values for removing 80% (77) of minimum and 10% (9) of minimum, the average value of remaining 11 frequencies As hybrid strain rate R=0.05%.
11, using variant sites, variant sites rate and hybrid strain rate, specificity, the uniformity of rice varieties to be measured are judged And stability, method are as follows：
Wherein, SD is threshold value selected when judging specific, and M is to judge threshold selected when uniformity and stability Value.The method for judging rice varieties to be measured specificity, uniformity and stability is：When variant sites rate >=SD or non-universal tests When region has variant sites, rice varieties to be measured have specificity, and as variant sites rate ＜ SD and variant sites are not present in When in non-universal test zone, rice varieties to be measured are without specificity；It is to be measured as hybrid strain rate≤M of rice varieties to be measured Rice varieties have uniformity and stability, and when the hybrid strain rate of rice varieties to be measured is more than ＞ M, rice varieties to be measured do not have Uniformity and stability.With M values, SD values be according to breeding level, desired Stringency, mark characteristic etc. it is many because Element, artificially determine.In the present embodiment, SD selects 1% standard.
In the present embodiment, variant sites rate is 0.05%<SD=1%, but (numbering is No. 10 to non-universal test zone Test zone) variant sites (being shown in Table 1) be present, therefore, judge that rice varieties to be measured have specificity；Rice varieties to be measured it is miscellaneous 0.05%≤M=0.40% of strain rate, therefore, judge that rice varieties to be measured have uniformity and stability.
Further, after specific rice varieties to be measured, uniformity and stability is judged, the accuracy of judgement is carried out Estimation, method are as follows：
Pure lines new rice variety in the present invention refer to be sheerly genotype as target and the conventional kind of seed selection, self-mating system, The types such as restorer, maintainer, sterile line.
Specific accuracy calculates：When variant sites are not present in non-universal test zone, if judging rice varieties to be measured With specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TRUE)；If judge water to be measured Rice varieties do not have specific, the correct probability >=BINOM.DIST (SD*TRN, TRN, OD, TRUE) of conclusion, wherein, TRN is The number for the test zone that success detects, OD are variant sites rate, and BINOM.DIST is the function in excel 2010, and it is used Method is identical with the definition in excel 2010, and what it was returned is the probability of binomial distribution.What above-mentioned probability actually calculated It is：When judging to have specific, variant sites rate is more than SD probability；When judging not having specific, variant sites rate Probability less than SD, successful test zone is detected by being obtained after analyzing sequencing fragment group.
This implementation does not judge the specificity of rice varieties to be measured using variant sites rate, therefore, does not calculate specific knot By correct probability.
Uniformity calculates with stability accuracy
The correct probability of conclusion for judging the uniformity and stability of rice varieties to be measured is：When rice varieties to be measured have When uniformity and stability, correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST (the ∑ SeN* of conclusion M,∑SeN,R,TRUE)；When rice varieties to be measured do not have uniformity and stability, the correct probability of conclusion >= BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) * BINOM.DIST (∑ SeN* (1-M), ∑ SeN, 1-R, TRUE), its In, ∑ SeN is the summation of all sequencing fragments for being used for test zone where calculating the frequency of hybrid strain rate R genotype, namely After removing 80% minimum value and 10% maximum, the test fragment of test zone for calculating hybrid strain rate is remained Summation, M are to judge threshold value selected when uniformity and stability.Judge that the accuracy of uniformity and stability depends entirely on The accuracy of hybrid strain rate, and the positive rate of hybrid strain rate really depends on the accuracy of following three steps：First, rice varieties to be measured are taken out Sample accuracy, second, the accuracy of detection hybrid strain kind from extraction sample, the 3rd, calculated using the hybrid strain kind of detection miscellaneous The accuracy of strain rate.Therefore, the accuracy for judging rice varieties uniformity and stability to be measured is the product of the step accuracy of the above three. Even because the present invention is under the conditions of most stringent of, the accuracy of detection hybrid strain kind also controls more than 99.9%, actually Mostly close to 100%.For example, in the present embodiment, whole hybrid strain kind detection probabilities more than 100.0000%, In the presence of erroneous judgement hybrid strain kind probability below 0.0000% (circular is shown in Table 2).Therefore, rice product to be measured are judged The accuracy of kind uniformity and stability can be estimated as the product of the accuracy of the first step and the 3rd step, and it is respectively in above-mentioned formula The value that former and later two functions are calculated.For example, BINOM.DIST (M*SN, SN, R, TRUE) meaning is：Rice varieties to be measured enter Go SN times and sampled, the hybrid strain rate R being actually pumped is less than threshold value M probability；For calculating the every of rice varieties hybrid strain rate to be measured Rice varieties to be measured have substantially also quite been carried out single sample by one sequencing fragment, therefore, BINOM.DIST (∑ SeN* M, ∑ SeN, R, TRUE) meaning be：Rice varieties to be measured are carried out with SeN sampling of ∑, the hybrid strain rate R being actually pumped is less than Threshold value M probability.
