CN104805182B

CN104805182B - A kind of method for the specificity, uniformity and stability for determining new hybrid rice varieties

Info

Publication number: CN104805182B
Application number: CN201510148540.9A
Authority: CN
Inventors: 魏传斌; 彭海; 陈红; 张静; 高利芬
Original assignee: Agriculture Ministry Technology Development Center; Jianghan University
Current assignee: Agriculture Ministry Technology Development Center; Jianghan University
Priority date: 2015-03-31
Filing date: 2015-03-31
Publication date: 2017-09-01
Anticipated expiration: 2035-03-31
Also published as: CN104805182A

Abstract

The invention discloses a kind of method for the specificity, uniformity and stability for determining new hybrid rice varieties.Methods described includes：Obtain variant sites；Determine the test zone of rice varieties to be measured；Build database；Determine after amount of sampling, random sampling mixes and extracts the DNA of mixing sample；Prepare primer；Expanded using the DNA of primer pair mixing sample, amplified production is used to build high-throughput sequencing library；High-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced；Analysis sequencing fragment group, obtains rice varieties genotype to be measured and hybrid strain genotype；Compare the approximate kind of acquisition, variant sites and variant sites rate；Obtain after hybrid strain kind, calculate hybrid strain rate；Using variant sites, variant sites rate and hybrid strain rate, rice varieties specificity to be measured, uniformity and stability are judged.Methods described can accurately, intactly judge the specificity, stability and uniformity of rice varieties to be measured, and test speed is faster.

Description

A kind of method for the specificity, uniformity and stability for determining new hybrid rice varieties

Technical field

The present invention relates to biological technical field, more particularly to a kind of specificity, uniformity for determining new hybrid rice varieties With the method for stability.

Background technology

As a kind of intellectual property of specialization, new variety of plant has become a company and competing to a national core Strive power.The solution that new variety of plant authorizes account and relative legal problems is tested dependent on DUS, i.e. the specificity to rice varieties to be measured (Distinctness), the field trapping test or molecules inside of uniformity (Uniformity) and stability (Stability) Marker Identification.Field trapping test flow is：Rice varieties to be measured and approximate kind are planted in field simultaneously, in 2 years and more than The season of growth in, observe their multiple characters, the difference of rice varieties to be measured and approximate kind judged according to trait expression Conspicuousness, i.e., it is specific, while judging hybrid strain ratio in colony, i.e. uniformity and stability；The stream of molecules inside Marker Identification Cheng Wei：Individual plant is divided to extract the DNA of rice varieties to be measured and each sample in approximate kind, and each survey to each sample respectively Performing PCR (Polymerase Chain Reaction, polymerase chain reaction) is entered in examination region, and carries out electrophoresis to each PCR primer Or generation sequencing detection, according to testing result, the difference site ratio of rice varieties to be measured and approximate kind is obtained, according to difference Site ratio, judges the specificity of rice varieties to be measured.

The shortcoming of field trapping test is：Cycle length, workload are big, and ambient influnence character causes to judge inaccurate.It is indoor The shortcoming of molecular markers for identification is：Need to handle each test zone of each sample respectively, workload is big, it is impossible to sample with Test zone bulk sampling, it is impossible to calculate hybrid strain rate, thus the test of stability and uniformity can not be carried out.Field trapping test Common drawback with molecules inside Marker Identification is：Due to workload is big, it is impossible to the objective selection from existing kind Approximate kind, can only be provided by kind power applicant, and the approximate product provided based on the motivations such as commercial interest, kind power applicant Planting may be untrue, so as to cause the legal consequence of wrong kind mandate.

The content of the invention

In order to solve the problems of the prior art, the embodiments of the invention provide a kind of spy for determining new hybrid rice varieties The method of the opposite sex, uniformity and stability.The technical scheme is as follows：

The embodiments of the invention provide a kind of side for the specificity, uniformity and stability for determining new hybrid rice varieties Method, methods described includes：

Obtain the variant sites between different rice varieties；

The test zone of the rice varieties to be measured is determined by the variant sites, the test zone includes general survey Region is tried, at least partly described variant sites are included in the universal test region determines described lead to by the variant sites It is with the method for test zone：Pass through discriminationThe value of discrimination is calculated, wherein, a is variation window region The kind sum being detected in domain, bi is the kind number of i-th kind of genotype in the variation window area, and bi>1, k is bag The number of genotype containing more than a kind, the variation window area be centered on each single nucleotide variations site, to The both sides in the single nucleotide variations site respectively extend survey sequence length 1/2 as the window detected, the universal test area Domain is that the discrimination is big on the big region of discrimination or nuclear genome and equally distributed region on cytoplasmic skeleton, Wherein, the genotype is the combination in multiple single nucleotide variations sites in the test zone；

Build the database of the genotype in all test zones comprising the different cultivars；

After the amount of sampling SN for determining the rice varieties to be measured, random sampling mixes and extracts the DNA of mixing sample；

The primer of the amplification test zone is prepared, the primer includes universal test region primer；

Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, institute Stating amplified production is used to build high-throughput sequencing library；

High-flux sequence is carried out to the high-throughput sequencing library, obtains that fragment group is sequenced；

The analysis sequencing fragment group, obtains rice varieties genotype to be measured and hybrid strain genotype；

The rice varieties genotype to be measured is compared with the genotype of the different cultivars in the database, obtained Approximate kind, variant sites and the variant sites rate of the rice varieties to be measured；

The hybrid strain genotype is compared with the genotype of the different cultivars in the database, hybrid strain kind is obtained Afterwards, hybrid strain rate is calculated；

Using the variant sites, the variant sites rate and the hybrid strain rate, judge that the rice varieties to be measured are special Property, uniformity and stability.

Specifically, the amount of sampling SN meets following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV is the function in excel 2010, and M is described to take out to judge threshold value selected when the uniformity and stability Sample amount SN meet condition implication be：Even if the hybrid strain rate only exceeds the 15% of the judgment threshold M of uniformity and stability, institute Amount of sampling is stated in the case where 95% probability ensures, the stability and uniformity of the rice varieties to be measured can be correctly judged.

Specifically, the depth CF of the high-flux sequence meets following condition：BINOM.DIST(10,10,BI NOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BIN OM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, its In, CF is the depth of the high-flux sequence, and M is to judge threshold value selected when the uniformity and stability, BINOM.DIST is the function in excel 2010, and the condition implication that the depth CF of the high-flux sequence is met is：Described Hybrid strain rate as little as 0.1%, the hybrid strain kind are averagely to only have between 10 and the hybrid strain kind and the rice varieties to be measured Under conditions of 20 difference sites, by the probability of the depth CF of the high-flux sequence whole hybrid strain kinds of detection determined >=99.9%；It is to be averaged only between 10000 and the hybrid strain kind and the rice varieties to be measured in the kind of the database Have under conditions of 20 difference sites, the general of the hybrid strain kind is judged by accident by the depth CF of the high-flux sequence presence determined Rate≤0.1%；In the hybrid strain kind be 10 and true hybrid strain rate exceeds only threshold value selected when judging specificity When 10%, by the depth CF of the high-flux sequence determine to the correct probability of the judgement conclusion of stability and uniformity >= 95.0%.

Specifically, the test zone also includes non-universal test zone, and the primer also includes non-universal test zone Primer.

Further, the non-universal test zone primer includes the first primer and the second primer, the first primer bag The first forward primer and the first reverse primer are included, second primer includes the second forward primer and the second reverse primer, described First primer and second primer carry out the amplified production that individually amplification obtains two non-universal test zones respectively, will The amplified production mixed in equal amounts of two non-universal test zones is used to build the high-throughput sequencing library individually expanded；

5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first 5 ' end connections in reverse primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；

5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second 5 ' end connections of reverse primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

Further, using the variant sites, the variant sites rate and the hybrid strain rate, the paddy rice to be measured is judged The method of varietY specificity, uniformity and stability includes：

When there are the variant sites in the variant sites rate >=SD or described non-universal test zones, the water to be measured Rice varieties have specificity, as the variant sites rate ＜ SD and the variant sites are not present in the non-universal test zone When, the rice varieties to be measured are without specificity, selected threshold value when wherein SD is judges specific；

As the hybrid strain rate≤M of the rice varieties to be measured, the rice varieties to be measured have uniformity and stably Property, when the hybrid strain rate of the rice varieties to be measured is more than ＞ M, the rice varieties to be measured are without uniformity and stably Property, M is to judge threshold value selected when the uniformity and stability；

The hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：

Wherein, n1 is the number of nucleus hybrid strain kind, and t1 is the The number of all special hybrid strain karyogene types of i1 nucleus hybrid strain kinds, i1j1 is the i-th 1 nucleus hybrid strains After all special hybrid strain karyogene types of kind sort from low to high by its frequency, the special hybrid strain karyogene of jth 1 Type, R1i1j1 is the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is the institute that is calculated by the hybrid strain karyogene type The summation of the hybrid strain rate of nucleus hybrid strain kind is stated, the hybrid strain rate of the nucleus hybrid strain kind is to remove the nucleus hybrid strain In kind after the frequency of the special hybrid strain karyogene type of minimum 80% and highest 10%, the remaining special hybrid strain 2 times of the average value of the frequency of karyogene type；

Wherein, t2 be except the nucleus hybrid strain kind possess it is described miscellaneous The number of outside the strain karyogene type and hybrid strain karyogene type of frequency >=0.17%, i2 is except the nucleus hybrid strain product After all hybrid strain karyogene types outside the hybrid strain karyogene type kind possessed sort from low to high by its frequency, the i-th 2 The individual hybrid strain karyogene type, R2i2 for the i-th 2 hybrid strain karyogene types frequency；R2 is utilized except the nucleus is miscellaneous The hybrid strain rate that the hybrid strain karyogene type that strain kind possesses is calculated, it is to remove the institute possessed except the nucleus hybrid strain kind After the value for stating 80% and highest 10% minimum in the frequency of hybrid strain karyogene type, 2 times of the average value of surplus value；

Wherein, n2 is the number of cytoplasm hybrid strain kind, and R3i3 is The hybrid strain rate of the i-th 3 cytoplasm hybrid strain kinds, t3 for the i-th 3 cytoplasm hybrid strain kinds all special hybrid strain matter The number of genotype, i3j3 presses its frequency for all special hybrid strain matter genotype of the i-th 3 cytoplasm hybrid strain kinds After sorting from low to high, the special hybrid strain matter genotype of jth 3, R3i3j3 is the i-th 3j3 special hybrid strain matter genes The frequency of type；R3 is the summation of the hybrid strain rate of the cytoplasm hybrid strain kind calculated by hybrid strain matter genotype, the cytoplasm The hybrid strain rate of hybrid strain kind is remove 80% and highest 10% minimum in the cytoplasm hybrid strain kind described special miscellaneous After the frequency of strain matter genotype, the average value of the frequency of the remaining special hybrid strain matter genotype；

