CN104800847A - Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases - Google Patents
Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases Download PDFInfo
- Publication number
- CN104800847A CN104800847A CN201410043666.5A CN201410043666A CN104800847A CN 104800847 A CN104800847 A CN 104800847A CN 201410043666 A CN201410043666 A CN 201410043666A CN 104800847 A CN104800847 A CN 104800847A
- Authority
- CN
- China
- Prior art keywords
- bmp
- cell
- kaposi
- signal path
- smad1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a use of a BMP pathway inhibitor in preparation of a drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases. The invention creatively discloses a use of a BMP signal pathway as a target point for Kaposi's sarcoma treatment. The invention also discloses a use of the BMP signal pathway inhibitor as an effective targeting drug for Kaposi's sarcoma treatment.
Description
Technical field
The invention belongs to biomedicine field; More specifically, the present invention relates to BMP pathway inhibitor and prepare the purposes in Kaposi's sarcoma virus infection medicine.
Background technology
Kaposi's sarcoma virus (Kaposi ' s sarcoma associated herpesvirus, KSHV), i.e. human herpes virus type 8 (Human herpes virus-8, HHV-8), be the novel herpesvirus of one found in Kaposi's sarcoma (KS) disease damage tissue in recent years, have obvious dependency with KS, lymphoma primary effusion (PEL), multicentricity Karst graceful disease (MCD).KS is modal malignant tumor in AIDS patient, in the patient accepting organ transplantation, also have higher sickness rate, and its grade malignancy is high, and even have extensive internal organs to invade, cause multiple organ dysfunction syndrome, fatality rate is high.Worldwide, infection rate is more than 40% in HIV sufferers for KSHV, and the infection rate in general population then has regionality distribution feature, and general regional crowd infection rate about 5%, but can reach 20-40% at African the Sahara area infection rate.KSHV infection rate average out to 5% in the ground general populations such as Zhejiang Province, China, Guangdong, Hubei, Xinjiang region average rate is then up to 20.4%, and oneself is close African for the KSHV IgG positive rate of the Kirgiz and Uygurs, is respectively 48% and 30.4%.Can not be ignored, population of China HIV-1 the infected quantity more than 1,000,000 people, and presents a rapidly rising trend.Based on the regularty of epidemic of AIDS-KS, China is following will have more AIDS-KS patient.
The fusiform cell (Spindle Cell) in endothelium source is the cell of KSHV main infection, is also main tumor cell.KSHV mainly exists with latent infection form in fusiform cell, only has small part cell to be in during spontaneous cracking copies.Therefore, the gene outcome expressed incubation period is considered to the original power of viral tumorigenesis.KSHV mainly expresses LANA in latent infection, v-FLIP, v-Cyclin, KSHV-miRNAs etc.Wherein LANA is topmost Virus latency albumen, and it can suppress important caused by tumor suppressor p 53, the activity of RB-E2F, and LANA, also by being combined with GSK3b, stabilizes the expression of β-catenin.The present inventor's work in the past also confirms, LANA, by suppressing the degraded of Notch born of the same parents' inner segment (ICN) of Sel10 mediation, stablizes ICN and expresses and promote cell proliferation.But owing to lacking KS cell strain and stablizing effective KSHV cell transformation model, it is still still to be tested to there is developing meaning at KS in these signal paths.
At present, the KS poor prognosis of late stage, mortality rate is high, develops the special efficient targeted drug for KS and has great importance.
Summary of the invention
BMP pathway inhibitor is the object of the present invention is to provide to prepare the purposes in Kaposi's sarcoma virus infection medicine.
In a first aspect of the present invention, BMP signal pathway inhibitor is provided to improve in preparation or treat the purposes in the compositions of Kaposi's sarcoma virus infection.
In a preference, described Kaposi's sarcoma virus infection comprises: Kaposi's sarcoma, lymphoma primary effusion, the graceful disease in multicentricity Karst.
In another preference, described BMP signal pathway inhibitor comprises: Dorsomorphin (also name Compound C, C
24h
25n
5and WSS25 O); Or their analog.
In another aspect of this invention, provide the purposes of BMP signal path or its pathway protein, for screening the potential material improving or treat Kaposi's sarcoma virus infection.
In another aspect of this invention, provide a kind of method of screening the potential material improving or treat Kaposi's sarcoma virus infection, described method comprises:
(1) system of BMP signal path or its pathway protein is contained by candidate substances pack processing;
(2) expression or the activity of BMP signaling pathway protein in described system is detected;
Wherein, (preferably significantly reducing if described candidate substances can reduce, as reduced by more than 20%, preferably reducing by more than 50%; Better reduction by more than 80%) expression of BMP signaling pathway protein or activity, then show that this candidate substances improves or the potential material for the treatment of Kaposi's sarcoma virus infection.
In a preference, described screening does not comprise the relevant method of medical diagnosis on disease or Therapeutic Method.
In another preference, step (1) comprising: in test group, candidate substances is joined in the system comprising BMP signal path; And/or
Step (2) comprising: the expression or the activity that detect BMP signaling pathway protein in the system of test group, and compares with matched group, and wherein said matched group is the system comprising BMP signal path of not adding described candidate substances;
If in test group the expression of BMP signaling pathway protein or activity statistically lower than (preferably remarkable lower than, as low by more than 20%, preferably low by more than 50%; Better is low by more than 80%) matched group, just show that this material standed for is the potential material improving or treat Kaposi's sarcoma virus infection.
In another preference, described BMP signal path is BMP-Smad1-Id path, described BMP signaling pathway protein comprises: BMP (bone morphogenetic protein(BMP), Bone morphology protein), Smad1 (SMAD family member 1, SMAD Family Member1), Id (DNA in conjunction with Profilin, Inhibitor of DNA binding).
In another preference, described system is selected from: cell system (there is cell or the cell culture of BMP signal path as endogenous), subcellular fraction system, solution system, organizational framework, organ systems or animal system.
In another preference, described system is cell system.