In the present embodiment, after removing the 80% of minimum and the hybrid strain genotype frequency of maximum 10%, 11 hybrid strain bases are shared Because type frequency be used to calculate hybrid strain rate R, the sequencing fragment sum of test zone corresponding to them is 355740, so ∑ SeN=355740, also that is, 30000 samples being pumped have been carried out with 355740 sampling, so big amount of sampling again Error be fairly small.In the present embodiment, judge that rice varieties to be measured have uniformity and stability, therefore, the judgement knot By correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST (∑ SeN*M, ∑ SeN, R, TRUE)= BINOM.DIST (0.40%*30000,30000,0.05%, TRUE) * BINOM.DIST (355740*0.40%, 355740, 0.05%, TRUE)=100.0000%.It can be seen that judgement of this implementation to the uniformity and stability of rice varieties to be measured is very Accurately.
Result verification
Press《New variety of plant specificity, uniformity and stability test guide-rice》In method plant and observe and treat Rice varieties and its approximate kind " R8377 " are surveyed, finds the high resistance to hoja blanca of rice varieties to be measured, the then high sense of approximate kind. 《New variety of plant specificity, uniformity and stability test guide-rice》Middle regulation：At least in a character with approximate product When kind has obvious and reproducible difference, you can judge that the rice varieties to be measured of application possess specificity.Therefore, judge to be measured Rice varieties have specificity.In experimentation, 400 plants of rice varieties to be measured and approximate kind (200 plants one has been planted altogether Cell, totally 2 repetitions), 1 plant of special-shaped strain is found, rice varieties to be measured are selfed seed,《New variety of plant specificity, uniformity and Stability test guide-rice》Middle regulation：When selfed seed sample size is 356~818 plants, 2 plants of abnormal shapes are at most allowed for Strain, thus judges that rice varieties to be measured have uniformity.《New variety of plant specificity, uniformity and stability test guide-water Rice》Middle regulation：If a kind possesses uniformity, it is believed that the kind possesses stability.Thus judge, rice product to be measured Kind also has stability.Rice varieties to be measured pass through New variety protection office of The Ministry of Agriculture of the People's Republic of China, MOA at present DUS is tested, and is authorized, and grant number CNA20100474.1, rice varieties to be measured can obtain mandate and show this implementation Judgement in example to the specificity of rice varieties to be measured, stability and uniformity is correct.
The embodiment of the present invention is expanded by high-flux sequence and more sites, realizes the large sample sampling of rice varieties to be measured Sampled with the large sample of inter-species individual test zone, recycle and define hybrid strain genotype, define cytoplasm hybrid strain kind and definition The comprehensive means such as hybrid strain rate calculation formula, successfully realize it is accurate, quick, intactly judge the special of rice varieties to be measured The target of property, stability and uniformity, it has the technical effect that what existing DUS method of testings did not all reach.Existing molecule DUS detections Technology such as chip only detects fixed test zone, it is impossible to according to case, flexibly selects non-universal test zone.And present invention detection Be PCR primer, non-universal test zone can be detected easily according to case flexible design primer.In addition, the present invention is real Example is applied for 30000 individual amount of samplings for traditional DUS measuring technologies, work is big, can not complete, for example, field Between in DUS tests, 30000 plants of rice of sampling need more than 2 mu of rice field of plantation, and need to plant 2 years, and annual every plant of rice need to Investigate individual character more than 70., it is necessary to be 30000 DNA extractions, 30000* respectively in widely used SSR molecules DUS tests 2231 PCR and 30000*2231 PCR primer detection (assuming that as the present embodiment, have detected 2231 universal test areas Domain).Therefore, because workload is excessive, existing molecule DUS tests there all are not measuring stability and uniformity, although field DUS is tested Detect uniformity and stability, but sampling samples amount is all below 1000 plants, and the present embodiment has been sampled 30000 plants of rice, its Accuracy is obviously higher.Why the present embodiment can increase amount of sampling, be conduct after all being mixed because of all 30000 samples One sample process, and field DUS test and comparisons, workload is equivalent to being reduced to 1/30000；Further, all 2231 Mixed once amplification is all only done in universal test region and a high-flux sequence detects, with SSR molecule DUS test and comparisons, work Amount is equivalent to being reduced to 1/ (30000*2231).Therefore, the present invention realizes large sample in the case where workload significantly mitigates With more site primers, make DUS tests not only accurate but also simple.Database variety and genetype is alkali in the embodiment of the present invention simultaneously Base forms, very standard, detects same breed in the present inventive method under different experimental conditions, can obtain identical base Because of type, accordingly, it is not necessary under different conditions repeat DUS test, therefore, the embodiment of the present invention can directly with database kind Genotype compares, and objectively selects the approximate kind of rice varieties to be measured.It is to be measured and existing DUS measuring technologies are not up to standard Rice varieties abreast carry out DUS tests simultaneously with approximate kind, just reliable conclusion can be obtained, in order to mitigate workload, no Obtain not by providing approximate kind by kind power applicant, if approximate kind mistake, there may be the legal consequence of erroneous grants.
The foregoing is only presently preferred embodiments of the present invention, be not intended to limit the invention, it is all the present invention spirit and Within principle, any modification, equivalent substitution and improvements made etc., it should be included in the scope of the protection.