Wherein, t4 is the hybrid strain matter base possessed except the cytoplasm hybrid strain kind Because of the number of the hybrid strain matter genotype of outside type and frequency >=0.17%, i4 is except the cytoplasm hybrid strain kind possesses The hybrid strain matter genotype outside all hybrid strain matter genotype sorted from low to high by its frequency after, described in the i-th 4 Hybrid strain matter genotype, R4i4 for the i-th 4 hybrid strain matter genotype frequency；R4 is to utilize to remove the cytoplasm hybrid strain kind The hybrid strain rate that the hybrid strain matter genotype possessed is calculated, it is to remove the hybrid strain possessed except the cytoplasm hybrid strain kind In the frequency of matter genotype after the value of minimum 80% and highest 10%, the average value of surplus value；

Wherein, t5 is the number of the special test zone of hybrid；I5 is the i-th 5 hybrids Special test zone；Rmi5 is in the i-th 5 special test zone of hybrid, the frequency of female genotype；Rfi5 is the i-th 5 In the special test zone of hybrid, the frequency of male parent gene type；The hybrid strain rate of Rm female parent selfings, it is that the hybrid is specifically surveyed Try in region, the average value of the frequency of the female genotype and the difference of the frequency of the male parent gene type；

Int () is bracket function；

The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm merely with karyogene type Hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to All hybrid strain karyogene types of one nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only one All hybrid strain matter genotype of the cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is The karyogene type；The hybrid strain matter genotype refers to that the hybrid strain genotype is the matter genotype；It is special in the hybrid In test zone, the female genotype is differed with the male parent gene type, the female genotype and all cells The genotype of core hybrid strain kind is different, and the male parent gene type and all nucleus hybrid strain kinds genotype not yet Together；During the female genotype is the rice varieties to be measured, with maternal genotype identical genotype；The male parent gene Type be the rice varieties to be measured in, the genotype identical genotype with male parent；

The karyogene type refers to the genotype on nuclear genome；The matter genotype refers to be located at cytoplasm base Because of the genotype in group.

Further, methods described also includes the uniformity and stably for judging the rice varieties to be measured in the following ways The correct probability of conclusion of property is：When the rice varieties to be measured have uniformity and stability, the correct probability of conclusion >= BINOM.DIST(M*SN,SN,R,TRUE)*BINOM.DIST(∑SeN*M,∑SeN,R,TRUE)；When the paddy rice product to be measured When kind not having the uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M) * SN, SN, (1-R), TRUE)*BINOM.DIST(∑SeN*(1-M),∑SeN,1-R,TRUE)；Wherein, M is when judging the uniformity and stability Selected threshold value, ∑ SeN is used for the test zone where calculating the frequency of the genotype of the hybrid strain rate R to be all Sequencing fragment summation, BINOM.DIST (M*SN, SN, R, TRUE) be the rice varieties to be measured carried out SN time sample, The hybrid strain rate R being actually pumped is less than the probability of the threshold value M, BINOM.DIST (Σ SeN*M, Σ SeN, R, TRUE) meaning Justice is：The rice varieties to be measured are carried out with SeN sampling of ∑, the hybrid strain rate R being actually pumped is less than the general of threshold value M Rate；BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) is that the rice varieties to be measured have carried out SN sampling, is actually taken out The hybrid strain rate R obtained is more than the probability of the threshold value M, BINOM.DIST (Σ SeN* (1-M), ∑ SeN, 1-R, TRUE) meaning Justice is：The rice varieties to be measured are carried out with SeN sampling of ∑, the hybrid strain rate R being actually pumped is more than the general of threshold value M Rate, the frequency of the genotype refers in the sequencing fragment group that the sequencing segments for representing the genotype accounts for the gene The ratio of the sequencing fragment sum of the test zone where type.

Further, when the variant sites are not present in the non-universal test zone, if judging the paddy rice to be measured Kind has specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TRUE)；If judging institute State rice varieties to be measured and do not have specific, the correct probability of conclusion >=BINOM.DI ST (SD*TRN, TRN, OD, TRUE), its In, TRN is detects the number of successful test zone, and OD is the variant sites rate, and BINOM.DIST is in excel 2010 Function, the correct probability of conclusion be expressed as when judge the rice varieties to be measured have specificity when, the change dystopy Point rate is more than SD probability, and when judging the rice varieties to be measured without specificity, the variant sites rate is less than SD's Probability, the successful test zone of detection after analyzing the sequencing fragment group by obtaining.

Specifically, obtaining the method for the hybrid strain kind includes：The hybrid strain kind is to be present in the database Kind, and the hybrid strain kind potential hybrid strain genotype with there is the test section of phase homogenic type between the hybrid strain genotype The number in domain accounts for total ratio >=60% that the hybrid strain kind has the test zone of the potential hybrid strain genotype； The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；

Quantity >=2 of distinguishing base between the potential hybrid strain genotype and all genotype of the rice varieties to be measured There are insertion or the missing of discontinuous base in individual or described distinguishing base.

The beneficial effect that technical scheme provided in an embodiment of the present invention is brought is：Method provided in an embodiment of the present invention passes through High-flux sequence and the amplification of many sites, realize the big of the large sample sampling of rice varieties to be measured and each individual test zone Sample is sampled, and recycles the comprehensive means such as hybrid strain genotype and hybrid strain rate, successfully realize it is accurate, intactly judge water to be measured The target of the specificity of rice varieties, stability and uniformity, and test speed is faster, can be completed within 10 days.

Embodiment

To make the object, technical solutions and advantages of the present invention clearer, embodiment of the present invention will be made into one below It is described in detail on step ground.

Embodiment one, measure new rice variety ' specificity, uniformity and the stability of section excellent 8377 '

Rice varieties to be measured provided in an embodiment of the present invention are rice varieties " section excellent 8377 ", rice varieties " section excellent 8377 " For rice varieties " R8377 " with " Jin Ke 1A " cross combination, above kind is open known kind.Determine the paddy rice product The method of specificity, uniformity and the stability planted comprises the following steps.

First, the variant sites between different rice varieties are obtained.

Variant sites between different rice varieties can be obtained from the documents and materials announced, but this method is obtained Results contrast is fragmentary, in the present embodiment, by by the genome sequence of different paddy rice and with reference to the genome sequence of rice varieties Row are compared, and obtain the variant sites between substantial amounts of different rice varieties, wherein can be " Japan with reference to rice varieties Eyeball " paddy rice, is somebody's turn to do " Japanese eyeball " paddy rice and could alternatively be other known reference rice varieties.

Further, the method for obtaining the genome sequence of different rice varieties is as follows：

The genome sequence of the different rice varieties of the present embodiment shows three kinds of sources, and the first is Han Bin to 1082 paddy rice The high-flux sequence sequence of the genome of kind, pertinent literature information is as follows：Huang XH et al.A map of rice genome variation reveals the origin of cultivated rice.Nature.2012；7:497–503. The genome sequence of 1082 rice varieties is published in European NucleotideArchive (http:// Www.ebi.ac.uk/ena/), reception number is ERP001143, ERP000729 and ERP000106；Second be Xu Xun to 50 The high-flux sequence sequence of the genome of rice varieties, pertinent literature information is as follows：Xun X et al.Resequencing 50accessions of cultivated and wild rice yields markers for identifying agronomically important genes.Nat Biotechnol.2011,30(1):105-11,50 rice varieties Genome sequence be published in NCBI Short Read Archive (http://www.ncbi.nlm.nih.gov/sra), connect Collect the digits for SRA023116；The third be by the method provided in the above-mentioned articles delivered of Han Bin to " R8377 ", " Jin Ke 1A ", " " D excellent 527 " has carried out high-flux sequence to Jin Ke 1A/R7723 " with hybrid strain kind for " IRBB23 ", cenospecies.The present embodiment is obtained altogether The high-flux sequence sequence of the genome of 1137 rice varieties.

Further, variant sites are obtained using the genome sequence of different cultivars.

Specifically, because the sequencing depth of this 1137 rice varieties is not high, identification single nucleotide variations (SNP) are only capable of Site, other variation types are as repeated number variation, due to a low credibility, without identification.Utilize Frederick Sanger ratios " Japan is compared respectively by the high-flux sequence sequence of the genome of this 1137 rice varieties to software (version number is 0.4) (version is IRGSP 4.0, download address to eyeball " rice cell core reference gene group：http://www.ncbi.nlm.nih.gov) In cytoplasm reference gene group, the cytoplasm reference gene group includes mitochondria reference gene group and chloroplaset reference gene Group, it is in NCBI (National Center for Biotechnology Information, US National biotechnology letter Breath center) on reception number be respectively NC_011033 and NC_001320.During contrast, Insert Fragment length is set to 500bp, other Parameter setting is default value.The Ssaha Pileup software kits (version number is 0.5) used identify the SNP positions of each rice varieties Point.The SNP site is defined as the missing of base-pair, the insertion of single base or the single base of difference determination.The alkali that the difference is determined Base is to referring to not include the uncertain base-pair of difference, and the uncertain base-pair of difference refers to the base between some degeneracy bases It is right, as R represents A or G, therefore, difference is there may be between A and R, it is also possible to which, in the absence of difference, therefore, difference is failed to understand between A and R Really, SNP it is not mutually.Therefore, the SNP site in the embodiment of the present invention is including the uncertain base-pair of above-mentioned difference.By with The definition of upper SNP site, the embodiment of the present invention obtains 7236888 SNP sites altogether between all 1137 rice varieties, wherein 59503 SNP sites are located on cytoplasmic skeleton, and remaining SNP site is located on nuclear genome.Base referred to hereafter Because type is to refer to the combination of multiple SNP sites in test zone, karyogene type refers to genotype on nuclear genome, matter base Because type refers to that genotype is located on cytoplasmic skeleton.For example, the 8th test zone is located on nuclear genome in table 1, it is Karyogene type, the test zone has 9 SNP sites, and the genotype of the test zone is the combination of this 9 SNP sites.

2nd, the test zone of rice varieties to be measured is determined by variant sites, test zone includes universal test region, extremely Small part variant sites are included in universal test region, and its method includes：

Determine universal test region

Universal test region be on cytoplasmic skeleton on the big region of discrimination or nuclear genome discrimination it is big and The equally distributed region of SNP site, wherein, discriminationWherein, a is detected in variation window area The kind sum arrived, bi is the kind number of i-th kind of genotype in variation window area, and bi>1, k is to include more than a kind Genotype number.The Computing Principle of discrimination is as follows：All interracial number of combinations areWherein, in same gene type Different cultivars between combination be undistinguishable, its number isSo, the ratio for the breed combination that can not be distinguished ForThe ratio for the breed combination that can be distinguished i.e. discriminationAs can be seen here, discrimination is bigger, more Different cultivars can be distinguished, the variation window area of discrimination greatly tests more effective to DUS.If the survey on nuclear genome Try area distribution uneven, some regions can be caused adjacent, so that linkage inheritance, information is easily overlapping, therefore, cell nucleus gene The principle of compositionality in universal test region is selected in group is：Discrimination is big and SNP site is uniformly distributed.Cytoplasmic skeleton is without chain Genetic problem, so, the big region of selective discrimination degree is only needed on cytoplasmic skeleton.