In another preference, described system is the endogenous cell (as KMM cell, MM cell or 293T cell) that there is BMP signal path.
In another preference, described candidate substances includes, but is not limited to: the micromolecular compound designed for the described BMP of existence signal path (gene or albumen containing this path), for the disturbing molecule, nucleic acid inhibitor, binding molecule (as antibody or part) etc. of BMP signal path or its upstream or downstream protein design.
In another preference, described method also comprises: carry out further cell experiment and/or animal experiment to the potential material obtained, to select further from candidate substances and to determine for the material improved or treatment Kaposi's sarcoma virus infection is useful.
In another aspect of this invention, provide a kind of compositions for improving or treat Kaposi's sarcoma virus infection, described compositions contains: (1) BMP pathway inhibitor; Be preferably Dorsomorphin, WSS25, or their analog; (2) pharmaceutically acceptable carrier.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
The p-Smad1 that Fig. 1, LANA and BMP activate interacts in core.
A: by the LANA interaction protein strategy schematic diagram that tandem affinity purification (TAP) scientific discovery is new.B, C: verify that LANA and Smad1 exists by Co-IP and interact.The p-Smad1 that D:LANA and BMP activates interacts in core.
Fig. 2, LANA rely on mode by BMP-Smad1 and raise Id expression at transcriptional level.
A, B:LANA raise Id family at transcriptional level and express; C:BMP pathway inhibitor Noggin can eliminate the rise effect of LANA for Id1 transcriptional level; D:BMP2 can strengthen the rise effect of LANA to Id1 transcriptional level; E:LANA raises Id1 promoter reporter gene expression levels, but can not raise the Id1 promoter reporter gene expression levels of disappearance Smad1 binding site; F: in the cell of Knock-downSmad1, LANA can not raise Id1 promoter reporter gene expression levels.
Fig. 3: LANA maintains the expression of p-Smad1 and promotes that it is to the combination of Id1 promoter.
The expression time of p-Smad1 after A, B, C:LANA energy significant prolongation BMP2 process, and promote that Id1 expresses; D:ChIP experiment shows that Smad1 and LANA all can in conjunction with Id1 promoter; E:ChIP experiment shows that LANA significantly can promote that Smad1 is to the binding ability of Id1 promoter.
Fig. 4: Id family KSHV transformant and KS tissue in high expressed.
A, B:Id family mRNA level in-site and protein level in KSHV transformant all significantly raise; C:Knock-down LANA lowers Id family transcriptional level in KSHV transformant; D:Id family is high expressed in KS tissue.
Fig. 5, Knock-down Id1 expresses the external and body interior one-tenth tumor ability significantly suppressing KSHV transformant.
A: the KSHV transformed cells setting up Id1knock-down; The speed of growth of B:Knock-down Id1 expression inhibiting KSHV transformed cells; C, D:Knock-down Id1 expresses the clonal growth ability significantly suppressing KSHV transformed cells; E, F:Knock-down Id1 expresses the energy for growth of the grappling non-dependent significantly suppressing KSHV transformed cells; G, H, I:Knock-down Id1 expresses and significantly suppresses the one-tenth tumor ability of KSHV transformed cells in nude mouse.
Fig. 6, Dorsomorphin are by lowering the one-tenth tumor ability of BMP-Smad1-Id signal suppressing KSHV transformant.
The p-Smad1 that A:BMP pathway inhibitor WSS25 and Dorsomorphin can suppress BMP to activate expresses; B:WSS25 and Dorsomorphin significantly suppresses the energy for growth of the grappling non-dependent of KSHV transformed cells; C:Dorsomorphin has optionally cytotoxic effect to KSHV transformed cells; D:Dorsomorphin suppresses the expression of Id family; E, F, G:Id1 partly can save the G2/M stagnation of Dorsomorphin to KSHV transformed cells, and the inhibitory action of the energy for growth of cytotoxic effect and grappling non-dependent is (in E, vec represents empty plasmid, and contrast expression does not give Dorsomorphin); H:Dorsomorphin significantly suppresses the one-tenth tumor ability of KSHV transformed cells in nude mouse; I:Dorsomorphin significantly suppresses the Id1 of KSHV transformed cells inoculated tumour in nude mouse to express, propagation (Ki67) and apoptosis-induced (Caspase3 of activation).
Detailed description of the invention
The present inventor, through system and deep research, disclosing the p-Smad1 of LANA by activating in conjunction with BMP first, maintaining its expression, and promote that it is in the combination of oncogene Id promoter, cause the overexpression of Id protein family, promote cell proliferation in several ways, apoptosis inhibit.Therefore, BMP-Smad1-Id1 path is a target spot for the treatment of Kaposi's sarcoma (KS).The present invention also confirms that BMP pathway inhibitor is the efficient targeting medicine for the treatment of Kaposi's sarcoma.
BMP signal pathway inhibitor and uses thereof
As used herein, " BMP signal path ", " BMP path " are used interchangeably.Described " BMP signal path ".Comprise " BMP-Smad1-Id path ".
As used herein, described " BMP signaling pathway protein " comprises any associated protein in BMP signal path; Preferably, comprising: BMP, Smad1, Id.
The present inventor finds, the signal of interest Protein S mad1 of BMP path is the new interaction protein of KSHV albumen LANA main incubation period.LANA is interacted by the p-Smad1 activated with BMP, maintains its expression, and promotes that it is in the combination of Id promoter, thus cause the remarkable rise of Id.
In the KSHV transformation model (KMM cell) of rat embryonic kidney mesenchymal precursor cells (MM cell), important oncogene Id family significantly raises, and confirms that their rise regulates and controls by LANA.Meanwhile, the present inventor finds Id high expressed in 10 routine KS disease damage tissues, and Smad1 is nuclear staining, shows that BMP path activates in KS tissue.
ShId1 can significantly slow down the speed of growth of KMM, significantly suppresses its Colony forming ability when normal cultivation, significantly suppresses the growth of its grappling non-dependent in soft agar, and significantly suppress it in nude mouse, become tumor ability.Therefore, Id becomes tumor ability to be necessary for maintenance KMM.