Claims (5)

1. a kind of method of specificity for testing pure lines new rice variety, uniformity and stability, it is characterised in that methods described Including：
Obtain the variant sites between different rice varieties；
The test zone of rice varieties to be measured is determined by the variant sites, the test zone includes universal test region, At least partly described variant sites are included in the universal test region, and the universal test is determined by the variant sites The method in region is：Pass through discriminationThe value of discrimination is calculated, wherein, a is tested in variation window area The kind sum measured, bi are the kind number of i-th kind of genotype in the variation window area, and bi>1, k is comprising more than 1 The number of the genotype of individual kind, the variation window area is centered on each single nucleotide variations site, to the list The both sides in nucleotide diversity site respectively extend 1/2 window as detection for surveying sequence length, and the universal test region is thin The discrimination is big on the big region of discrimination or nuclear genome in cytogene group and equally distributed region, wherein, The genotype is the combination in multiple single nucleotide variations sites in the test zone；
Structure includes database of the rice varieties to be measured in the genotype of all test zones；
After the amount of sampling SN for determining the rice varieties to be measured, random sampling mixes and extracts the DNA of mixing sample, the sampling Amount SN meets following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV are in excel 2010 Function, to judge threshold value selected when the uniformity and stability, the condition implication of the amount of sampling SN satisfactions is M： Even if the hybrid strain rate only exceeds the 15% of threshold value M, the amount of sampling can correctly judge described treat in the case where 95% probability ensures Survey the stability and uniformity of rice varieties；
The primer for expanding the test zone is prepared, the primer includes universal test region primer；
Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, the expansion Volume increase thing is used to build high-throughput sequencing library；
High-flux sequence is carried out to the high-throughput sequencing library, obtains that fragment group, the depth CF of the high-flux sequence is sequenced Meet following condition：BINOM.DIST (10,10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, CF is the depth of the high-flux sequence, and M is to judge the uniformity With threshold value selected during stability, BINOM.DIST be excel 2010 in function, the depth CF of the high-flux sequence The condition implication of satisfaction is：The hybrid strain rate as little as 0.1%, the hybrid strain kind be 10 and the hybrid strain kind with it is described Under conditions of averagely only having 20 difference sites between rice varieties to be measured, the detection that is determined by the depth CF of the high-flux sequence All probability >=99.9% of the hybrid strain kind；The database kind for 10000 and the hybrid strain kind and institute State under conditions of averagely only having 20 difference sites between rice varieties to be measured, deposited by what the depth CF of the high-flux sequence was determined Judging probability≤0.1% of the hybrid strain kind by accident；In the hybrid strain kind be 10 and true hybrid strain rate exceeds only judgement spy When different in nature selected threshold value 10% when, stability and uniformity are sentenced by what the depth CF of the high-flux sequence was determined Determine correct probability >=95.0% of conclusion；
The sequencing fragment group is analyzed, obtains rice varieties genotype and hybrid strain genotype to be measured；
By the rice varieties genotype to be measured compared with the genotype of the different cultivars in the database, described in acquisition Approximate kind, variant sites and the variant sites rate of rice varieties to be measured；
By the hybrid strain genotype compared with the genotype of the different cultivars in the database, after obtaining hybrid strain kind, Calculate hybrid strain rate；
Using the variant sites, the variant sites rate and the hybrid strain rate, the rice varieties specificity to be measured, one are judged Cause property and stability, the test zone also include non-universal test zone, and the primer also draws including non-universal test zone Thing, when the variant sites be present in the variant sites rate >=non-universal test zones of SD or described, the rice product to be measured Kind has specificity, when the variant sites rate ＜ SD and the variant sites are not present in the non-universal test zone When, the rice varieties to be measured do not have specificity, wherein, SD is threshold value selected when judging specific；