High-flux sequence is carried out using Proton high-flux sequences instrument in the embodiment of the present invention, the test section of detection is sequenced in it Length of field can reach 200bp, also be 200bp to obtain the most long test zone in maximum fault information, the present embodiment.Therefore, The variant sites that the present embodiment is mentioned are located in whole test zone, and the variant sites may include multiple SNP sites.

First, centered on each SNP site of acquisition, each extension 99bp and 100bp, constitutes 200bp change to the left and right Different window.According to the 7236888 of acquisition SNP sites, 7236888 variation windows can be obtained, these variation windows are calculated The discrimination in regionFor example, in the 1st variation window area, a=520 kind is detected altogether, altogether There are k=3 kind genotype ACCT, CGTT, ACCC, their kind number is respectively b1=10, b2=30 and b3=431, Therefore, It is meant that：, can be by 520 product by the 1st variation window area 31% breed combination in kind is distinguished, and 79% breed combination cannot be distinguished by out, it is necessary to more make a variation window just in addition It can distinguish.After the same method, calculate the discrimination of the whole 7236888 variations windows of acquisition and therefrom choose and be located at carefully 6800 maximum variation windows of discrimination and 200 maximum changes of discrimination in cytoplasmic skeleton in karyon genome Different window.Check one by one in 6800 variation windows of nuclear genome, each variation window and next variation window Distance between mouthful, if after the less variation window of wherein discrimination more than 100K (1K=1000 base), is abandoned Reexamine, untill the adjacent distance for looking into variation window is all higher than 100K.Selection 100K criterion distance is because paddy rice base Because a group size is about 500M (ten thousand bases of 1M=100), by final selected 2000 universal tests for being located at nuclear genome Region is counted, and the interregional distance of average universal test is 250K, but due to few variations such as some specific regions such as centromere Site, therefore, average distance should be less than 250K.By the above process, 4061 variations for being located at nuclear genome be have selected Window, their totally 4261 variations together with 200 variation windows for being located at discrimination maximum in cytoplasmic skeleton of acquisition Window is used as selected universal test region.Wherein, 200 maximum variation windows of selective discrimination degree, are empirical value, the quantity It can modify as the case may be.

The test zone can also include non-universal test zone.

Determine non-universal test zone

Non-universal test zone refers to the special site of special kinds needs detection.DUS tests need to detect fixed point transformation Special site, fixed point transformation is the technological means commonly used in modern breeding, and such as back cross breeding, transgenic breeding, fixed point changes Specificity can also be had because of it and turn into new varieties by making kind.Based on the specific decision principle of New variety protection, non-universal Test zone should not be included in universal test region and be the site of known control qualitative character.

In the present embodiment, the gene Xa23 of high bacterial leaf spot resistant is present in database kind IRBB23, the control of Xa23 genes Bacterial leaf spot resistance be qualitative character, and Xa23 derive from wild rice, be not included in universal test region.Managed based on more than By being detected Xa23 genes as non-universal test zone, Xa23 genes have been cloned, its resistance is lacked by 7 bases Mistake causes, therefore, and the special detection region of rice varieties to be measured is the base of this 7 missings, and it is located at Japanese eyeball and refers to base Because of 24046820 to 24046825 of upper 11st chromosome of group, the more detailed information on Xa23 genes is shown in：Wang,C., X.Zhang,et al.(2014)."XA23is an executor R protein and confers broad-spectrum disease resistance in rice."Molecular plant:ssu132.

3rd, the primer in amplification assay region is prepared, the primer includes universal test region primer, specific as follows：

Universal test region primer is prepared, the universal test region primer is directed to all kinds, specifically：

Detected that multiple PCR technique refers in same PCR reacts using multiple PCR technique in universal test region Multiple PCR primers are added, while multiple sites in amplification gene group.The key of the technology is to design and synthesize multiplex PCR to draw Thing, the present embodiment matches the multiple PCR technique that Mo Feishier companies provide using the U.S., and it can set up to 12000 weight PCR to draw Thing.

Primer acquisition process is as follows：Log in match Mo Feishier company multiple PCR primer Photographing On-line webpage https:// Ampliseq.com/protected/help/pipelineDetails.action, relevant information is submitted by its requirement. In the present embodiment, " Application type " options select " DNA Hotspot designs (single-pool) ".If Multi-pool is selected, then multiplex PCR carries out point multitube, and cost can be increased, and single-pool primer is only needed to Multiplex PCR, saves cost, has the disadvantage that some universal test regions design of primers may fail, but on genome Alternative universal test region is more, therefore, abandons some alternative universal test regions and has no effect on result.By paddy rice to be measured The nucleus reference gene group and cytoplasm reference gene group of kind permeate file, and in " Select the genome Selected in you wish to use " options after " Custom ", upload the file of fusion as ginseng during design multiple PCR primer Examine genome." Standard DNA ", in Add Hotspot options, addition needs that designs to lead to the selection of DNA type options With the initiation site and SNP stop bits of the positional information of the SNP site in test zone, including chromosome information, SNP Point, its certain embodiments are shown in Table 1.Finally click on the " multiple PCR primer that Submit targets " buttons are submitted and designed.This In embodiment, from the above-mentioned 4261 universal test regions obtained, design and be successfully authenticated 2231 pairs of multiple PCR primers, For expanding corresponding 2231 universal test regions.It is the method provided by the present invention to verify the method for multiple PCR primer, is carried The leaves genomic DNA on same strain paddy rice is taken, and the genomic DNA of acquisition is expanded using the multiple PCR primer of design Increase, build storehouse, high-flux sequence and analyze sequencing fragment group, remove the corresponding primer of following test zone：The survey of the test zone Sequence segments is less than 1000 or there is hybrid strain genotype, and the primer remained is the multiple PCR primer being proved to be successful.Due to Genomic DNA source is in same strain rice leaf, it is impossible to there is hybrid strain kind, therefore, and hybrid strain genotype is by test zone The PCR that causes of special construction or sequencing Preference mistake, remove these test zones and avoid such system mistake.Verify into The multiple PCR primer of work(also by the said firm mix after be supplied to client to use in fluid form.Above-mentioned successful design is more 2231 universal test regions of weight PCR primer are the universal test region detected eventually for rice varieties to be measured, meanwhile, Each kind in the database of structure also contains above-mentioned 2231 universal test regions, wherein, 100 universal test regions On cytoplasmic skeleton, remaining 2131 universal test regions are located on nuclear genome.

It should be noted that：The number requirement >=900 in universal test region, reason is as follows：If less than 900, existing The probability of the hybrid strain kind of erroneous judgement will be more than 1%, and the projectional technique of the threshold value is shown in Table 2.Due to there may be the survey of detection failure Region is tried, therefore, test zone number is general >=and 1000.

Test zone primer can also include the primer of non-universal test zone, and the non-universal test zone primer is for treating Rice varieties are surveyed, test zone primer can also include non-universal test zone primer, specific as follows：

The primer of non-universal test zone include the first primer and the second primer, the first primer include the first forward primer and First reverse primer, the second primer includes the second forward primer and the second reverse primer, and the first primer and the second primer enter respectively Row individually expands the amplified production for obtaining two non-universal test zones, by the amplified production equivalent of two non-universal test zones It is mixed for building the high-throughput sequencing library individually expanded.5 ' end connections of the first forward primer are just like SEQ ID in sequence table NO:5 ' end connections in sequence 1 shown in 1, the first reverse primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；The 5 ' end connections of two forward primers are just like SEQ ID NO in sequence table:Sequence 2 shown in 2,5 ' end connections of the second reverse primer Just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

The design process of non-universal test zone primer is as follows：The first step, by amplification length no more than 200bp and comprising non- The requirement of all SNP sites in universal test region, by common PCR primers design method, design amplification non-universal test zone PCR forward primer and reverse primer；5 ' ends of designed forward primer and reverse primer are connected sequence by second step respectively SEQ ID NO in list:1 and sequence table in SEQ ID NO:2, the forward primer and first primer of the first primer are obtained respectively Reverse primer；3rd step, by SEQ ID NO in 5 ' ends of designed forward primer and reverse primer respectively catenation sequence table:2 With SEQ ID NO in sequence table:1, the forward primer of the second primer and the reverse primer of the second primer are obtained respectively.In sequence table SEQ ID NO:1 and sequence table in SEQ ID NO:2 be the joint sequence used in high-flux sequence, thereby using PCR primer band There is the joint sequence of high-flux sequence, set up after directly being mixed with the product in the general sequencing region of amplification after sequencing library Together be sequenced, without by fragmentation, jointing etc. it is cumbersome build storehouse step, improve operating efficiency and reduce into This.It is in order to simultaneously from the two ends sequencing of non-universal test zone to make two pairs of only different primers of joint.

Specifically, in the present embodiment, it is designed to be used to expand rice varieties non-universal test zone (X a23 bases to be measured Cause) the forward primer sequences of common PCR primers be：TGCGGCATCACTAACATCAG, reverse primer sequences are： TGTTAGTGATGCGGGAGGAA.SEQ ID NO in sequence table are added respectively to its two ends:1 and sequence table in SEQ ID NO:2 The forward primer of the first primer formed afterwards is：5’- SEQ ID NO in CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCGGCATCACTAACATCAG such as sequence table:3；First The reverse primer of primer is：SEQ in 5 '-CCTCTCTATGGGCAGTCGGTGATTGTTAGTGATGCGGGAGGAA such as sequence tables ID NO:4；The forward primer of second primer is：5 '-CCTCTCTATGGGCAGTCGGTGATTGCGGCATCACTAACATCAG are such as SEQ ID NO in sequence table:5；The reverse primer of second primer is：5’- SEQ ID NO in CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTTAGTGATGCGGGAGGAA such as sequence table:6.It is set The non-universal test zone primer of meter is matched Mo Feishier companies by the U.S. and synthesized.

4th, the method for building the database of the genotype in all test zones comprising different cultivars is as follows：

The database of the genotype in all test zones comprising different cultivars is built, specifically, in paddy rice product to be measured Kind test zone on, obtain different cultivars to genotype that should be on test zone and composition data storehouse.This example is obtained 2231 universal test region primers and 1 non-universal test zone primer, their corresponding amplification regions are water to be measured The test zone of rice varieties.Build the genotype of 2232 test zones comprising 1137 kinds and its SNP positional information Database, partial results are shown in Table 1.

Table 1 is database variety and genetype and its position, rice varieties genotype to be measured, hybrid strain genotype and its frequency Certain embodiments

'-' represents the position of the SNP site and lacked in reference gene group in table 1；"/" represents that the test zone is heterozygosis , there is the different genotype of "/" both front and back in genotype；In addition to ATGC, other letters represent degeneracy base.If genotype it is complete by Degeneracy base N is constituted, and claims corresponding test zone genotype and SNP shortage of data, genotype or SNP and any genotype of missing Or SNP is when comparing, make indifference processing.The method for the detection rice varieties genotype to be measured that can be provided by the present invention detects number According to storehouse kind and the genotype of completion missing.