Independent process LAN Id1 itself, can not directly make MM cell transform, but in KMM cell process LAN Id1, the speed of growth of KMM can be promoted further, promote its Colony forming ability when normal cultivation, promote the growth of its grappling non-dependent in soft agar.In conjunction with above experiment, confirm that Id is the indispensable driving force of KSHV transformant.
Dorsomorphin is I type bmp receptor inhibitor, and WSS25 can suppress BMP to be combined with bmp receptor, and the present inventor finds that the two all can significantly suppress p-Smad1 to express, and significantly suppresses the energy for growth of KMM grappling non-dependent in soft agar.
Wherein, the structural formula of Dorsomorphin is as follows:
WSS25 is after extracting WGEW in Rhizoma Gastrodiae, the derivant that oneself sulfonation obtains, and it is the analog (see Glycoconj J (2012) 29:389-398) of heparin sulfate.It is a mixture, and length (n) is not fixed, and the degree of sulfonation is not also fixed, and by electronegative, in conjunction with BMP molecule, blocks the combination of BMP and bmp receptor.Its structural formula is as follows:
Dorsomorphin is for KMM cell selectively cytotoxic effect.Dorsomorphin significantly can suppress the expression of Id protein family, and process LAN Id1 significantly can save the KMM G2/M that Dorsomorphin causes and is detained, cell death, and the suppression of the energy for growth of grappling non-dependent in soft agar.Therefore, Dorsomorphin suppresses the one-tenth tumor ability of KMM by targeting BMP-Smad1-Id path.The more important thing is, the lumbar injection Dorsomorphin of dose significantly can suppress the one-tenth tumor ability of KMM in nude mouse, and Dorsomorphin has significantly lowered the Id1 in tumor, and Ki67 expresses, and have activated the expression of Caspase3.
BMP pathway inhibitor Dorsomorphin can pass through targeting BMP-Smad1-Id signal path, significantly suppresses KMM cell one-tenth tumor ability in vitro and in vivo.Therefore, BMP pathway inhibitor is the targeted drug of very promising treatment KS.
The discovery of the present inventor discloses the new mechanism that KSHV promotes into tumor, and confirms that BMP pathway inhibitor is potential KS targeted drug.By researching and developing as lead drug with Dorsomorphin, or all the research of KS targeted drug will be carried forward vigorously by the discovery of novel B MP pathway inhibitor.
Based on the above-mentioned new discovery of the present inventor, the invention provides a kind of purposes of inhibitor of BMP signal path, for the preparation of the compositions of improving or treating Kaposi's sarcoma virus infection.
As used herein, described BMP signal path gene or the inhibitor of albumen include antagonist, lower adjustment, blocker, blocker etc.
Described BMP signal path gene or the inhibitor of albumen refer to the activity of any BMP of reduction signaling pathway protein, the stability reducing BMP signal path gene or albumen, the expression of lowering BMP signaling pathway protein, minimizing BMP signaling pathway protein effective acting time or suppress the material of transcribing and translating of BMP signal path gene, these materials all can be used for the present invention, as for lowering the useful material of BMP signal path, thus can be used for improving or treatment Kaposi's sarcoma virus infection.Such as, described inhibitor can be: the siRNA molecule of specificity interference BMP signal path gene expression or antisense nucleotide; Or the antibody that is combined with BMP signaling pathway protein of specificity or part.
As optimal way of the present invention, described BMP signal pathway inhibitor comprises: I type bmp receptor inhibitor; Be preferably Dorsomorphin, WSS25.Or their analog.
Compositions
Present invention also offers a kind of compositions, it contains effective dose (as 0.000001-50wt%; Preferably 0.00001-20wt%; Better, 0.0001-10wt%) the inhibitor of described BMP signal path, and pharmaceutically acceptable carrier.Described compositions can be used for improving or treatment Kaposi's sarcoma virus infection.The inhibitor of any aforesaid BMP signal path all can be used for the preparation of compositions.
As used herein, described " effective dose " refer to can to people and/or animal produce function or activity and can by people and/or animal the amount that accepts.Described " pharmaceutically acceptable carrier " refers to the carrier being used for the treatment of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carrier is well known to those of ordinary skill in the art.Pharmaceutically acceptable carrier can contain liquid, as water, saline, buffer in the composition.In addition, in these carriers, also may there is complementary material, as filler, lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance etc.
After the purposes of inhibitor obtaining BMP signal path described in cicada, can adopt multiple method well known in the art that described inhibitor or its pharmaceutical composition are delivered medicine to mammal.Include but not limited to: subcutaneous injection, intramuscular injection, percutaneous gives, local gives, implant, slow release gives; Preferably, described administering mode is that non-bowel gives.
The effective dose of the inhibitor of BMP signal path of the present invention can change with order of severity of the pattern of administration and disease to be treated etc.The selection of preferred effective dose can be determined (such as passing through clinical trial) according to various factors by those of ordinary skill in the art.Described factor includes but not limited to: pharmacokinetic parameter such as bioavailability, metabolism, the half-life etc. of described BMP signal path gene or the inhibitor of albumen; The order of severity of the disease that patient will treat, the body weight of patient, the immune state of patient, the approach etc. of administration.Usually, when the inhibitor of BMP signal path of the present invention gives with the dosage of about 0.00001mg-50mg/kg the weight of animals (preferably 0.0001mg-10mg/kg the weight of animals) every day, gratifying effect can be obtained.Such as, by an urgent demand for the treatment of situation, the dosage that several times separate can be given every day, or dosage is reduced pari passu.
Drug screening
After the Close relation obtaining cicada BMP signal path and Kaposi's sarcoma virus infection, can screen based on this feature the material suppressing BMP signal path.Can find from described material for the medicine improved or treatment Kaposi's sarcoma virus infection is really useful.