As the hybrid strain rate≤M of the rice varieties to be measured, the rice varieties to be measured have uniformity and stability, when When the hybrid strain rate of the rice varieties to be measured is more than ＞ M, the rice varieties to be measured do not have uniformity and stability, and M is to sentence Selected threshold value when the uniformity and stability of breaking；
The hybrid strain rate R=R1+R2-R3-R4, wherein：
Wherein, n1 is the number of nucleus hybrid strain kind, and t1 is all special hybrid strains of the i-th 1 nucleus hybrid strain kinds The number of karyogene type, i1j1 are that all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds press frequency After sorting from low to high, the special hybrid strain karyogene type of jth 1, R1i1j1 is the i-th 1j1 special hybrid strain karyogenes The frequency of type, R1 are the summation of the hybrid strain rate of the nucleus hybrid strain kind calculated by hybrid strain karyogene type, described thin The hybrid strain rate of karyon hybrid strain kind is to remove the institute of 80% and highest 10% minimum in the nucleus hybrid strain kind After the frequency for stating special hybrid strain karyogene type, 2 times of the average value of the frequency of the remaining special hybrid strain karyogene type；
Wherein, t2 is described in addition to the hybrid strain karyogene type that the nucleus hybrid strain kind possesses and frequency >=0.17% The number of hybrid strain karyogene type, i2 are all institutes in addition to the hybrid strain karyogene type that the nucleus hybrid strain kind possesses State after hybrid strain karyogene type sorts from low to high by frequency, the i-th 2 hybrid strain karyogene types, R2i2 is described miscellaneous for the i-th 2 The frequency of strain karyogene type；R2 is to utilize to remove the described of the hybrid strain karyogene type calculating that the nucleus hybrid strain kind possesses Hybrid strain rate, R2 are 80% He minimum in the frequency for remove the hybrid strain karyogene type possessed except the nucleus hybrid strain kind After the value of highest 10%, 2 times of the average value of surplus value；
Wherein,N2 is the number of cytoplasm hybrid strain kind, and R3i3 is the i-th 3 The hybrid strain rate of the individual cytoplasm hybrid strain kind, R3i3 value when R3ic is i3=ic, ic are when the kind to be measured is When nucleo_cytoplasmic interaction sterile line or maintainer, the cytoplasm hybrid strain kind of the corresponding maintainer or the sterile line, T3 is the number of all special hybrid strain matter genotype of the i-th 3 cytoplasm hybrid strain kinds, and i3j3 is the i-th 3 cells After all special hybrid strain matter genotype of matter hybrid strain kind sort from low to high by frequency, the special hybrid strain matter of jth 3 Genotype, R3i3j3 are the frequency of the i-th 3j3 special hybrid strain matter genotype, and R3ic refers to the institute being mixed into the sterile line State the hybrid strain rate of maintainer or the hybrid strain rate for the sterile line being mixed into the maintainer；R3 is to be calculated by hybrid strain matter genotype The cytoplasm hybrid strain kind the hybrid strain rate summation, the hybrid strain rate of the cytoplasm hybrid strain kind is described thin to remove It is remaining described in kytoplasm hybrid strain kind after the frequency of the special hybrid strain matter genotype of minimum 80% and highest 10% The average value of the frequency of special hybrid strain matter genotype；
Wherein, t4 is in addition to the hybrid strain matter genotype that the cytoplasm hybrid strain kind possesses and frequency >=0.17% The number of the hybrid strain matter genotype, i4 are the institute in addition to the hybrid strain matter genotype that the cytoplasm hybrid strain kind possesses After having the hybrid strain matter genotype to be sorted from low to high by frequency, the i-th 4 hybrid strain matter genotype, R4i4 is the i-th 4 institutes State the frequency of hybrid strain matter genotype；R4 is to utilize the hybrid strain matter genotype possessed except the cytoplasm hybrid strain kind to calculate The hybrid strain rate, R4 are minimum in the frequency for remove the hybrid strain matter genotype possessed except the cytoplasm hybrid strain kind 80% and highest 10% value after, the average value of surplus value；
Int () is bracket function；