The present embodiment does not list all database content completely as space is limited, only lists wherein 5 kinds The information of 10 test zones.There are some areas also only to list part equally based on length limitation, in the present embodiment related real Example, remaining unlisted data can be according to the method completion of the present embodiment.

5th, after the amount of sampling SN for determining rice varieties to be measured, random sampling mixes and extracts the DNA of mixing sample, method It is as follows：

Calculate rice varieties amount of sampling to be measured

Amount of sampling SN should meet following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein, BINOM.INV For the function in excel 2010, its application method is identical with the definition in excel 2010, and its implication is so that accumulation binomial The functional value of distribution is more than or equal to the smallest positive integral of critical value.Amount of sampling SN meet condition implication be：Even if hybrid strain rate is only Beyond the 15% of threshold value M, the amount of sampling can correctly judge the stability and one of rice varieties to be measured in the case where 95% probability ensures Cause property.M values are artificially determined according to conditions such as crop species, type, specific requirements.In the Ministry of Agriculture, New variety protection is done In public room issue《New variety of plant specificity, uniformity and stability test guide-paddy rice》Middle regulation：Hybrid rice seed is used 1% population norms, therefore, in the present embodiment, M values are used as from median 1%.Progressively increase after SN values, calculate above-mentioned public affairs Formula is found, as SN >=12000, and BINOM.INV (SN, 1%, 0.95)/SN≤1.15*1% is set up.Therefore, in the present embodiment Sample to be tested amount of sampling should >=12000.

Random sampling mixes and extracts the DNA of mixing sample

In the present embodiment, 50000 germinations are have chosen, 30000 buds being substantially equal to the magnitudes is randomly selected and mixes It is placed in after conjunction in mortar, powder is fully ground into after adding liquid nitrogen into mortar.Given birth to using Beijing Tiangeng biochemical technology Co., Ltd The article No. of production extracts for DP305 plant genome DNA extracts kit and obtains the DNA of rice varieties mixing sample to be measured, DNA extraction method is carried out by the operation manual of the kit.Produced using Invitrigen companies of the U.S. dsDNA HS Assay Kit (article No. is Q32852) and its specification are quantified to the DNA of acquisition, the paddy rice product to be measured after quantifying Plant DNA and be diluted to 10.00ng/ μ l.

6th, expanded using the DNA of primer pair mixing sample, obtain the amplified production of test zone, amplified production is used In building high-throughput sequencing library, wherein primer includes universal test region primer and the high-flux sequence text in universal test region Storehouse, specific method is as follows：

High-throughput sequencing library includes：The high-throughput sequencing library in universal test region and the high pass of non-universal test zone Sequencing library is measured, in the present embodiment, the high-throughput sequencing library of universal test region and non-universal test zone is built respectively, The two is mixed, the high-throughput sequencing library of all test zones is obtained.

The method for building the high-throughput sequencing library in universal test region is as follows：

(match Mo Feishier companies by the U.S. to produce, article No. is 4475345) multiplex PCR using library construction Kit 2.0 Expand behind universal test region, high-throughput sequencing library is built using amplified production.The kit includes following reagent：5×Ion AmpliSeq^TMHiFi Mix, FuPa reagent, transferring reagent, sequence measuring joints solution and DNA ligase.The method of library construction is pressed The operation manual of the kit《Ion AmpliSeq^TMLibrary Preparation》(publication number：MAN0006735, version： A.0) carry out.By 2231 universal test regions of multiplexed PCR amplification, the amplification system of multiplex PCR is as follows：5×Ion AmpliSeq^TMThe μ l of HiFi Mix 4, the μ l of universal test region primer mixed liquor 4, the DNA 10ng of rice varieties to be measured prepared With without the μ l of enzyme water 11.The amplification program of multiplex PCR is as follows：99 DEG C, 2 minutes；(99 DEG C, 15 seconds；60 DEG C, 4 minutes) × 25 follow Ring；10 DEG C of insulations.Digested using FuPa reagents after primer unnecessary in multiplexed PCR amplification product, then carry out phosphorylation, specifically Method is：2 μ L FuPa reagents are added into the amplified production of multiplex PCR, after mixing, are reacted in PCR instrument by following program： 50 DEG C, 10 minutes；55 DEG C, 10 minutes；60 DEG C, 10 minutes；10 DEG C of preservations, obtain mixture a, and mixture a is containing passing through phosphorus The amplified production solution of acidifying.By the upper sequence measuring joints of amplified production connection of phosphorylation, specific method is：Add into mixture a Enter the μ L of transferring reagent 4, the μ L of sequence measuring joints solution 2 and the μ L of DNA ligase 2, after mixing, reacted in PCR instrument by following program：22 DEG C, 30 minutes；72 DEG C, 10 minutes；10 DEG C of preservations, obtain mixed liquor b.Utilize the ethanol precipitation methods purifying mixed liquor b of standard After be dissolved in 10 μ L without in enzyme water.Produced using Invitrigen companies of the U.S. dsDNA HS Assay Kit (article No. is Q32852) and it is measured, and is obtained after mixed liquor b mass concentration according to its specification, by mixing after purification Liquid b is diluted to 15ng/ml, obtains the high-throughput sequencing library in concentration about 100pM universal test region.

The method for building the high-throughput sequencing library of non-universal test zone is as follows：

Using the DNA of rice varieties to be measured as template, the first primer of the non-universal test zone prepared using the above method The high pass for carrying out obtaining non-universal test zone respectively with the second primer after independent PCR amplifications, mixed in equal amounts amplified production is measured Preface storehouse.Concrete operations are pressed《Ion Amplicon Library Preparation(Fusion Method)》(publication number： 4468326) carry out, substantially process is as follows：The forward primer and reverse primer of first primer are dissolved as 10 μM of concentration with water Afterwards, isometric mixing, obtains the first primer solution.It is formulated as follows PCR reaction systems：First primer solution 1 μ L, 30ng water to be measured (invirtrigen companies of the U.S. produce rice varieties DNA and PCR high-fidelity mixture, and article No. is 12532016) 45 μ L, mix Afterwards, reacted in PCR instrument by following program：94 DEG C, 3 minutes；(94 DEG C, 30 seconds；58 DEG C, 30 seconds；68 DEG C, 1 minute) × 40 Circulation；4 DEG C of insulations.Pcr amplification product is dissolved in 10 μ L water after purification by the method for the ethanol precipitation of standard, utilizes DNA 1000 kits (article No. is 5067-1504) are pressed on the biological analyser (model 2100) that Agilent company of the U.S. is produced The kit specification is determined and obtained after the molar concentration of amplified production, is diluted to 200pM, the amplification production of as the first primer Thing.Using identical method, amplified production of the concentration for 200pM the second primer is obtained.By the amplified production of the first primer with The amplified production of second primer is mixed in equal volume, obtains the non-universal test zone high-throughput sequencing library that concentration is 100pM.

Obtain the high-throughput sequencing library of all test zones

In universal test region number and non-universal test zone number ratio mixing equimolar concentration it is general The high-throughput sequencing library of test zone and the high-throughput sequencing library of non-universal test zone, obtained mixture is all The high-throughput sequencing library of test zone.In the present embodiment, the high-throughput sequencing library in the universal test region of acquisition is taken After the high-throughput sequencing library of 2231 μ L and 1 μ L non-universal test zones is mixed, all test zones that concentration is 100pM are obtained High-throughput sequencing library.

7th, high-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced.

Determine high-flux sequence depth CF principle：The depth CF of high-flux sequence meets following condition：BI NOM.DIST (10,10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FA LSE) >=99.9%, 1- BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIS T (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, CF is the depth of high-flux sequence, namely the capped multiple of average each test zone, and M is Judge threshold value selected when uniformity and stability, B INOM.DIST are the function in excel 2010, its application method with Definition in excel 2010 is identical, and what it was returned is the probability of binomial distribution.The meaning of three functions is：In hybrid strain rate As little as 0.1%, the hybrid strain condition wide in variety up to average only 20 difference sites between 10 and hybrid strain kind and rice varieties to be measured Under, probability >=99.9% of the whole hybrid strain kinds of detection determined by high-flux sequence depth；In database kind up to 10000 It is individual and between hybrid strain kind and rice varieties to be measured under conditions of average only 20 difference sites, determined by high-flux sequence depth In the presence of probability≤0.1% of erroneous judgement hybrid strain kind；It is wide in variety up to 10 and true hybrid strain rate exceeds only judgement specificity in hybrid strain When selected threshold value 10% when, the judgement conclusion to stability and uniformity determined by high-flux sequence depth is correct Probability >=95.0%.Conditions above is very strict, therefore, and true effect is better than above-mentioned threshold value.The projectional technique of above probability is shown in Table 2.

Table 2 is the computational methods of the present embodiment dependent probability

Table 2 is the tables of data of Excel 2010, and its function, cell etc. are identical with Excel 2010 definition.Wherein, " judging threshold value (M) selected when uniformity and stability ", for cell B2, other cell numberings are pressed using B2 as reference Excel 2010 rule definition, for example the cell where " hybrid strain rate (R) " adds 4 rows 1 on the basis of B2 and arranged, therefore Numbering is C6, and other cell coding rules are identical with this.

The determination method of the present embodiment high-flux sequence depth is：M=1% is substituted into after above three formula, progressively added It during big sequencing depth CF to 2783, can set up above three equation, therefore, the present embodiment sequencing depth is defined as >=2783 Times.

High-flux sequence is carried out using high-throughput sequencing library

Utilize the high-throughput sequencing library and kit Ion PI Template OT2 of all test zones of acquisition (invirtrigen companies of the U.S. produce 200Kit v2, and article No. is the ePCR (Emulsion before 4485146) being sequenced PCR, emulsion polymerization enzyme chain reaction) expand, operating method is carried out by the operation manual of the kit.Utilize ePCR products and reagent (invirtrigen companies of the U.S. produce box Ion PI Sequencing 200Kit v2, and 4485149) article No. is in Proton High-flux sequence is carried out on two generation high-flux sequence instrument, operating method is carried out by the operation manual of the kit.In the present embodiment In, high-flux sequence flux is set to average 30000 times of coverage test region.

A large amount sequencing result is pre-processed

First determine whether high-flux sequence the quality of data whether >=Q20, if<Q20 (this situation is few), then as stated above High-flux sequence is re-started, until quality requirement reaches Q20 standards, Q20 standards, which are met in table 2, " to be sequenced wrong to be specific The requirement of the probability of base "≤0.33%.The high-flux sequence fragment for being up to quality requirement is compared to all 2232 tests Region, removes and compares after the unsuccessful and infull sequencing fragment of genotype detection, and remaining all sequencing fragments are referred to as piece is sequenced Section group.The incomplete sequencing fragment of genotype detection refers to could not be by table 1 shown in " positions of the SNP in reference gene group " All SNP sites detect sequencing fragment, and the reason for genotype detection is not complete is that sequencing fragment is too short, compares unsuccessful reason It is that sequencing fragment is generally non-specific amplification product.

8th, analysis sequencing fragment group, obtains rice varieties genotype to be measured and hybrid strain genotype, and method is as follows；

Sequencing fragment group is compared to all test zones, and counts the sequencing segments in each test zone, is removed The test zone of segments≤1000 is sequenced, remaining test zone is the successful test zone of detection.In the present embodiment, 2030 successful test zones of detection are obtained altogether.The fragment for comparing test zone is referred to as the sequencing fragment of the test zone, The base composition that the position in table 1 shown in " positions of the SNP in reference gene group " is extracted from sequencing fragment is referred to as the sequencing The genotype of fragment.The frequency of genotype refers in sequencing fragment group that the sequencing segments for representing the genotype accounts for the genotype The ratio of the sequencing fragment sum of place test zone.The genotype of frequency >=30% is referred to as rice varieties genotype to be measured.One As for, in the sample extracted, the amount of hybrid is not higher than 10%, and sequencing mistake is no more than 1%, and the two is total to be no more than 11%, therefore, for homozygosis site, rice varieties genotype to be measured only has one kind, and its frequency should be more than 89%, and right For heterozygous sites, rice varieties genotype to be measured has 2 kinds, and its ratio should be more than 45.5%, therefore, provide paddy rice to be measured Frequency >=30% of variety and genetype, can be excluded because being contaminated with hybrid strain in the wrong and to be measured rice varieties of sequencing to water to be measured The interference of rice varieties genotype.Hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%, wherein, potential hybrid strain gene There is discontinuous base in quantity >=2 of distinguishing base between all genotype of type and rice varieties to be measured or distinguishing base Insertion is lacked.The principle of hybrid strain VDA genotypes is：In high-flux sequence, insertion or missing errors are extremely rare, and because surveying Sequence mistake causes probability as little as (1%/3) 2=0.0011% of 2 fixed distinguishing bases, and require hybrid strain genotype frequency >= 0.02%, under the limitation of these conditions, even 30000 sequencing depth, because sequencing mistake produces certain hybrid strain genotype Probability is only 0.0001% (computational methods are shown in Table 2).0.02% frequency meets most strict DUS testing standards at present, i.e., from 10,000 As little as 2 hybrid detected in grain seed.If distinguishing base quantity=1, whole test zones can all produce mistake Hybrid strain genotype (computational methods are shown in Table 2), if during distinguishing base quantity >=3, hybrid strain genotype quantity is drastically reduced, it is difficult to accurate Hybrid strain rate R is really calculated, therefore, the threshold value of distinguishing base quantity >=2 is optimal.

For example, sequencing fragment group in, the 1st sequencing region sequencing fragment sum be 33180 articles, have ACCC, CGTT, CCCC, GCCC ... totally 41 kinds of genotype, represent these genotype sequencing segments distinguish 16709,16334,2,2 Bar ..., the frequency of these genotype is 16709/33180=50.36%, 16334/33180=49.23%, 2/33180= 0.006%th, 2/33180=0.006% ....By the definition of rice varieties genotype to be measured and hybrid strain genotype, ACCC with CGTT should be to be measured rice varieties genotype of the rice varieties to be measured in the 1st test zone, and other genotype are wrong for sequencing The genotype produced by mistake.In the special test zone of hybrid, female genotype is differed with male parent gene type, female genotype and institute There is the genotype of nucleus hybrid strain kind different, and male parent gene type is also different from the genotype of all nucleus hybrid strain kinds； During female genotype is rice varieties to be measured, with maternal genotype identical genotype；Male parent gene type is paddy rice product to be measured In kind, the genotype identical genotype with male parent.1st test zone, female genotype CGTT and male parent gene type ACCC Differ, and female genotype and male parent gene type and all nucleus hybrid strain kinds (in the present embodiment, no hybrid strain kind) Genotype is different, therefore, and the 1st test zone is also the special test zone of hybrid.Hybrid strain karyogene type refers to hybrid strain genotype For karyogene type, hybrid strain matter genotype refers to that hybrid strain genotype is matter genotype.By this definition, first test zone is without hybrid strain Genotype, therefore, also without hybrid strain karyogene type or hybrid strain matter genotype.By identical method, judge and obtain whole 2030 Rice varieties genotype to be measured, the special test zone of hybrid, hybrid strain genotype and its frequency of successful test zone are detected, and Judge that the hybrid strain genotype obtained is hybrid strain karyogene type or hybrid strain matter genotype.As a result show：In the present embodiment, no hybrid strain Genotype, has 153 special test zones of hybrid.

The standard sample detection method in the present embodiment is following is a brief introduction of, a kind is taken from rice varieties to be measured Son, sows and grows up to after seedling, is pressed using the blade of seedling and extracts genomic DNA with rice varieties identical method to be measured, should DNA is referred to as the standard sample of rice varieties to be measured.With rice varieties to be measured simultaneously and by the parallel structure standard sample of same procedure High-throughput sequencing library and high-flux sequence.Wherein, the genotype of frequency >=30% is referred to as standard sample genotype, standard sample Frequency >=0.02% of product hybrid strain genotype and quantity >=2 or the distinguishing base of the distinguishing base between standard sample genotype In have insertion or the missing of discontinuous base.By with rice varieties identical method to be measured, obtain each detection successfully test Standard sample genotype and standard sample hybrid strain genotype in region.If standard sample genotype and rice varieties gene to be measured Type identical test zone accounts for standard sample and rice varieties to be measured detect the ratio of successful test zone more than 90%, then Standard sample is correct, otherwise, takes 1 seed from rice varieties to be measured again, repeats above procedure, until obtaining correct mark Quasi- sample.By the hybrid strain genotype ratio of the hybrid strain genotype of correct standard sample test zone corresponding with rice varieties to be measured Compared with, identical hybrid strain genotype is obtained, removes identical hybrid strain genotype described in rice varieties to be measured, correct paddy rice to be measured Kind hybrid strain genotype is retained and is used for subsequent analysis.Above measure eliminates miscellaneous caused by Systematic selection mistake Pnca gene type, Systematic selection mistake is mainly the PCR selectivity mistake amplifications caused by the special construction of gene order.Need What is illustrated is：When database is wide in variety, different cultivars genotype can be represented extensively, hybrid strain genotype and database can be required Some genotype of kind is identical, can equally play with standard sample identical function, in this case, it is possible to not detect mark Quasi- sample, reaches the purpose for mitigating workload.In the present embodiment, because not detecting hybrid strain genotype, also it is not present The problem of removing wrong hybrid strain genotype.

9th, rice varieties genotype to be measured is compared with the genotype of the different cultivars in database, the approximate kind of acquisition, Variant sites and variant sites rate, method are as follows：

If in the test, rice varieties to be measured claim the test zone with the genotype of database kind without missing For rice varieties to be measured and the shared test zone of the database kind.In shared test zone, if rice varieties to be measured with The genotype of database kind is incomplete same, then the test zone where the genotype is called rice varieties to be measured and the data The difference site of storehouse kind, corresponding genotype Differential genotype each other, the number in difference site rate=difference site/shared is surveyed Try the number in region.The approximate kind that the minimum kind of difference bit rate is referred to as rice varieties to be measured is obtained from database, accordingly Difference site be referred to as variant sites, the number of number/shared test zone of variant sites rate=variant sites.

In the present embodiment, the 1st kind " Jin Ke 1A " the shared test zone number of rice varieties and database to be measured For 2025.In the 1st shared test zone, rice varieties to be measured with " Jin Ke 1A " genotype be respectively CGTT/ACCC and CGTT, the two is incomplete same, therefore, the 1st shared test zone be rice varieties to be measured with " Jin Ke 1A " difference site, CGTT/ACCC and ACCC is rice varieties to be measured and " Jin Ke 1A " Differential genotype.By identical method, by all shared surveys Try in region, rice varieties to be measured with " Jin Ke 1A " genotype is compared, and finds to have 152 difference sites, difference site rate= 152/2025=7.51%.By identical method, rice varieties to be measured and all 1137 interracial differences in database are obtained Ectopic sites rate, and the minimum kind of difference site rate is obtained for " it is numbering 10 for Jin Ke 1A/R7723 ", only 1 difference site Number non-universal test zone (being shown in Table 1), difference site rate be 0.05%.Therefore, " Jin Ke 1A/R7723 " are paddy rice product to be measured The approximate kind planted, the variant sites rate of rice varieties to be measured is 0.05%.

Tenth, hybrid strain genotype is compared with the genotype of the different cultivars in database, obtained after hybrid strain kind, calculated miscellaneous Strain rate, method is as follows：

Obtain hybrid strain kind：Hybrid strain kind is present in the kind in database, and the potential hybrid strain genotype of hybrid strain kind Having the number of the test zone of phase homogenic type to account for hybrid strain kind between hybrid strain genotype has the test of potential hybrid strain genotype Total ratio >=60% in region, wherein, the difference between all genotype of potential hybrid strain genotype and rice varieties to be measured There are insertion or the missing of discontinuous base in quantity >=2 of base or distinguishing base.Hybrid strain kind is divided into nucleus hybrid strain product Plant and cytoplasm hybrid strain kind, wherein, nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained merely with karyogene type, carefully Kytoplasm hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype.For example, it is assumed that the base of the kind in database When because of type being respectively AA, AA, AA/TT, AA/TT, AA/TT, AA/TT and AA, the corresponding genotype of rice varieties to be measured is respectively AA, AA/TT, TT, AA, TT/CC, GG/CC and during-A, corresponding potential hybrid strain genotype is：Nothing, nothing, AA, TT, AA, AA/TT And AA.Heterozygous genotypes are not present in general homozygosis kind, but only a few site there may be, in addition, hybrid strain is generally cenospecies, Heterozygous sites more typically, therefore list various possible situations.Parameter 60% can ensure that whole hybrid strain kind detection probabilities are 100% and exist erroneous judgement hybrid strain kind probability be 0%, the determination method of the parameter value is shown in Table 2.

In the present embodiment, due to not detecting hybrid strain genotype, therefore, also without hybrid strain kind.Special hybrid strain gene Type refers to all hybrid strain genotype of only one hybrid strain kind, and it includes special hybrid strain karyogene type and special hybrid strain matter gene Type；Special hybrid strain karyogene type refers to all hybrid strain karyogene types of only one nucleus hybrid strain kind, special hybrid strain matter base Because type refers to all hybrid strain matter genotype of only one cytoplasm hybrid strain kind.In the present embodiment, due to without hybrid strain kind, because This, also without special hybrid strain genotype.

Calculate hybrid strain rate R principles

Hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：Wherein, n1 For the number of nucleus hybrid strain kind, t1 for all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds number, After i1j1 sorts from low to high for all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds by its frequency, jth 1 Special hybrid strain karyogene type, R1i1j1 is the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is by hybrid strain karyogene type meter The summation of the hybrid strain rate of the nucleus hybrid strain kind of calculation, the hybrid strain rate of nucleus hybrid strain kind is to remove in nucleus hybrid strain kind After the frequency of the special hybrid strain karyogene type of minimum 80% and highest 10%, the frequency of remaining special hybrid strain karyogene type 2 times of average value；Wherein, t2 is the hybrid strain possessed except nucleus hybrid strain kind The number of the hybrid strain karyogene type of outside karyogene type and frequency >=0.17%, i2 be except nucleus hybrid strain kind possess it is miscellaneous After all hybrid strain karyogene types outside strain karyogene type sort from low to high by its frequency, the i-th 2 hybrid strain karyogene types, R2i2 for the i-th 2 hybrid strain karyogene types frequency；R2 is to utilize the hybrid strain karyogene type possessed except nucleus hybrid strain kind to calculate Hybrid strain rate, it is minimum 80% and highest in the frequency for remove the hybrid strain karyogene type possessed except nucleus hybrid strain kind After 10% value, 2 times of the average value of surplus value；Wherein, n2 is cell The number of matter hybrid strain kind, R3i3 is the hybrid strain rate of the i-th 3 cytoplasm hybrid strain kinds, and t3 is the i-th 3 cytoplasm hybrid strain kinds All special hybrid strain matter genotype number, i3j3 for the i-th 3 cytoplasm hybrid strain kinds all special hybrid strain matter genotype After being sorted from low to high by its frequency, the special hybrid strain matter genotype of jth 3, R3i3j3 is the i-th 3j3 special hybrid strain matter genes The frequency of type；R3 is the summation of the hybrid strain rate of the cytoplasm hybrid strain kind calculated by hybrid strain matter genotype, cytoplasm hybrid strain kind Hybrid strain rate be the special hybrid strain matter genotype for removing 80% and highest 10% minimum in cytoplasm hybrid strain kind frequency Afterwards, the average value of the frequency of remaining special hybrid strain matter genotype；Wherein, t4 be except The number of the hybrid strain matter genotype of outside the hybrid strain matter genotype that cytoplasm hybrid strain kind possesses and frequency >=0.17%, i4 is All hybrid strain matter genotype in addition to the hybrid strain matter genotype that cytoplasm hybrid strain kind possesses sort from low to high by its frequency Afterwards, the i-th 4 hybrid strain matter genotype, R4i4 for the i-th 4 hybrid strain matter genotype frequency；R4 is to utilize to remove cytoplasm hybrid strain kind The hybrid strain rate that the hybrid strain matter genotype possessed is calculated, it is the frequency for removing the hybrid strain matter genotype possessed except cytoplasm hybrid strain kind In rate after the value of minimum 80% and highest 10%, the average value of surplus value；Wherein, t5 is The number of the special test zone of hybrid；I5 is the i-th 5 special test zones of hybrid；Rmi5 is the i-th 5 special test sections of hybrid In domain, the frequency of female genotype；Rfi5 is in the i-th 5 special test zone of hybrid, the frequency of male parent gene type；Rm is maternal The hybrid strain rate of selfing, during it is the special test zone of hybrid, the difference of the frequency of female genotype and the frequency of male parent gene type Average value；Int () is bracket function, returns to the integer part of the number in bracket.

Maternal selfing, the flyings pollination that hybrid strain in rice varieties to be measured comes from reproductive process mix and machinery is mixed It is miscellaneous, wherein, maternal is the main source of hybrid strain variet complexity from giving flyings pollination to mix.Maternal selfing refers in hybrid seed In production process, as sterile line female parent originally should not selfing produce seed, but due to maternal part fertility restorer, produce Seed, so as to form hybrid.Flyings pollination, which mixes, refers to that the pollen of hybrid strain kind passes to paddy rice product to be measured by wind-force etc. Plant and formation of pollinating hybrid seed, flyings pollination can not possibly introduce cytoplasm, therefore can only cause hybrid strain karyogene type, its is miscellaneous Strain rate is 2 times of hybrid strain karyogene type frequency.Mechanical admixture refers to that hybrid strain variety seeds are directly mixed in rice varieties to be measured, together When introduce nucleus and cytoplasm, while forming hybrid strain karyogene type and hybrid strain matter genotype, its hybrid strain rate should be hybrid strain The frequency of matter genotype.In hybrid strain rate R calculation formula, the hybrid strain rate of mechanical admixture has been over-evaluated 1 times by R1+R2, needs correction, After correction for R1+R2-R3-R4.It is a technical barrier to distinguish mechanical admixture with flyings pollination to mix, and the present invention solves this One problem.

In hybrid strain rate R calculation formula, the hybrid strain rate of nucleus hybrid strain kind is all 2 × hybrid strain karyogene type frequency, Its reason is as follows：Diploid or allopolyploid plant are 2 copies, therefore, hybrid strain in the test zone of nuclear genome Rate is 2 times of corresponding hybrid strain karyogene type frequency.If the test zone of the nuclear genome of N parts of copies must be selected, Then coefficient should be adjusted to N, if copy number is indefinite, make N=2 processing, if wrong, it will when calculating R, by removing 80% The mode of low extremum excludes them.

In hybrid strain rate R calculation formula, it is in 10% middle progress merely with hybrid strain genotype frequency value and counts Calculate, its principle is：The different hybrid strain genotype of same hybrid strain kind are determined by the hybrid strain rate of the hybrid strain kind, so the phase of frequency Prestige value is equal, and the difference between frequency is expanded by PCR, the error during high-flux sequence causes.Pass through hybrid strain genotype Definition and rice varieties standard sample to be measured, these improper values are eliminated substantially, the extremum for removing 10% is enough Fall the test zone that very small amount deviates true hybrid strain rate.Why remove the 80% of minimum, and it is maximum then only remove 10%, it is former Reason is as follows：(1) worst error source is sequencing mistake, and it is very low that the wrong hybrid strain genotype frequency produced is sequenced；(2) in removal of impurities In the frequency of hybrid strain genotype outside strain kind, high level is more likely the common hybrid strain genotype of different hybrid strains, is represent true Real hybrid strain rate.

In R2 and R4 calculation formula, it is desirable to which frequency >=0.17% of hybrid strain genotype, its principle is as follows：Work as database In kind number and detection site when reaching 10000,149 hybrid strain genotype erroneous judgements will be averagely produced, when setting hybrid strain During genotype frequency >=0.17%, probability >=99.98% (projectional technique is shown in Table 2) of the hybrid strain genotype of no erroneous judgement just can be accurate Really calculate the value to R2 and R4.Kind number in database and detection site reach that 10000 have been the limit in reality, because This, the threshold value of frequency >=0.17% of hybrid strain genotype goes for various situations.R2 and R4 introducing so that energy of the present invention Enough is 0 in database kind, i.e., in the case that no database is supported, calculate hybrid strain rate R.Especially, if hybrid strain kind A institute There is hybrid strain genotype to be possessed by hybrid strain kind B and other hybrid strain kinds, thus, hybrid strain kind A is without special hybrid strain genotype.This When, when calculating hybrid strain rate R, hybrid strain kind A and hybrid strain kind B hybrid strain rate are not calculated, and calculate hybrid strain kind AB hybrid strain Rate.Hybrid strain kind AB hybrid strain VDA genotypes are：Hybrid strain kind A and hybrid strain genotype common to hybrid strain kind B.

Hybrid strain rate R calculation formula is general formula, and rice varieties to be measured typically only mix a kind of hybrid strain product in reality Kind, due to cenospecies production area all very big and process specifications, so, the possibility of flyings pollination and mechanical admixture is all very low, Up to maternal selfing forms hybrid, and the present embodiment is such case.

Calculate hybrid strain rate R hypothesis example

Table 3 assumes a hybrid strain rate calculated examples, to become apparent from the calculating process for illustrating hybrid strain rate R.

Table 3 assumes example to calculate one of hybrid strain rate R

In table 3, nucleus hybrid strain kind common A and B two, so n1=2, cytoplasm hybrid strain kind number only C mono-, so N2=1.By the definition of special hybrid strain karyogene type, the special hybrid strain karyogene type for obtaining hybrid strain kind A is that numbering is No. 1-10 Hybrid strain karyogene type AA, TT, TCC, GG, AC, TTC, TCCC, GGC, ACC and AG, so, t1=10, they frequency difference For 0.10%, 1.20%, 0.10%, 0.10%, 0.02%, 0.10%, 0.10%, 0.10%, 0.10% and 0.10%, to this It is R11111=0.02%, R11121=0.02%, R11131 after 10 special hybrid strain karyogene type frequencies sort from low to high =0.10%, R11141=0.10%, R11151=0.10%, R11161=0.10%, R11171=0.10%, R11181= 0.10%th, R11191=0.10% and R111101=1.20%.From j 1=Int (0.8 × t1)+1=Int (0.8 × 10)+1 =9 to j 1=t1-Int (0.1 × t1)=10-Int (0.1 × 10)+1=9 R111j1 value is R11191=0.10%, So nucleus hybrid strain kind A hybrid strain rate isIn the same way, nucleus is obtained Hybrid strain kind B hybrid strain rate is Thus, nucleus hybrid strain kind is obtainedIn a similar manner, R2=0.02%, cytoplasm hybrid strain product are obtained The hybrid strain rate plantedR4=0.04%.In the 1st special test zone of hybrid, Rmi5 =52.36%, Rfi5=46.34%, therefore, the maternal selfing rate calculated using the special test zone of the 1st hybrid is 52.36%-46.34%=6.02%, by identical method, is calculated in other several special test zones of hybrid, maternal selfing Rate is 3.94%, 6.06%, 6.22% and 7.54%, therefore in the hypothesis example, final maternal selfing rate is：Rm= (6.02%+3.94%+6.06%+6.22%+7.54%)/5=5.96%.Therefore, hybrid strain rate R=R1+ in the hypothesis example R2-R3-R4+Rm=0.60%+0.02%-0.10%-0.04%+5.96%=6.44%.

With reference to above-mentioned hypothesis example, the hybrid strain rate R in the present embodiment is calculated：In the present embodiment, no hybrid strain kind and miscellaneous Pnca gene type, and in addition to the hybrid strain genotype that hybrid strain kind possesses, no frequency is more than 0.17% hybrid strain genotype, therefore, R1, R2, R3 and R4 are 0, thus, R=Rm.In the 1st hybrid test zone, Rmi5=50.36%, Rfi5= 49.23%, therefore, the maternal selfing rate calculated using the 1st test zone is 50.36%-49.23%=1.13%, by phase With method, calculate the special test zone of all 152 hybrids in, maternal selfing rate be 1.13%, 1.02%, 1.03%....., defined by Rm, their average value calculated after the maternal selfing rate for calculating the special test zone of these hybrids, Obtain R=Rm=1.09% in the present embodiment.

11, using variant sites, variant sites rate and hybrid strain rate, specificity, the uniformity of rice varieties to be measured are judged And stability, method is as follows：

Wherein, SD is judges threshold value selected during specificity, and M is to judge threshold selected when uniformity and stability Value.The method for judging rice varieties to be measured specificity, uniformity and stability is：When variant sites rate >=SD or non-universal are tested When region has variant sites, rice varieties to be measured have specificity, as variant sites rate ＜ SD and variant sites are not present in During non-universal test zone, rice varieties to be measured are without specificity；As hybrid strain rate≤M of rice varieties to be measured, water to be measured Rice varieties have uniformity and stability, and when the hybrid strain rate of rice varieties to be measured is more than ＞ M, rice varieties to be measured do not have one Cause property and stability.With M values, SD values are, according to breeding level, desired Stringency, to mark the factors such as characteristic, Artificially determine.In the present embodiment, SD selects 1% standard.

In the present embodiment, variant sites rate is 0.05%<SD=1%, but (numbering is No. 10 to non-universal test zone Test zone) there are variant sites (being shown in Table 1), therefore, judge that rice varieties to be measured have specificity；Rice varieties to be measured it is miscellaneous The ＞ M=1% of strain rate 1.09%, therefore, judge that rice varieties to be measured do not have uniformity and stability.

Further, after rice varieties specificity to be measured, uniformity and stability is judged, the accuracy to judgement is carried out Estimation, method is as follows：

Specific accuracy is calculated：When variant sites are not present in non-universal test zone, if judging rice varieties to be measured With specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TR UE)；If judging water to be measured Rice varieties do not have specific, the correct probability >=BINOM.DIST (SD*TRN, TRN, OD, TRUE) of conclusion, wherein, TRN is The number for the test zone that success is detected, OD is variant sites rate, and BINOM.DIST is the function in excel 2010, and it is used Method is identical with the definition in excel 2010, and what it was returned is the probability of binomial distribution.What above-mentioned probability was actually calculated It is：When judging to have specificity, variant sites rate is more than SD probability；When judge rice varieties to be measured without specificity When, variant sites rate is less than SD probability, detects successful test zone by being obtained after analyzing sequencing fragment group.

This implementation does not judge the specificity of rice varieties to be measured using variant sites rate, therefore, and specific knot is not calculated By correct probability.

Uniformity is calculated with stability accuracy

Judge the correct probability of the conclusion of uniformity and stability of rice varieties to be measured as：When rice varieties to be measured have When uniformity and stability, correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST (the ∑ SeN* of conclusion M,ΣSeN,R,TRUE)；When rice varieties to be measured do not have uniformity and stability, the correct probability of conclusion >= BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) * BINOM.DIST (∑ SeN* (1-M), Σ SeN, 1-R, TRUE), its In, M is judges threshold value selected when uniformity and stability, and Σ SeN are all frequencies for being used to calculate hybrid strain rate R genotype The summation of the sequencing fragment of test zone where rate, BINOM.DIST (M*SN, SN, R, TRUE) is that rice varieties to be measured are carried out SN sampling, the hybrid strain rate R being actually pumped is less than threshold value M probability, BINOM.DIST's (Σ SeN*M, Σ SeN, R, TRUE) Meaning is：Rice varieties to be measured are carried out with SeN sampling of Σ, the hybrid strain rate R being actually pumped is less than threshold value M probability； BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) is that rice varieties to be measured have carried out SN sampling, the hybrid strain being actually pumped Rate R is more than threshold value M probability, and BINOM.DIST (Σ SeN* (1-M), ∑ SeN, 1-R, TRUE) meaning is：To paddy rice to be measured Kind has carried out SeN sampling of ∑, and the hybrid strain rate R being actually pumped is more than threshold value M probability.∑ SeN be remove 80% minimum Value and the summation for the test fragment for after 10% maximum, remaining the test zone for calculating hybrid strain rate.Judge consistent Property and the accuracy of stability depend entirely on the accuracy of hybrid strain rate, and the positive rate of hybrid strain rate really depends on three below step Accuracy：First, rice varieties sampling accuracy to be measured, second, the accuracy of hybrid strain kind is detected from sample is extracted out, the Three, calculate the accuracy of hybrid strain rate using the hybrid strain kind of detection.Therefore, rice varieties uniformity to be measured and stability are judged Accuracy is the product of the step accuracy of the above three.Even because the present invention is under the conditions of most stringent of, detection hybrid strain kind is just True rate also controls more than 99.9%, is actually mostly close to 100%.Therefore, rice varieties uniformity to be measured is judged The product of the accuracy of the first step and the 3rd step can be estimated as with the accuracy of stability, it is respectively former and later two in above-mentioned formula The value that function is calculated.For example, BINOM.DIST (M*SN, SN, R, TRUE) meaning is：Rice varieties to be measured have been carried out SN times Sampling, the hybrid strain rate R being actually pumped is less than threshold value M probability；Each sequencing for calculating rice varieties hybrid strain rate to be measured Rice varieties to be measured have substantially also quite been carried out single sample by fragment, therefore, BI NOM.DIST (Σ SeN*M, Σ SeN, R, TRUE) meaning be：Rice varieties to be measured are carried out with SeN sampling of Σ, the hybrid strain rate R being actually pumped is less than threshold value M's Probability.

In the present embodiment, the site for hybrid strain rate R is 153 special test zones of hybrid strain, and its sequencing total amount is 4403423, also that is, 30000 samples being pumped have been carried out with 4403423 sampling again, such big amount of sampling Error is fairly small.In the present embodiment, judge that rice varieties to be measured do not have uniformity and stability, therefore, the judgement knot By correct probability >=BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) * BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1-R, TRUE)=BINOM.DIST ((1-1%) * 30000,30000, (1-1.09%), TRUE) * BINOM.DIST (4403423* (1-1%), 4403423,1-1.09%, TRU E)=93.84%.It can be seen that, this implementation is to rice varieties to be measured The judgement of uniformity and stability is very accurate.

Result verification

Press《New variety of plant specificity, uniformity and stability test guide-paddy rice》In method plant and observe and treat Rice varieties and its approximate kind are surveyed, the high sense bacterial leaf-blight of rice varieties to be measured is found, approximate kind then high resistance to hoja blanca. 《New variety of plant specificity, uniformity and stability test guide-paddy rice》Middle regulation：With approximate product at least in a character When planting with obvious and reproducible difference, you can judge that the rice varieties to be measured of application possess specificity.Therefore, judge to be measured Rice varieties have specificity.In experimentation, 400 plants of rice varieties to be measured and approximate kind (200 plants one has been planted altogether Cell, totally 2 repetitions), 10 plants of special-shaped strains are found,《New variety of plant specificity, uniformity and stability test guide-paddy rice》 Middle regulation：When sample size is 400~471 plants, 8 plants of special-shaped strains are at most allowed for.Therefore, rice varieties to be measured are judged Without uniformity.It is generally believed that without uniformity, just not having stability yet.It is indicated above that to be measured in the present embodiment The judgement of the specificity of rice varieties, stability and uniformity is correct.

The embodiment of the present invention is expanded by high-flux sequence and many sites, realizes the large sample sampling of rice varieties to be measured Sampled with the large sample of the individual test zone of inter-species, recycle and define hybrid strain genotype, define cytoplasm hybrid strain kind and definition The comprehensive means such as hybrid strain rate calculation formula, successfully realize it is accurate, quick, intactly judge the special of rice varieties to be measured The target of property, stability and uniformity, it has the technical effect that what existing DUS method of testings did not all reach.Existing molecule DUS detections Technology such as chip only detects fixed test zone, it is impossible to according to case, flexibly selection non-universal test zone.And present invention detection Be PCR primer, non-universal test zone can be detected easily according to case flexible design primer.With present invention implementation Exemplified by example one, for 30000 individual amount of samplings for traditional DUS measuring technologies, work is big, it is impossible to complete, example Such as, in field DUS tests, 30000 plants of paddy rice of sampling need to plant more than 2 mu of rice field, and need to plant 2 years, and annual every plant Paddy rice need to investigate more than 70 character., it is necessary to do 30000 DNA extractions respectively in widely used SSR molecules DUS tests, 30000*2231 PCR and the detection of 30000*2231 PCR primer (assuming that as the present embodiment, have detected 2231 it is general Test zone).Therefore, because workload is excessive, existing molecule DUS tests there all are not measuring stability and uniformity, and field DUS is surveyed Although examination detection uniformity and stability, sampling samples amount is all below 1000 plants, and the present embodiment has been sampled 30000 plants of water Rice, its accuracy is obviously higher.Why the present embodiment can increase amount of sampling, be because all 30000 samples are all mixed Afterwards as a sample process, and field DUS test and comparisons, workload is equivalent to being reduced to 1/30000；Further, own Mixed once amplification and a high-flux sequence detection are all only done in 2231 universal test regions, test and compare with SSR molecules DUS Compared with, workload equivalent to being reduced to 1/ (30000*2231).Therefore, the present invention is realized in the case where workload significantly mitigates Large sample and many site primers, make DUS tests not only accurate but also simple.While database kind in the embodiment of the present invention one Genotype is base composition, very standard, detects same breed in the present inventive method under different experimental conditions, can obtain Exactly the same genotype, accordingly, it is not necessary under different conditions repeat DUS test, therefore, the embodiment of the present invention can directly with Database variety and genetype compares, and objectively selects the approximate kind of rice varieties to be measured.And existing DUS measuring technologies are inadequate Standard, rice varieties to be measured abreast carry out DUS tests simultaneously with approximate kind, just reliable conclusion can be obtained, in order to mitigate Workload, it has to which, by providing approximate kind by kind power applicant, if approximate kind mistake, there may be erroneous grants Legal consequence.

The foregoing is only presently preferred embodiments of the present invention, be not intended to limit the invention, it is all the present invention spirit and Within principle, any modification, equivalent substitution and improvements made etc. should be included in the scope of the protection.

Claims

1. a kind of method for the specificity, uniformity and stability for determining new hybrid rice varieties, it is characterised in that methods described Including：

Obtain the variant sites between different rice varieties；

The test zone of the rice varieties to be measured is determined by the variant sites, the test zone includes universal test area Domain, at least partly described variant sites are included in the universal test region, are determined by the variant sites described general The method of test zone is：Pass through discriminationThe value of discrimination is calculated, wherein, a is variation window area In the kind sum that is detected, bi is the kind number of i-th kind of genotype in the variation window area, and bi>1, k be comprising More than the number of the genotype of a kind, the variation window area is centered on each single nucleotide variations site, to institute The both sides for stating single nucleotide variations site respectively extend survey sequence length 1/2 as the window detected, the universal test region For the discrimination on the big region of discrimination on cytoplasmic skeleton or nuclear genome is big and equally distributed region, its In, the genotype is the combination in multiple single nucleotide variations sites in the test zone；

Build the database in the genotype of all test zones comprising the different cultivars；

Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, the expansion Volume increase thing is used to build high-throughput sequencing library；

The rice varieties genotype to be measured is compared with the genotype of the different cultivars in the database, obtains described Approximate kind, variant sites and the variant sites rate of rice varieties to be measured；

The hybrid strain genotype is compared with the genotype of the different cultivars in the database, obtained after hybrid strain kind, Calculate hybrid strain rate；

Using the variant sites, the variant sites rate and the hybrid strain rate, the rice varieties specificity to be measured, one are judged Cause property and stability.

2. according to the method described in claim 1, it is characterised in that the amount of sampling SN meets following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV be excel 2010 in function, M for judge the uniformity with Selected threshold value during stability, the condition implication that the amount of sampling SN is met is：Even if the hybrid strain rate is only beyond threshold value M's 15%, the amount of sampling can correctly judge the stability and uniformity of the rice varieties to be measured in the case where 95% probability ensures.

3. according to the method described in claim 1, it is characterised in that the depth CF of the high-flux sequence meets following condition： BINOM.DIST (10,10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >= 99.9%, 1-BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINO M.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, CF is the depth of the high-flux sequence, and M is judges selected when the uniformity and stability Threshold value, BINOM.DIST is the function in excel 2010, and the condition implication that the depth CF of the high-flux sequence is met is： It is to be put down between 10 and the hybrid strain kind and the rice varieties to be measured in the hybrid strain rate as little as 0.1%, the hybrid strain kind Under conditions of only having 20 difference sites, the whole hybrid strain kind of the detection determined by the depth CF of the high-flux sequence Probability >=99.9%；It is between 10000 and the hybrid strain kind and the rice varieties to be measured in the kind of the database Averagely only have under conditions of 20 difference sites, the hybrid strain product are judged by accident by the depth CF of the high-flux sequence presence determined Probability≤0.1% planted；In the hybrid strain kind be 10 and true hybrid strain rate exceeds only threshold selected when judging specificity Value 10% when, by the depth CF of the high-flux sequence determine to the correct probability of the judgement conclusion of stability and uniformity >=95.0%.

4. according to the method described in claim 1, it is characterised in that the test zone also includes non-universal test zone, institute Stating primer also includes non-universal test zone primer.

5. method according to claim 4, it is characterised in that the non-universal test zone primer include the first primer and Second primer, first primer includes the first forward primer and the first reverse primer, and it is positive that second primer includes second Primer and the second reverse primer, first primer and second primer carry out respectively individually amplification obtain two it is described non-through With the amplified production of test zone, the amplified production mixed in equal amounts of two non-universal test zones is used to build independent expansion The high-throughput sequencing library of increasing；

5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first is reverse 5 ' end connections in primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；

5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second is reverse 5 ' end connections of primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

6. method according to claim 4, it is characterised in that utilize the variant sites, the variant sites rate and institute Hybrid strain rate is stated, judging the method for the rice varieties specificity to be measured, uniformity and stability includes：

When there are the variant sites in the variant sites rate >=SD or described non-universal test zones, the paddy rice product to be measured Kind there is specificity, as the variant sites rate ＜ SD and when the variant sites are not present in the non-universal test zone, The rice varieties to be measured are without specificity, selected threshold value when wherein SD is judges specific；

As the hybrid strain rate≤M of the rice varieties to be measured, the rice varieties to be measured have uniformity and stability, when When the hybrid strain rate of the rice varieties to be measured is more than ＞ M, the rice varieties to be measured do not have uniformity and stability, M To judge threshold value selected when the uniformity and stability；

The hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：

Wherein, n1 is the number of nucleus hybrid strain kind, and t1 is the i-th 1 The number of all special hybrid strain karyogene types of the nucleus hybrid strain kind, i1j1 is the i-th 1 nucleus hybrid strain kinds All special hybrid strain karyogene types sorted from low to high by frequency after, the special hybrid strain karyogene type of jth 1, R1i1j1 is the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is the nucleus calculated by hybrid strain karyogene type The summation of the hybrid strain rate of hybrid strain kind, the hybrid strain rate of the nucleus hybrid strain kind is to remove the nucleus hybrid strain kind In minimum 80% and highest 10% the special hybrid strain karyogene type frequency after, the remaining special hybrid strain core base Because of 2 times of the average value of the frequency of type；

Wherein, t2 is the hybrid strain core base possessed except the nucleus hybrid strain kind Because of the number of the hybrid strain karyogene type of outside type and frequency >=0.17%, i2 is except the nucleus hybrid strain kind possesses The hybrid strain karyogene type outside all hybrid strain karyogene types sorted from low to high by frequency after, the i-th 2 are described miscellaneous Strain karyogene type, R2i2 for the i-th 2 hybrid strain karyogene types frequency；R2 is utilized except the nucleus hybrid strain kind is gathered around The hybrid strain rate that the hybrid strain karyogene type that has is calculated, R2 be remove except the nucleus hybrid strain kind possess it is described miscellaneous In the frequency of strain karyogene type after the value of minimum 80% and highest 10%, 2 times of the average value of surplus value；

Wherein, n2 is the number of cytoplasm hybrid strain kind, and R3i3 is the i-th 3 The hybrid strain rate of the individual cytoplasm hybrid strain kind, t3 for the i-th 3 cytoplasm hybrid strain kinds all special hybrid strain matter genes The number of type, i3j3 for the i-th 3 cytoplasm hybrid strain kinds all special hybrid strain matter genotype by frequency by it is low to After height sequence, the special hybrid strain matter genotype of jth 3, R3i3j3 is the frequency of the i-th 3j3 special hybrid strain matter genotype Rate；R3 is the summation of the hybrid strain rate of the cytoplasm hybrid strain kind calculated by hybrid strain matter genotype, and the cytoplasm is miscellaneous The hybrid strain rate of strain kind is to remove the special hybrid strain of 80% and highest 10% minimum in the cytoplasm hybrid strain kind After the frequency of matter genotype, the average value of the frequency of the remaining special hybrid strain matter genotype；

Wherein, t4 is the hybrid strain matter base possessed except the cytoplasm hybrid strain kind Because of the number of the hybrid strain matter genotype of outside type and frequency >=0.17%, i4 is except the cytoplasm hybrid strain kind possesses The hybrid strain matter genotype outside all hybrid strain matter genotype sorted from low to high by frequency after, the i-th 4 are described miscellaneous Strain matter genotype, R4i4 for the i-th 4 hybrid strain matter genotype frequency；R4 is utilized except the cytoplasm hybrid strain kind is gathered around The hybrid strain rate that the hybrid strain matter genotype having is calculated, R4 is to remove the hybrid strain matter possessed except the cytoplasm hybrid strain kind In the frequency of genotype after the value of minimum 80% and highest 10%, the average value of surplus value；

Wherein, t5 is the number of the special test zone of hybrid；I5 is special for the i-th 5 hybrids Test zone；Rmi5 is in the i-th 5 special test zone of hybrid, the frequency of female genotype；Rfi5 is described in the i-th 5 In the special test zone of hybrid, the frequency of male parent gene type；Rm is the hybrid strain rate of maternal selfing, and Rm is that the hybrid is special In test zone, the average value of the frequency of the female genotype and the difference of the frequency of the male parent gene type；

Int () is bracket function；

The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm hybrid strain merely with karyogene type Kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to only one All hybrid strain karyogene types of the nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only described in one All hybrid strain matter genotype of cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is described Karyogene type；The hybrid strain matter genotype refers to that the hybrid strain genotype is the matter genotype；Specifically tested in the hybrid In region, the female genotype is differed with the male parent gene type, and the female genotype and all nucleus are miscellaneous The genotype of strain kind is different, and the male parent gene type is also different from the genotype of all nucleus hybrid strain kinds；Institute Female genotype is stated in the rice varieties to be measured, with maternal genotype identical genotype；The male parent gene type is In the rice varieties to be measured, the genotype identical genotype with male parent；

The karyogene type refers to the genotype on nuclear genome；The matter genotype refers to be located at cytoplasmic skeleton On genotype.

7. method according to claim 6, it is characterised in that methods described also includes treating described in judgement in the following ways Survey rice varieties the correct probability of the conclusion of uniformity and stability be：When the rice varieties to be measured have uniformity and steady When qualitative, correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST of conclusion (Σ SeN*M, ∑ SeN, R, TRUE)；When the rice varieties to be measured do not have the uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M)*SN,SN,(1-R),TRUE)*BINOM.DIST(∑SeN*(1-M),∑SeN,1-R,TRUE)；Wherein, M is judgement Selected threshold value when the uniformity and stability, ∑ SeN is all genotype for being used to calculate the hybrid strain rate R The summation of the sequencing fragment of the test zone where frequency, BINOM.DIST (M*SN, SN, R, TRUE) is the paddy rice to be measured Kind has carried out SN sampling, and the hybrid strain rate R being actually pumped is less than the probability of the threshold value M, BINOM.DIST (∑ SeN* M, ∑ SeN, R, TRUE) meaning be：The rice varieties to be measured are carried out with SeN sampling of Σ, what is be actually pumped is described miscellaneous Strain rate R is less than threshold value M probability；BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) is carried out for the rice varieties to be measured SN sampling, the hybrid strain rate R that is actually pumped is more than the probability of the threshold value M, BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1-R, TRUE) meaning be：The rice varieties to be measured have been carried out with SeN sampling of Σ, the hybrid strain being actually pumped Rate R is more than threshold value M probability, and the frequency of the genotype refers in the sequencing fragment group, represents the sequencing of the genotype The ratio of the sequencing fragment sum of the test zone where segments accounts for the genotype.

8. method according to claim 6, it is characterised in that when the change dystopy is not present in the non-universal test zone During point, if it is specific to judge that the rice varieties to be measured have, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN,1-OD,TRUE)；If judging the rice varieties to be measured without specificity, the correct probability >=BINOM.DIST of conclusion (SD*TRN, TRN, OD, TRUE), wherein, TRN is detects the number of successful test zone, and OD is the variant sites rate, BINOM.DIST is the function in excel 2010, and the correct probability of conclusion, which is expressed as working as, judges the rice varieties to be measured During with specificity, the variant sites rate is more than SD probability, when judging the rice varieties to be measured without specificity, The variant sites rate is less than SD probability, and the successful test zone of detection after analyzing the sequencing fragment group by obtaining .

9. according to the method described in claim 1, it is characterised in that obtaining the method for the hybrid strain kind includes：The hybrid strain Kind is the kind being present in the database, and the potential hybrid strain genotype and the hybrid strain genotype of the hybrid strain kind Between have phase homogenic type the number of the test zone account for the hybrid strain kind there is the described of the potential hybrid strain genotype Total ratio >=60% of test zone；The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；

Quantity >=2 of distinguishing base between the potential hybrid strain genotype and all genotype of the rice varieties to be measured or There are insertion or the missing of discontinuous base in the distinguishing base.