Therefore, the invention provides a kind of method of screening the potential material improving or treat Kaposi's sarcoma virus infection, described method comprises: by the system of candidate substances pack processing containing (expression) BMP signal path; With the expression or the activity that detect BMP signaling pathway protein in described system; If described candidate substances can lower expression or the activity of BMP signaling pathway protein (comprising bmp protein), then show that this candidate substances is the potential material improving or treat Kaposi's sarcoma virus infection.The described system comprising BMP signal path can be such as cell (or cell culture) system, and described cell can be the cell that endogenous comprises (expression) BMP signal path; It can be maybe the cell of recombinant expressed BMP signal path.The described system comprising BMP signal path can also be subcellular fraction system, solution system, organizational framework, organ systems or animal system (as animal model, the animal model of preferred non-human mammal, as Mus, rabbit, sheep, monkey etc.) etc.
In optimal way of the present invention, when screening, in order to be easier to observe the expression of BMP signaling pathway protein or the change of activity, also can arrange matched group, described matched group can be the system comprising BMP signal path of not adding described candidate substances.
As optimal way of the present invention, described method also comprises: carry out further cell experiment and/or animal experiment to the potential material obtained, to select further and to determine for the material improved or treatment Kaposi's sarcoma virus infection is really useful.
The present invention has no particular limits for the detection method of the expression of BMP signaling pathway protein (comprising BMP, Smad1, Id), activity, expression or secretion situation.Conventional protein quantification or half-quantitative detection technology, such as (but being not limited to) can be adopted: SDS-PAGE method, Western-Blot method etc.
On the other hand, present invention also offers the potential material of the improvement adopting described screening technique to obtain or treatment Kaposi's sarcoma virus infection.The material that these Preliminary screening go out can form a screening storehouse, for expression and the activity suppressing BMP signal path, and then can improve or treat the useful material of Kaposi's sarcoma virus infection so that people finally can therefrom filter out.
Major advantage of the present invention is:
Disclose the generation of BMP signal path and Kaposi's sarcoma virus infection first or develop closely related, thus BMP signal path can improve as drug target exploitation or the medicine for the treatment of Kaposi's sarcoma virus infection.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.
Materials and methods
1, plasmid
PCDH-SF-Puro is (see document Gloeckner by SF sequence label, et al.Proteomics, 2007 supplementary material Fig. 1) be cloned into pCDH-CMV-MCS-EF1-Puro (System Biosciences) BamHI and NotI site build form.LANA total length CDS sequence (GenBank accession number: NC_009333) sub-clone to EcoRI and the BamHI site of pCDH-SF-Puro builds to form by pCDH-SF-LANA, makes LANA and SF label can amalgamation and expression.
PA3F-LANA (Flag-LANA): available from Univ Pennsylvania USA.
HA-Smad1 and Flag-Smad1 is available from Shanghai Inst. of Life Science, CAS.
EcoRI and the BamHI site structure of Id1 total length CDS sequence (GenBank accession number: NM_181353.2) sub-clone to pCDH-SF-Puro forms by pCDH-Id1-Puro.
Reporter gene Id985-Luc (Id1-985) and Id956-Luc (Id1-956) list of references Katagiri, et al.Gens and Cells, the 2002,957th page.
The operation instruction of construction method reference pLKO.1 carrier (Addgene) of interference plasmid ShId1, ShSmad1 and shLANA.Be AAGGTCACATTTCGTGCTTCT (SEQ ID NO:1) for Id1 interference sequence, being CGGTTGCTTATGAGGAACCAA (SEQID NO:2) for Smad1 interference sequence, is AGATTCCTGGCGTAAAAGCTT (SEQ ID NO:3) for LANA interference sequence.Obtain pLKO.1-shId1, pLKO.1-shSmad1, pLKO.1-shLANA plasmid.
2, antibody and reagent
Anti-LANA (Advanced Biotechnologies, 13-210-100), anti-Smad1 (Santacruz, sc-7965x), anti-pSmad1/5/8 (Cell signaling technology, #9511), anti-Id1 (Santa cruz, sc-488), anti-Id2 (Santa cruz, sc-489), anti-Id3 (Santa cruz, sc-490), anti-Ki67 (Novocastra, NCL-Ki67p), anti-cleaved Caspase-3 (Cell signalingtechnology, #9661), Anti-HA (H6908), Anti-Flag M2affinity gel (Sigma, A2220), Strep-Tactin sepharose (IBA, 2-1201-010), desthiobiotin (IBA, 2-1000-001), BMP2 (Sigma, B3555), Dorsomorphin (Sigma, P5499), WSS25 is available from Shanghai institute of materia medica, puromycin (Sigma, P8833).
3, cell
Rat embryonic metanephricmesenchymal precursor cells (MM cells), KSHV-transformed MM cells (KMM) is available from University of Southern California.293T/SF-LANA, 293T/SF-Puro, 293T/shSmad1,293T/shControl, KMM/shId1, KMM/shLANA, and KMM/shControl, KMM/Id1, KMM/Vector screen after corresponding slow virus infection 293T or KMM cell the stable expression cell strain obtained.
Specific as follows: by pCDH-SF-LANA, pCDH-Id1-Puro, pCDH-SF-Puro, pLKO.1-shId1, pLKO.1-shSmad1, pLKO.1-shLANA, pLKO.1 respectively with slow virus packaging plasmid delta8.9, VSVG cotransfection 293T cell [the slow virus packing method provided with reference to pCDH-CMV-MCS-EF1-Puro (System Biosciences) description is carried out], transfection obtained cells and supernatant after 48 hours, namely obtained corresponding slow virus supernatant.
293T/SF-LANA builds: after pCDH-SF-LANA slow virus Supernatant infection 293T cell, screens gained stable cell strain with Puromycin.
293T/SF-Puro builds: after pCDH-SF-Puro slow virus Supernatant infection 293T cell, screens gained stable cell strain with Puromycin.
293T/shSmad1 builds: after pLKO.1-shSmad1 slow virus Supernatant infection 293T cell, screens gained stable cell strain with Puromycin.
293T/shControl (293T-shCtrl) builds: after pLKO.1 slow virus Supernatant infection 293T cell, screens gained stable cell strain with Puromycin.
KMM/shId1 builds: after pLKO.1-shId1 slow virus Supernatant infection KMM cell, screens gained stable cell strain with Puromycin.
KMM/shLANA builds: after pLKO.1-shLANA slow virus Supernatant infection KMM cell, screens gained stable cell strain with Puromycin.
KMM/shControl (KMM-shCtrl) builds: after pLKO.1 slow virus Supernatant infection KMM cell, screens gained stable cell strain with Puromycin.
KMM/Id1 builds: after pCDH-Id1-Puro slow virus Supernatant infection KMM cell, screens gained stable cell strain with Puromycin.
KMM/Vector builds: after pCDH-SF-Puro slow virus Supernatant infection KMM cell, screens gained stable cell strain with Puromycin.
4, Tandem affinity purication (TAP, tandem affinity purification) and co-immunoprecipitation (Co-IP)
SF label is utilized to carry out the method for TAP experiment, see document Gloeckner, et al.Proteomics, 2007,4230-4231 page.
The method of co-immunoprecipitation experiment, see Anti-Flag M2affinity gel (Sigma, A2220), Strep-Tactin sepharose (IBA, 2-1201-010) reagent description.
5, RNA extracting, reverse transcription, qPCR
Respectively according to Trizol buffer (Life technology), cDNA Reverse Transcription Kit (Toyobo) and SYBR green Master Mix kit (Toyobo) reagent description are carried out.PCR primer sequence is as table 1.
Table 1
6, ChIP experiment
List of references Feng, et al.Cancer Research, the 2012,6503rd page.The primer sequence is as follows:
Id1-F：5’-CAGTTTGTCGTCTCCATG-3’(SEQ ID NO:12)；
Id1-R：5’-TCTGTGTCAGCGTCTGAA-3’(SEQ ID NO:13)；
GAPDH-F：5’-TACTAGCGGTTTTACGGGCG-3’(SEQ ID NO:14)；
GAPDH-R：5’-TCGAACAGGAGGAGCAGAGAGCGA-3’(SEQ ID NO:15)。
7, Dual-luciferase reporting experiment
Carry out according to Dual-luciferase reporter assay system (Promega) description.
8, histopathology and SABC (IHC) are analyzed
10 routine KS clinical samples are collected in attached first teaching hospital of Xinjiang Medicine University, and obtain informed consent.This research approach obtains Ethics Committee's approval (Study protocol#20082012) of this hospital.LANA, Id1, Id2, Id3, the expression that Smad1 organizes at KS, and Id1, Ki67, activated caspase3 is detected by SABC in the expression of nude mice model tumor tissues, experimental technique list of references Feng, et al.Cancer Research, the 2012,6503rd page.
9, MTT experiment
Carry out according to MTT cell proliferation and citotoxicity detection kit (the green skies) description.To row cell proliferation experiment, every hole spreads 1000 cells, and every day carries out cell viability detection; For cytotoxicity experiment, every hole spreads 4000 cells, and carries out cell viability detection with after the Dorsomorphin process given number of days of prescribed concentration.
10, cell cycle detects
Carry out according to cell cycle and cell apoptosis detection kit (the green skies) description.KMM-Vector and KMM-ID1 cell carries out cell cycle detection with DMSO or 5uM Dorsomorphin process after 48 hours respectively.
11, colony formation
The 6 every holes of orifice plate spread 1000 cells, and normal cultivation is after 2 weeks, and cell clone 0.005% crystal violet is fixed dyeing and photographic analysis.
12, soft agar assay
List of references Feng, et al.Cancer Research, 2012, the 6 every holes of orifice plate spread 10000 cells, and after cultivating 2 weeks, cell clone 0.005%crystal violet is fixed dyeing and photographic analysis.
13, Xenograft experiment
1 × 10
6kMM-shCtrl cell or KMM-shId1 cell carry out mouse bare subcutaneous injection, often organize 5 nude mices.Tumor size is measured with slide gauge for every three days, and computing formula is volume=(length × wide
2)/2.When shCon group tumor grows to 2000mm
3time, all nude mices implement euthanasia, and carry out tumor separation, weigh and embed.In administration experiment, 1 × 10
6kMM cell mouse bare subcutaneous injection, when gross tumor volume reaches 50 ~ 100cm
3, nude mice is divided into two groups at random, and injection Dorsomorphin (10mg/Kg) in administration group disposable celiac, matched group injects coordinative solvent according to the same manner.Tumor size is measured with slide gauge every day, and computing formula is volume=(length × wide
2)/2.This experimental program is by Institutional Animal Care andUse Committee of the Institut Pasteur of Shanghai, and Chinese Academy of Sciences ratifies (Animal protocol#A2013010).
The p-Smad1 that embodiment 1, LANA and BMP activate interacts in core
The present inventor, by the method (Figure 1A) of tandem affinity purification, finds that the important signal transducer Smad1 of BMP path is a new LANA interaction protein.
Flag-LANA and HA-Smad1 corotation enters in 293T cell by the present inventor, by mutual co-immunoprecipitation experiment, confirms that LANA and Smad1 exists interaction (Figure 1B) in cell.
PCDH-SF-LANA and Flag-Smad1 corotation enters in 293T cell by the present inventor, by mutual co-immunoprecipitation experiment, further demonstrate that LANA and Smad1 exists interaction (Fig. 1 C) in cell.
LANA is a nucleoprotein, and Smad1 is a plasmosin normally, and after BMP is in conjunction with bmp receptor, Smad1 is phosphorylated, and forms trimer with Smad4 and enter core, and plays functional transcription factor.Interval in order to verify the interaction of LANA and Smad1, the present inventor processes 293T cell after 2 hours with BMP2 (10ng/mL), carries out endochylema and is separated with karyon, and carry out co-immunoprecipitation experiment respectively to cell.Found that, the p-Smad1 that LANA activates in karyon component and BMP interacts (Fig. 1 D).
Embodiment 2, LANA rely on mode by BMP-Smad1 and raise Id expression at transcriptional level
Research in the past shows, the BMP passage downstream gene endotheliocyte that to be also important oncogene Id1 infect at KSHV and high expressed in KS disease damage tissue, but regulatory mechanism and function are completely unclear.Because the p-Smad1 that LANA and BMP activates interacts in core, the present inventor guesses that LANA can regulate and control BMP signal path by Smad1.
The present inventor, by pCDH-SF-LANA transfection 293T cell, with empty plasmid in contrast, detects the expression of Id family gene in cell.
Id family comprises Id1 ~ 4, and they are all downstream molecules of BMP path, and except Id4 is not detected, the present inventor finds that LANA can not only raise Id1 and express, and can also raise the expression (Fig. 2 A, B) of Id2 and Id3 at albumen and transcriptional level.
The present inventor with BMP pathway inhibitor noggin (100ng/mL) add in 293T cell culture medium process 6 hours, found that, BMP pathway inhibitor noggin can eliminate LANA and raise (Fig. 2 C) the transcriptional level of Id1.
The present inventor adds in 293T cell culture with BMP2 (10ng/mL), processes the time of specifying, and finds that BMP2 can promote that LANA is to the rise (Fig. 2 D) of Id1 transcriptional level.
The present inventor is respectively by Id1-985, Id1-956 reporter gene and pCDH-SF-LANA or pCDH-SF-Puro cotransfection 293T cell.Found that, LANA can activate Id1 promoter reporter gene Id1-985, but can not activate the reporter gene Id1-956 (Fig. 2 E) of Smad1 binding site disappearance.
The present inventor by pCDH-SF-LANA, pCDH-SF-Puro and Id1-985 cotransfection in 293T-shSmad1 or 293T-shCtrl cell.Found that, in 293T-shSmad1 cell, the activation of LANA to Id1-985 is subject to serious suppression.Therefore, the rise of LANA to Id1 depends on BMP-Smad1 path (Fig. 2 F).
Embodiment 3, LANA maintain the expression of p-Smad1 and promote that it is to the combination of Id1 promoter
The present inventor attempts exploring LANA raises Id1 mechanism at transcriptional level.Respectively by pCDH-SF-LANA, pCDH-SF-Puro transfection 293T cell, within 24 hours after transfection, start with BMP2 (10ng/mL) process.Found that, in the cell of empty carrier transfection, Smad1 is phosphorylated very soon, and promotes the expression of downstream molecules Id1 rapidly.But after 9 hours, p-Smad1 down-regulated expression, and be returned to background level gradually; In the cell that LANA expresses, the expression of p-Smad1 is stablized significantly, and Id1 is also significantly raised by LANA, and presents and unanimously with p-Smad1 express trend (Fig. 3 A-C).
On the other hand, the present inventor by pCDH-SF-LANA and HA-Smad1 cotransfection to 293T cell.Transfection is after 24 hours, with carrying out ChIP experiment with Flag antibody and HA antibody respectively.In another experiment, by pCDH-SF-LANA and HA-Smad1 cotransfection to 293T cell.Transfection, after 24 hours, processes cell 2 hours with BMP2 (10ng/ml), then carries out ChIP experiment with HA antibody.Found that, Smad1 and LANA all can be combined in the promoter of Id1, and LANA significantly can increase the combination (Fig. 3 D-E) of Smad1 in Id1 promoter.
Therefore, the present inventor thinks that LANA is by interacting with p-Smad1, maintains its expression, and promotes that it is in the combination of Id promoter, raises the expression of Id family in this way.
Embodiment 4, Id family KSHV transformant and KS tissue in high expressed
Owing to lacking KSHV transformant model always, the research of KSHV tumorigenesis mechanism is very restricted.Up to date, professor Gao Shoujiang of University of Southern California establishes efficient KSHV transformation model, KSHV can infect and transform rat metanephros mesenchymal precursor cells (MM cell), this transformant (KMM cell) can become tumor and present the typical characteristic of KS in nude mouse, is therefore a research KSHV tumorigenesis mechanism good model.Due to the Oncogene family that Id is important, the present inventor guesses that LANA raises Id expression by BMP-Smad1 path and may take part in KSHV tumorigenesis mechanism.
The present inventor have detected Id and expresses in KMM cell.Compared with unconverted MM cell, in KMM cell, Id1 ~ 3 are all significantly raised (Fig. 4 A, B) at transcriptional level and post-transcriptional level.After utilizing the expression of ShLANA knock-down LANA in KMM cell, Id expression is significantly lowered (Fig. 4 C).This illustrates that LANA is the major reason causing Id unconventionality expression.
Further, the present inventor finds in 10 routine KS disease damage tissues, Id family high expressed, and Smad1 is nuclear staining (Fig. 4 D), shows that BMP path is activate in KS tissue.
Embodiment 5, Knock-down Id1 express the external and body interior one-tenth tumor ability significantly suppressing KSHV transformant
In order to verify that Id becomes the effect of tumor ability for KMM, the present inventor constructs the KMM/shId1 cell strain (Fig. 5 A) of Id1Knock-down.ShId1 can significantly slow down the speed of growth (Fig. 5 B) of KMM, its Colony forming ability (Fig. 5 C when normal cultivation of remarkable suppression, D), growth (Fig. 5 E of its grappling non-dependent in soft agar of remarkable suppression, F), these are marks of external one-tenth tumor ability; And significantly suppress it in nude mouse, become tumor ability (Fig. 5 G).Therefore, Id becomes tumor ability to be necessary for maintenance KMM.
Independent process LAN Id1 itself, can not directly make MM cell transform, but in KMM cell process LAN Id1, the speed of growth of KMM can be promoted further, promote its Colony forming ability when normal cultivation, promote the growth of its grappling non-dependent in soft agar.In conjunction with above experiment, the present inventor confirms that Id is the indispensable driving force of KSHV transformant.
Embodiment 6, Dorsomorphin significantly suppress the one-tenth tumor ability of KMM in vitro and in vivo
Because Id high expressed in KSHV transformant and KS tissue, and Id1 plays an important role for the one-tenth tumor ability of KSHV transformant, and the present inventor guesses that BMP-Smad1-Id1 path is a potential target spot for the treatment of KS.
The present inventor picks the imagination that two kinds of BMP pathway inhibitors verify the present inventor, and Dorsomorphin is a kind of I type bmp receptor inhibitor, and WSS25 can suppress BMP to be combined with bmp receptor.Dorsomorphin (5 μMs), WSS25 (40mg/ml) are processed 293T cell 2 hours with BMP2 (10ng/mL) by the present inventor respectively.The present inventor finds that the two all can significantly suppress p-Smad1 to express (Fig. 6 A), and significantly suppresses the energy for growth (Fig. 6 B) of KMM grappling non-dependent in soft agar.
Further, the Dorsomorphin process KMM cell of the present inventor's variable concentrations or MM cell, found that Dorsomorphin is for KMM cell selectively cytotoxic effect (Fig. 6 C).
With the Dorsomorphin process KMM cell of 5 μMs of concentration, find that Dorsomorphin significantly can suppress the expression (Fig. 6 D) of Id protein family.
PCDH-Id1-puro is infected in KMM cell, discovery process LAN Id1 significantly can save KMM G2/M stagnation (Fig. 6 E) that Dorsomorphin causes, cell death (Fig. 6 F), and the suppression (Fig. 6 G) of the energy for growth of grappling non-dependent in soft agar.Therefore, Dorsomorphin suppresses the one-tenth tumor ability of KMM by targeting BMP-Smad1-Id path.
The more important thing is, the lumbar injection Dorsomorphin (DM, 10mg/Kg) of dose significantly can suppress the one-tenth tumor ability (Fig. 6 H) of KMM in nude mouse.And tumour immunity group result shows, and Dorsomorphin has significantly lowered the Id1 in tumor, Ki67 expresses, and have activated the expression (Fig. 6 I) of Caspase3.Therefore, Dorsomorphin is a targeted drug being applicable to KS treatment.
Embodiment 6, cellular level drug screening
Get KMM cell, this cellular expression BMP-Smad1-Id signal path.Using this kind of cell as being used for the cell model screening the medicine suppressing BMP signal path.
Test group: with the culture of the above-mentioned cell of candidate substances process;
Matched group: without the culture of the above-mentioned cell of candidate substances process.
Appropriate time after treatment, adopts conventional method to measure the expression of the Id1 albumen of described cell.If compared with matched group, the expression of the above-mentioned albumen in test group significantly declines more than 20%, then illustrate that this candidate substances is the material of potential treatment KS.
Employing Dorsomorphin alternatively material tests, and the activity of result display BMP path significantly declines, thus it is the material of potential treatment KS.
Sum up
The present inventor finds, KSHV albumen LANA main incubation period has regulated and controled BMP-Smad1-Id signal path, and confirm Id KSHV transformant KMM and in KS disease damage tissue high expressed, confirmation Id is the indispensable driving force of KSHV transformant.
The present inventor also finds, BMP pathway inhibitor Dorsomorphin can pass through targeting BMP-Smad1-Id signal path, significantly suppresses KMM cell one-tenth tumor ability in vitro and in vivo.Therefore, BMP pathway inhibitor is the targeted drug of very promising treatment KS.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1.BMP signal pathway inhibitor improves in preparation or treats the purposes in the compositions of Kaposi's sarcoma virus infection.
2. purposes as claimed in claim 1, it is characterized in that, described Kaposi's sarcoma virus infection comprises: Kaposi's sarcoma, lymphoma primary effusion, the graceful disease in multicentricity Karst.
3. purposes as claimed in claim 1, it is characterized in that, described BMP signal pathway inhibitor comprises: Dorsomorphin and WSS25; Or their analog.
The purposes of 4.BMP signal path or its pathway protein, is characterized in that, for screening the potential material improving or treat Kaposi's sarcoma virus infection.
5. screen a method for the potential material improving or treat Kaposi's sarcoma virus infection, described method comprises:
(1) system of BMP signal path or its pathway protein is contained by candidate substances pack processing;
(2) expression or the activity of BMP signaling pathway protein in described system is detected;
Wherein, if described candidate substances can reduce expression or the activity of BMP signaling pathway protein, then show that this candidate substances is the potential material improving or treat Kaposi's sarcoma virus infection.
6. method as claimed in claim 5, it is characterized in that, step (1) comprising: in test group, candidate substances is joined in the system comprising BMP signal path; And/or
Step (2) comprising: the expression or the activity that detect BMP signaling pathway protein in the system of test group, and compares with matched group, and wherein said matched group is the system comprising BMP signal path of not adding described candidate substances;
If the expression of BMP signaling pathway protein or activity are statistically lower than matched group in test group, just show that this material standed for improves or the potential material for the treatment of Kaposi's sarcoma virus infection.
7. method as claimed in claim 5, it is characterized in that, described BMP signal path is BMP-Smad1-Id path, and described BMP signaling pathway protein comprises: BMP, Smad1, Id.
8. the method as described in as arbitrary in claim 5-7, it is characterized in that, described system is cell system.
9. method as claimed in claim 8, it is characterized in that, described system is the endogenous cell that there is BMP signal path.
10. for improving or treat a compositions for Kaposi's sarcoma virus infection, it is characterized in that, described compositions contains:
(1) BMP pathway inhibitor; Be preferably Dorsomorphin, WSS25, or their analog; With
(2) pharmaceutically acceptable carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410043666.5A CN104800847A (en) | 2014-01-29 | 2014-01-29 | Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410043666.5A CN104800847A (en) | 2014-01-29 | 2014-01-29 | Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104800847A true CN104800847A (en) | 2015-07-29 |
Family
ID=53686324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410043666.5A Pending CN104800847A (en) | 2014-01-29 | 2014-01-29 | Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104800847A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020000704A1 (en) * | 2018-06-29 | 2020-01-02 | 中国科学院深圳先进技术研究院 | Use of ampk inhibitor, compound c, in drug for treating tumors |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035627A1 (en) * | 2002-10-21 | 2004-04-29 | Cambridge University Technical Services Limited | Modulation of tgfbeta-like signalling pathways |
| WO2009114180A1 (en) * | 2008-03-13 | 2009-09-17 | The General Hospital Corporation | Inhibitors of the bmp signaling pathway |
| WO2009151600A2 (en) * | 2008-06-10 | 2009-12-17 | Tufts University | Smad proteins control drosha-mediated mirna maturation |
| CN101627055A (en) * | 2006-09-05 | 2010-01-13 | 梅达雷克斯公司 | The antibody of bone morphogenetic protein and acceptor thereof and their using method |
-
2014
- 2014-01-29 CN CN201410043666.5A patent/CN104800847A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004035627A1 (en) * | 2002-10-21 | 2004-04-29 | Cambridge University Technical Services Limited | Modulation of tgfbeta-like signalling pathways |
| CN101627055A (en) * | 2006-09-05 | 2010-01-13 | 梅达雷克斯公司 | The antibody of bone morphogenetic protein and acceptor thereof and their using method |
| WO2009114180A1 (en) * | 2008-03-13 | 2009-09-17 | The General Hospital Corporation | Inhibitors of the bmp signaling pathway |
| WO2009151600A2 (en) * | 2008-06-10 | 2009-12-17 | Tufts University | Smad proteins control drosha-mediated mirna maturation |
Non-Patent Citations (3)
| Title |
|---|
| LIU ET AL.: "Kaposi’s Sarcoma-Associated Herpesvirus-Encoded MicroRNA miR-K12-11 Attenuates Transforming Growth Factor Beta Signaling through Suppression of SMAD5", 《JOURNAL OF VIROLOGY》 * |
| TODD M.BULL ET AL.: "Human Herpesvirus-8 Infection of Primary Pulmonary Microvascular Endothelial Cells", 《AM J RESPIR CELL MOL BIOL》 * |
| YIN ET AL.: "MicroRNA miR-155 Inhibits Bone Morphogenetic Protein (BMP)Signaling and BMP-Mediated Epstein-Barr Virus Reactivation", 《JOURNAL OF VIROLOGY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020000704A1 (en) * | 2018-06-29 | 2020-01-02 | 中国科学院深圳先进技术研究院 | Use of ampk inhibitor, compound c, in drug for treating tumors |
| CN110652515A (en) * | 2018-06-29 | 2020-01-07 | 中国科学院深圳先进技术研究院 | Application of AMPK inhibitor Compound C in tumor treatment drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ruscetti et al. | Senescence-induced vascular remodeling creates therapeutic vulnerabilities in pancreas cancer | |
| Korkaya et al. | Activation of an IL6 inflammatory loop mediates trastuzumab resistance in HER2+ breast cancer by expanding the cancer stem cell population | |
| Mao et al. | MicroRNA-23a is involved in tumor necrosis factor-α induced apoptosis in mesenchymal stem cells and myocardial infarction | |
| Meng et al. | ADAM17-siRNA inhibits MCF-7 breast cancer through EGFR-PI3K-AKT activation | |
| CN103945850A (en) | Combination of a phosphoinositide 3-kinase inhibitor and a modulator of the janus kinase 2-signal transducer and activator of transcription 5 pathway | |
| US11053476B2 (en) | Generation of cancer stem cells and use thereof | |
| CN109563513B (en) | siRNA for inhibiting K-RAS gene expression and precursor and application thereof | |
| CN106574241A (en) | Cancer immunotherapy compositions and methods | |
| CN109477107A (en) | A kind of siRNA inhibiting EGFR gene expression and its precursor and application | |
| Wu et al. | Overexpression of KAI1 induces autophagy and increases MiaPaCa-2 cell survival through the phosphorylation of extracellular signal-regulated kinases | |
| Wang et al. | Stable gene-silence of Kif2a synergistic with 5-fluorouracil suppresses oral tongue squamous cell carcinoma growth in vitro and in vivo | |
| CN104800847A (en) | Use of BMP pathway inhibitor in preparation of drug for treating Kaposi's sarcoma associated herpesvirus-infected diseases | |
| WO2020010280A1 (en) | Combination therapy with mek inhibitor and cdk4/6 inhibitor to treat pancreatic cancer | |
| WO2016204216A1 (en) | Treatment-resistance reducing agent for treatment-resistant cancer | |
| CN113616645A (en) | Application of thiazolyl diazo naphthol compound in preparation of medicine for treating malignant brain glioma | |
| CN111166867B (en) | Function and use of PD-1 ubiquitination agonist | |
| Wei et al. | F25P preproinsulin abrogates the secretion of pro-growth factors from EGFRvIII cells and suppresses tumor growth in an EGFRvIII/wt heterogenic model | |
| KR20140143880A (en) | Composition for Inhibiting Senescence of Adult Stem Cells By Increasing of miRNA Expression | |
| Rahal et al. | Selective expression of constitutively active pro-apoptotic protein BikDD gene in primary mammary tumors inhibits tumor growth and reduces tumor initiating cells | |
| KR101701597B1 (en) | Pharmaceutical compositions for treatment of stk11-mutated cancer comprising cardiac glycosides | |
| Yuan et al. | Preclinical study of LMP1-RNAi-based anti-tumor therapy in EBV-positive nasopharyngeal carcinoma | |
| WO2022127788A1 (en) | Application of lenvatinib and aurora-a kinase inhibitor in preparing cancer-inhibiting drugs | |
| JP6616190B2 (en) | Muscle formation promoter, muscle atrophy inhibitor, pharmaceutical composition, and TAZ activator | |
| CN114404591B (en) | Application of CDK14 as target in preparation of medicine for treating triple negative breast cancer | |
| CN103330940B (en) | Combination formulations and preparing the application in non-small cell lung cancer drug |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150729 |
|
| WD01 | Invention patent application deemed withdrawn after publication |