The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm hybrid strain merely with karyogene type Kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to only one All hybrid strain karyogene types of the nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only described in one All hybrid strain matter genotype of cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is described Karyogene type, the karyogene type refer to the genotype and are located on nuclear genome；The hybrid strain matter genotype refers to described Hybrid strain genotype is the matter genotype, and the matter genotype refers to that the genotype is located on cytoplasmic skeleton.
2. according to the method for claim 1, it is characterised in that the non-universal test zone primer include the first primer and Second primer, first primer include the first forward primer and the first reverse primer, and it is positive that second primer includes second Primer and the second reverse primer, first primer and second primer carry out respectively individually amplification obtain two it is described non-through With the amplified production of test zone, the amplified production mixed in equal amounts of two non-universal test zones is used to build independent expansion The high-throughput sequencing library of increasing；
5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first is reverse 5 ' end connections in primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；
5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second is reverse 5 ' end connections of primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.
3. according to the method for claim 1, it is characterised in that methods described also includes treating described in judgement in the following ways The correct probability of conclusion of uniformity and stability for surveying rice varieties is：When the rice varieties to be measured have uniformity and steady When qualitative, correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST of conclusion (∑ SeN*M, ∑ SeN, R, TRUE)；When the rice varieties to be measured do not have the uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M)*SN,SN,(1-R),TRUE)*BINOM.DIST(∑SeN*(1-M),∑SeN,1-R,TRUE)；Wherein, M is judgement Selected threshold value when the uniformity and stability, ∑ SeN are all genotype for being used to calculate the hybrid strain rate R The summation of the sequencing fragment of the test zone where frequency, BINOM.DIST (M*SN, SN, R, TRUE) is the rice to be measured Kind has carried out SN sampling, and the hybrid strain rate R being actually pumped is less than the probability of the threshold value M, BINOM.DIST (∑ SeN* M, ∑ SeN, R, TRUE) for the rice varieties to be measured have been carried out with SeN sampling of ∑, the hybrid strain rate R being actually pumped is less than threshold Value M probability.
4. according to the method for claim 1, it is characterised in that when the change dystopy is not present in the non-universal test zone During point, if it is specific to judge that the rice varieties to be measured have, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN,1-OD,TRUE)；If judge the rice varieties to be measured without specificity, the correct probability >=BINOM.DIST of conclusion (SD*TRN, TRN, OD, TRUE), wherein, TRN is the number for detecting successful test zone, and OD is the variant sites rate, BINOM.DIST is the function in excel2010, and the correct probability of conclusion, which is expressed as working as, judges the rice varieties to be measured During with specificity, the variant sites rate is more than SD probability, when judging that the rice varieties to be measured do not have specific, The variant sites rate is less than SD probability, and the successful test zone of detection after analyzing the sequencing fragment group by obtaining .
5. according to the method for claim 1, it is characterised in that obtaining the method for the hybrid strain kind includes：The hybrid strain Kind is the kind being present in the database, and the potential hybrid strain genotype of the hybrid strain kind and the hybrid strain genotype Between have phase homogenic type the number of the test zone account for the hybrid strain kind there is the described of the potential hybrid strain genotype Total ratio >=60% of test zone；The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；
Quantity >=2 or described of distinguishing base between all genotype of the potential hybrid strain genotype and the kind to be measured There are insertion or the missing of discontinuous base in distinguishing base.
CN201510148635.0A 2015-03-31 2015-03-31 A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability Active CN104805184B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510148635.0A CN104805184B (en) 2015-03-31 2015-03-31 A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510148635.0A CN104805184B (en) 2015-03-31 2015-03-31 A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability

Publications (2)

Publication Number Publication Date
CN104805184A CN104805184A (en) 2015-07-29
CN104805184B true CN104805184B (en) 2018-03-20

Family

ID=53690380

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510148635.0A Active CN104805184B (en) 2015-03-31 2015-03-31 A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability

Country Status (1)

Country Link
CN (1) CN104805184B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108866225B (en) * 2018-06-21 2022-05-06 江汉大学 Screening method for genetic background of genetically modified rice

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104328507A (en) * 2014-10-11 2015-02-04 中国水稻研究所 SNP chip used for identifying rice variety, preparation method and application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104328507A (en) * 2014-10-11 2015-02-04 中国水稻研究所 SNP chip used for identifying rice variety, preparation method and application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Evaluation of the use of high-density SNP genotyping to implement UPOV Model 2 for DUS testing in barley;Huw Jones et al;《Theor. Appl. Genet.》;20121212;第126卷;第901-911页， 参见对比文件1摘要、第901-902页、第906页、图1-2、表1-5 *

Also Published As

Publication number Publication date
CN104805184A (en) 2015-07-29

Similar Documents

Publication Publication Date Title
Williams et al. [51] Genetic analysis using random amplified polymorphic DNA markers
CN104846076B (en) A method of specificity, consistency and the stability of measurement cross-bred rape new varieties
CN105525024B (en) A kind of special SNP marker and application identifying No. 4 biological strain resistances of celery cabbage clubroot
CN108779459A (en) Cotton whole genome snp chip and its application
US20210285063A1 (en) Genome-wide maize snp array and use thereof
US11739374B2 (en) Methods and compositions for pathogen detection in plants
CN104830975A (en) Novel method for testing corn parent source authenticity and proportion
CN117683927A (en) Functional KASP molecular marker of rice blast resistance gene and application thereof
CN104805184B (en) A kind of method of the specificity for testing pure lines new rice variety, uniformity and stability
CN108103239A (en) Identify SNP marker A045736268C/T and its application of cabbage turnip mosaic virus resistance
CN105603081B (en) Non-diagnosis-purpose qualitative and quantitative detection method for intestinal microorganisms
CN107815489A (en) A kind of method for screening the high polymorphic molecular marker site of plant
CN104805182B (en) A kind of method for the specificity, uniformity and stability for determining new hybrid rice varieties
CN104805189B (en) A kind of method of the specificity for determining hybrid plant new varieties, uniformity and stability
CN104805187B (en) A kind of method of the specificity for testing pure lines new soybean varieties, uniformity and stability
CN104805191B (en) A kind of method of the specificity for testing pure lines corn variety, uniformity and stability
CN104805190B (en) A kind of method of the specificity for determining hybrid maize variety, uniformity and stability
CN104846077B (en) A method of specificity, consistency and the stability of test pure lines new rape variety
CN104805186B (en) A kind of method for testing corn variety substance derived relation
CN104805185B (en) A kind of method of test plants kind substance derived relation
CN104805183A (en) Method for testing distinctness, uniformity and stability of pure-line plant new variety
CN104805188B (en) A kind of method for testing soybean varieties substance derived relation
CN104805195A (en) Novel method for testing rice parental source authenticity and proportion of rice parental source
CN115029452B (en) MNP (MNP) marking site of Legionella, primer composition, kit and application of MNP marking site
CN117757979B (en) Primer group, kit and identification method for identifying soybean varieties

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant