CN104792751B - By the protein protein interaction in FRET method in situ quantitation living cells - Google Patents
By the protein protein interaction in FRET method in situ quantitation living cells Download PDFInfo
- Publication number
- CN104792751B CN104792751B CN201510155923.9A CN201510155923A CN104792751B CN 104792751 B CN104792751 B CN 104792751B CN 201510155923 A CN201510155923 A CN 201510155923A CN 104792751 B CN104792751 B CN 104792751B
- Authority
- CN
- China
- Prior art keywords
- fluorescin
- close
- albumen
- wavelength
- dronpa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The method of first albumen and the second albumen with the presence or absence of interacting in cell is determined by FRET method the invention discloses a kind of.The method includes：(1) the first fusion protein and the second fusion protein are expressed in cell, wherein, first fusion protein includes the first albumen and can close fluorescin as the first of donor, and second fusion protein includes the second albumen and can close fluorescin as the second of acceptor；(2) can close fluorescin and second first can close fluorescin and open, and under the conditions of 3 kinds for each individually opening, under conditions of three kinds of exciting lights and launching light detect the fluorescent value of the cell respectively, to obtain the data set being made up of fluorescence absolute value.(3) based on the data set, parameter FR numerical value is determined, and determine between first albumen and second albumen with the presence or absence of interaction based on resulting parameter FR numerical value.
Description
Technical field
The present invention relates to biological technical field, in particular it relates to the method for protein interaction, more particularly, to
The method of first albumen and the second albumen with the presence or absence of interacting in cell is determined by FRET method.
Background technology
Resonance energy transfer (RET:Resonance energy transfer), 1948 by scientist Forster first
It was found that, therefore referred to as FRET (Forster resonance energy transfer).Simultaneously because acceptor is usually fluorescence point
Son, thus FRET be also often construed as FRET (fluorescence resonance energy
transfer).Intermolecular interactions of the fluorescin FRET in research live body (living cells) level has the special of height
Property and sensitivity, become the important research meanses of life science and method.
However, FRET methods conventional at present are remained in various defects, for example, acceptor photobleaching FRET (apFRET) is one
The FRET measuring methods of own control are planted, this aspect is current more accurately FRET efficiency quantitative technique.But its deficiency exists
There is very big phototoxicity to cell in it, can only do once and temporal resolution is very poor (generally needing several minutes)；
PcFRET is that light is switched the technology that fluorophor and apFRET are combined, fortune in this way, the fluorescence intensity of donor with
The light of acceptor switches and vibrates, and it remains the accuracy feature of apFRET efficiency calculations, meanwhile, compared to apFRET, it is big
Imaging time (~10 seconds) is reduced greatly, makes calculating that there is repeatability, reduce the phototoxicity to cell, reduced to fluorescence
Albumen is quenched, but pcFRET is not suitable as the quantitative tool of double cross FRET.
Therefore, FRET technologies still need further improvement.
The content of the invention
It is contemplated that at least solving one of technical problem present in prior art.Therefore, one object of the present invention
It is to propose a kind of control experiment with needed for being quantified in FRET, need not being calculated, dynamic process can be observed, had to sample
There are four aspects of universality to meet desired new FRET methods.
It should be noted that the present invention is to be based on the following work of inventor and complete：
Inventor has found, by the PreIQ3- of ICDIF and fluorescin the rsTagRFP mark of fluorescin Dronpa marks
IQD-AD is co-expressed in mammal HEK293T, using the method for dsFRET, i.e., by following three condition each
Under part：A () opens fluorescin Dronpa, open fluorescin rsTagRFP；B () opens fluorescin Dronpa, close glimmering
Photoprotein rsTagRFP；And (c) closes fluorescin Dronpa, fluorescin rsTagRFP is opened, following three is used respectively
The fluorescent value of the cell is detected under conditions of exciting light and launching light：(1) with the light irradiation sample of 504nm, while using 542nm
Transmitting filter plate go receive launching light；(2) with the light irradiation sample of 504nm, while being gone to receive with the transmitting filter plate of 620nm
Launching light；(3) with the light irradiation sample of 565nm, while being gone to receive launching light with the transmitting filter plate of 620nm.By to obtaining
Fluorescent value be fitted calculating, obtain FR values, the interaction between protein is determined whether by FR values.Invention human hair
FRET methods (dual-switchable FRET, dsFRET) is now switched than very widely used today 3- using of the invention pair of light
Cube FRET methods, are accurately calculated, stablize, and the cell to different conditions has more universality, can more embody real egg
White interphase interaction situation.
Thus, first albumen and second in cell is determined by FRET method the invention provides a kind of
Method of the albumen with the presence or absence of interacting.Embodiments in accordance with the present invention, the method includes：
(1) the first fusion protein and the second fusion protein are expressed in cell, wherein, first fusion protein includes the
One albumen and fluorescin can be closed as the first of donor, second fusion protein includes the second albumen and as acceptor
Second can close fluorescin；
(2) under the conditions of each of following three condition：A () opens described first and can close fluorescin, open institute
Stating second can close fluorescin；B () opens described first and can close fluorescin, closing described second can close fluorescence egg
In vain；And (c) closes described first and can close fluorescin, opening described second can close fluorescin, respectively following three
Detect the fluorescent value of the cell under conditions of kind exciting light and launching light：I the wavelength of () exciting light is n1, launching light
Wavelength is n2, and wherein n1 represents the described first excitation wavelength that can close fluorescin, and n2 represents that described first can close fluorescence
Albumen receives wavelength；(ii) wavelength of exciting light is n1, and the wavelength of launching light is n4, wherein, n4 represents that described second can close
That closes fluorescin receives wavelength；And the wavelength of (iii) exciting light is n3, the wavelength of launching light is n4, wherein, n3 represents institute
Stating second can close the excitation wavelength of fluorescin, to obtain the data set being made up of following fluorescence absolute value：Sn1_n4(D&
A)、Sn1_n2(D&A)、Sn3_n4(D&A)、Sn1_n4(D_Only)、Sn1_n2(D_Only)、Sn3_n4(D_Only)、Sn1_n4(A_Only)
Sn1_n2And S (A_Only)n3_n4(A_Only), wherein, (D＆A) represents that described first can close fluorescin and second and can close
Fluorescin is opened, and (D_Only) represents that described first can close fluorescin and be opened, and described second can close fluorescence
Albumen is closed, and (A_Only) represents that described first can close fluorescin and be closed, and described second can close fluorescin quilt
Open.
(3) based on the data set, parameter FR numerical value is determined, and first egg is determined based on the parameter FR numerical value
In vain with the presence or absence of interaction between second albumen.
Compared with prior art, the present invention at least has following beneficial technique effect：
1., for the measurement of FRET efficiency, can realize quantifying, can expire without donor and acceptor control, temporal resolution
The demand of sertoli cell general dynamics process, to dimer or two hybridization experiments be applicable；
2. on a cellular level, FRET parameters and FRET efficiency calculations based on cells in situ are closer to actual conditions, phase
It is more more accurate than its measured value in conventional method；
3., without control experiment, experiment expense is saved；
4. on subcellsular level, realize that FRET is quantified based on intracellular parameter in situ, obtain the intracellular point of FRET efficiency
Cloth is imaged.
Additional aspect of the invention and advantage will be set forth in part in the description, and will partly become from the following description
Obtain substantially, or recognized by practice of the invention.
Brief description of the drawings
Of the invention above-mentioned and/or additional aspect and advantage will become from description of the accompanying drawings below to embodiment is combined
Substantially and be readily appreciated that, wherein：
Fig. 1 shows dsFRET basic principle schematics according to an embodiment of the invention；
Fig. 2 shows dsFRET imaging devices schematic diagram according to an embodiment of the invention；
Fig. 3 shows dsFRET experiment flows figure according to an embodiment of the invention；
Fig. 4 shows Dronpa according to an embodiment of the invention and the mammalian cell HEK293T's of rsTagRFP couples
DsFRET experimental results and the schematic diagram with the experimental result of 3-cube FRET；
Fig. 5 shows Dronpa according to an embodiment of the invention and the mammalian cell HEK293T's of rsTagRFP couples
The data statistics schematic diagram that dsFRET is tested and 3-cube FRET are tested；
Fig. 6 shows ICDIF and the rsTagRFP mark of Dronpa marks according to an embodiment of the invention
The FR value schematic diagrames of the dsFRET experiments of PreIQ3-IQD-AD double cross；
Fig. 7 shows ICDIF and the rsTagRFP mark of Dronpa marks according to an embodiment of the invention
The FR value schematic diagrames of the 3-cube FRET experiments of PreIQ3-IQD-AD double cross；
Fig. 8 shows ICDIF and the rsTagRFP mark of Dronpa marks according to an embodiment of the invention
The binding curve schematic diagram to Ab of PreIQ3-IQD-AD；
Fig. 9 shows ICDIF and the rsTagRFP mark of Dronpa marks according to an embodiment of the invention
The binding curve schematic diagram to Dfree of PreIQ3-IQD-AD；
Figure 10 show under a visual field according to an embodiment of the invention two ICDIF of expression Dronpa marks with
The schematic three dimensional views of the FR values being calculated with dsFRET methods of the cell of the PreIQ3-IQD-AD of rsTagRFP marks；
Figure 11 show under a visual field according to an embodiment of the invention two ICDIF of expression Dronpa marks with
The three-dimensional signal of the FR values being calculated with 3-cube FRET methods of the cell of the PreIQ3-IQD-AD of rsTagRFP marks
Figure；
Figure 12 shows the lactation of the expression rsTagRFP-Dronpa of micro- sem observation according to an embodiment of the invention
Picture, 33-FRET fluorescence imagings figure and dsFRET fluorescence imaging figures that two channel fluorescences of cell HEK293T are imaged；
Figure 13 shows the mammalian cell HEK293T of expression rsTagRFP-Dronpa according to an embodiment of the invention
Line tracking schematic diagram；
Figure 14 shows the mammalian cell HEK293T of expression rsTagRFP-Dronpa according to an embodiment of the invention
The schematic diagram of the ratio of cell membrane and cytoplasm correlation；
Figure 15 shows coexpression rsTagRFP-Dronpa-ras according to an embodiment of the invention and rsTagRFP's
The Fluorescent micrograph of the subcellular proteomics of mammalian cell HEK293T；And
Figure 16 shows expression rsTagRFP-Dronpa according to an embodiment of the invention with coexpression rsTagRFP-
The statistics schematic diagram of FR ratios at the cell membrane and cytoplasm of the mammalian cell HEK293T of Dronpa-ras, rsTagRFP.
Specific embodiment
Embodiments of the invention are described below in detail, the example of the embodiment is shown in the drawings, wherein from start to finish
Same or similar label represents same or similar element or the element with same or like function.Below with reference to attached
It is exemplary to scheme the embodiment of description, is only used for explaining the present invention, and is not considered as limiting the invention.
The general principle of FRET method of the invention as shown in figure 1, one biswitch FRET pairs of design,
That is Donor albumen and Accepter albumen, by it is different can backlight can switch two kinds of switches of albumen, such that it is able to original position
Obtain parameter needed for calculating.
Further, FRET method of the invention is applied to existing FRET imaging devices, is formed
DsFRET imaging devices, as shown in Fig. 2 also, the need for FRET method of the invention, inventor couple
Existing FRET devices are improved, and are mainly included：
(1) using the long-service-life metal halide lamp from bottom irradiating sample；
(2) great power LED and its control circuit from top irradiating sample are used in；
(3) use can obtain the exciter filter rotating disk of the irradiation light of different wave length；
(4) microscope uses inverted microscope；
(5) use can reflect the dichroscope rotating disk of different wave length irradiation light and transmission emitting at different wavelengths light；
(6) using being capable of focusing illumination light and the object lens for collecting launching light；
(7) use can detect the detector of transmitting fluorescence；
(8) using being capable of each hardware of control device and the computer for carrying out graphical analysis.
Using the dsFRET imaging devices, can on cellular level and subcellsular level, realize it is quantitative, without donor and
Acceptor control, temporal resolution disclosure satisfy that the detection of the protein interaction of the demand of cell general dynamics process.
Thus, first albumen and second in cell is determined by FRET method the invention provides a kind of
Method of the albumen with the presence or absence of interacting.
Wherein, term used herein " FRET ", i.e. FRET, refer to apart from two close fluorescence point
A kind of energy transfer phenomenon produced between son.When the emission spectrum and the absorption spectrum weight of acceptor fluorescence molecule of donor fluorescent molecule
It is folded, and two distances of molecule are when within 10nm scopes, and a kind of energy transfer of on-radiation will occur, i.e. and FRET shows
As so that many (fluorescent quenchings) that will be low during its individualism of the fluorescence intensity ratio of donor, and the fluorescence of acceptor emission is significantly
Enhancing (sensitized fluorescence).And in vivo, if two distances of protein molecule are within 10nm, it is considered that the two
There is direct interaction in protein molecule.Thus, using FRET methods the first albumen and the second albumen can be determined in cell
In with the presence or absence of interact.
Embodiments in accordance with the present invention, the method includes：
(1) the first fusion protein and the second fusion protein are expressed in cell, wherein, first fusion protein includes the
One albumen and fluorescin can be closed as the first of donor, second fusion protein includes the second albumen and as acceptor
Second can close fluorescin.Specific example of the invention, described first can close fluorescin selected from following：
One of Dronpa, PDM1-4, Dronpa-2, Dronpa-3, reFastLime, bsDronpa, Padron, Mut2Q and reEGFP.
Preferably, described first fluorescin can be closed for Dronpa, wherein, the DNA sequence dna of Dronpa is：
atgagtgtgattaaaccagacatgaagatcaagctgcgtatggaaggcgctgtaaatggacacccgttcgcgattga
aggagttggccttgggaagcctttcgagggaaaacagagtatggaccttaaagtcaaagaaggcggacctctgcctt
tcgcctatgacatcttgacaactgtgttctgttacggcaacagggtattcgccaaatacccagaaaatatagtagac
tatttcaagcagtcgtttcctgagggctactcttgggaacgaagcatgaattacgaagacgggggcatttgtaacgc
gacaaacgacataaccctggatggtgactgttatatctatgaaattcgatttgatggtgtgaactttcctgccaatg
gtccagttatgcagaagaggactgtgaaatgggagccatccactgagaaattgtatgtgcgtgatggagtgctgaag
ggtgatgttaacatggctctgtcgcttgaaggaggtggccattaccgatgtgacttcaaaactacttataaagctaa
gaaggttgtccagttgccagactatcactttgtggaccaccacattgagattaaaagccacgacaaagattacagta
atgttaatctgcatgagcaCgccgaagcgcattctgagctgccAaggcaggccaagtaa(SEQ ID NO：1)
Described second can close fluorescin selected from following：RFP、RFP、asFP595、KFP1、rsCherry、
One of rsCherryRev and rsTagRFP.Preferably, described second fluorescin can be closed for RFP.
Wherein, the RFP is rsTagRFP, and the DNA sequence dna of rsTagRFP is：
Atggtgtctaagggcgaagagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtgaacaacca
ccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagg
gcggccctctccccttcgccttcgacatcctggctaccagcttcatgtacggcagccgcaccttcatcaaccacacc
cagggcatccccgacttctggaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgg
gggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagctcagaggggtga
acttcccatccaacggccctgtgatgcagaagaaaacactcggctgggaggccgccaccgagatgctgtaccccgct
gacggcggcctggaaggcagaggggacatggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagac
cacatacagatccaagaatcccgctaagaacctcaagatgcccggcgtctactttgtggaccacagactggaaagaa
tcaaggaggccgacaaagagacctacgtcgagcagcacgaggtggctgtggccagatactgcgacctccctagcaaa
ctggggcacaagcttaat(SEQ ID NO：2).
Thus, the fluorescent brightness of fluorescin is good, and imaging resolution is high, FRET efficiency highs.
Wherein, term used herein " can close fluorescin " refers to that fluorescin can be by different wave length or intensity
Laser irradiation makes the protein manifest or hide fluorescence respectively, and specifically, fluorescin can be activated with a kind of laser of wavelength,
By the laser shutdown of another wavelength or intensity, and can switch repeatedly repeatedly.In the present invention, Dronpa is short in 430nm
Time irradiation can be activated, and in 505nm, irradiation is closed for a long time；RsTagRFP can be activated in 430nm short irradiations,
565nm for a long time close by irradiation.
In the present invention, it is not particularly limited as the species of " donor " and the closed fluorescin of " acceptor ", but should be expired
It is enough to lower condition：
(1) emission spectrum of donor by acceptor absorbance and can produce fluorescence signal, emission spectrum and the acceptor of donor
Excitation spectrum must have significantly overlap (>30%)；
(2) the dipole moment spatial orientation of donor and acceptor can not be mutually perpendicular to；
(3) under dimer state, the distance of its luminous group is not to be exceeded 10nm (more near better) for donor and acceptor,
(4) in theory, the higher the better for the quantum yield of donor, and the higher the better for the extinction coefficient of acceptor.Inventor has found nothing
By for acceptor or donor, quantum yield and extinction coefficient are that the higher the better；
(5) have on the conditioned basic of notable overlap in acceptor emission spectrum and donor PLE, the stoke of acceptor and donor
This displacement is the bigger the better.
" the first albumen " and " the second albumen " in the present invention, it is possible to use want the testing protein that detection interacts.
" interaction " of the first albumen and the second albumen not only includes direct interaction in the present invention, is additionally included in the
Between one albumen and the second albumen complex is formed by other molecules (micromolecular compound, sugar, lipid, nucleic acid and protein etc.)
Such Indirect Interaction.
(2) under the conditions of each of following three condition：A () opens described first and can close fluorescin, open institute
Stating second can close fluorescin；B () opens described first and can close fluorescin, closing described second can close fluorescence egg
In vain；And (c) closes described first and can close fluorescin, opening described second can close fluorescin, respectively following three
Detect the fluorescent value of the cell under conditions of kind exciting light and launching light：I the wavelength of () exciting light is n1, launching light
Wavelength is n2, and wherein n1 represents the described first excitation wavelength that can close fluorescin, and n2 represents that described first can close fluorescence
Albumen receives wavelength；(ii) wavelength of exciting light is n1, and the wavelength of launching light is n4, wherein, n4 represents that described second can close
That closes fluorescin receives wavelength；And the wavelength of (iii) exciting light is n3, the wavelength of launching light is n4, wherein, n3 represents institute
Stating second can close the excitation wavelength of fluorescin.
, wherein it is desired to explanation, first and second can close the excitation wavelength and wavelength of transmitted light of fluorescin not
Be particularly limited, if excite luminous energy excite can close fluorescin light, transmitting luminous energy receive exciting for fluorescin
Light, also, it will be understood by those skilled in the art that according to different fluorescins, the wavelength of exciting light and launching light is not
Together, the wavelength of same fluorescin, exciting light and launching light can fluctuate around certain certain value, for example, Dronpa is glimmering
The a length of 490-510nm of excitation light wave of photoprotein, preferably 500nm, wavelength of transmitted light is 530-550nm, preferably 540nm,
The a length of 555-575nm of excitation light wave of rsTagRFP fluorescins, preferably 565nm, wavelength of transmitted light is 610-630nm, preferably
620nm.Specific example of the invention, n1 is 500nm, and n2 is 540nm, and n3 is 565nm, and n4 is 620nm.Thus, it is possible to
Dronpa and rsTagRFP fluorescins are efficiently excited to light.To obtain the data set being made up of following fluorescence absolute value：
Sn1_n4(D&A)、Sn1_n2(D&A)、Sn3_n4(D&A)、Sn1_n4(D_Only)、Sn1_n2(D_Only)、Sn3_n4(D_Only)、Sn1_n4
(A_Only)Sn1_n2And S (A_Only)n3_n4(A_Only), wherein, (D＆A) represents that described first can close fluorescin and
Two can close fluorescin is opened：(D_Only) expression described first can close fluorescin and be opened, and described second can
Fluorescin is closed to be closed；(A_Only) represent that described first can close fluorescin and be closed, described second can close it is glimmering
Photoprotein is opened.
Specifically, fluorescin as donor can be closed using Dronpa, rsTagRFP can close fluorescin as acceptor,
With reference to Fig. 1, the data set to above-mentioned fluorescence absolute value composition is further illustrated, Sn1_n2(D＆A), i.e. S500_540(D＆A) it is Fig. 1
In 9 passage the first rows (acceptor donor is opened entirely) first row fluorescence absolute value, excite Dronpa (donor), excitation wavelength
It is 500, receives Dronpa (donor), receives light wave a length of 540；Sn1_n2(D＆A), i.e. S500_620(D＆A), it is 9 passages in Fig. 1
The fluorescence absolute value of a line (acceptor donor is opened entirely) secondary series, excites Dronpa (donor), excitation light wave a length of 500 to connect
RsTagRFP (acceptor) is received, light wave a length of 620 is received；Sn3_n4(D＆A), i.e. S565_620(D＆A) it is that 9 passage the first rows (are received in Fig. 1
Body donor is opened entirely) tertial fluorescence absolute value, excite rsTagRFP (acceptor), excitation light wave a length of 565 to receive
RsTagRFP (acceptor), receives light wave a length of 620；Sn1_n2(D_Only), i.e. S500_540(D) it is 9 the second rows of passage (pass in Fig. 1
Close acceptor) the fluorescence absolute value of first row, excite Dronpa (donor), excitation light wave a length of 500 to receive Dronpa (donor),
Receive light wave a length of 540；Sn1_n4(D_Only), i.e. S500_620(D) it is 9 the second row of passage (closing acceptor) secondary series in Fig. 1
Fluorescence absolute value.Dronpa (donor), excitation light wave a length of 500 is excited to receive rsTagRFP (acceptor), receive light wave a length of
620；Sn3_n4(D_Only), i.e. S565_620 (D), is that 9 the second row of passage (closing acceptor) tertial fluorescence are absolute in Fig. 1
Value, excites rsTagRFP (acceptor), excitation light wave a length of 565 to receive rsTagRFP (acceptor), receive light wave a length of 620；Sn1_n2
(A_Only), i.e. S500_540(A) be 9 passage the third lines (closing donor) first row in Fig. 1 fluorescence absolute value.Excite Dronpa
(donor), excitation light wave a length of 500 receives Dronpa (donor), receives light wave a length of 540；Sn1_n4(A_Only), i.e. S500_620
(A), it is the fluorescence absolute value of 9 passage the third lines (closing donor) secondary series in Fig. 1, excites Dronpa (donor), excitation light wave
A length of 500, rsTagRFP (acceptor) is received, receive light wave a length of 620；Sn3_n4(A_Only), i.e. S565_620(A) it is 9 to lead in Fig. 1
Road the third line (closing donor) tertial fluorescence absolute value, excites rsTagRFP (acceptor), excitation light wave a length of 565 to receive
RsTagRFP (acceptor), receives light wave a length of 620.
, wherein it is desired to explanation, the order of (a), (b) and (c) item is not particularly limited in step (2), can be with root
The characteristics of according to specific equipment, is adjusted, as long as completing this 3 operations, accurate acquisition each group of data.Meanwhile, step (2)
In the order of (i), (ii) and (iii) item be not also particularly limited, as long as completing this 3 operations, accurate acquisition each group of data
.(3) based on the data set, parameter FR numerical value is determined, and first albumen is determined based on the parameter FR numerical value
With the presence or absence of interaction between second albumen.
, wherein it is desired to explanation, the computing formula of parameter FR is not particularly limited, as long as can be experimental specific
Demand, the interaction between albumen is judged by the formula.Preferably, in abovementioned steps (3), the parameter FR is
Determined based on following equation：
Wherein, n1 represents the described first excitation wavelength that can close fluorescin, and n2 represents that described first can close fluorescence
Albumen receives wavelength；N4 represent described second can close fluorescin receive wavelength；And n3 represents that described second can close
Close the excitation wavelength of fluorescin.
Based on by parameter FR numerical value obtained by above-mentioned formula determine between first albumen and second albumen whether
Include in the presence of interaction, the parameter FR numerical value and predetermined threshold value are compared, if the parameter FR numerical value is less than
The threshold value, then in the absence of interacting between first albumen and second albumen, if the parameter FR numerical value is big
In the threshold value, then exist between first albumen and second albumen and interact.
, wherein it is desired to explanation, using different FR computing formula, and different donor and acceptor, threshold value also can
Change accordingly.Embodiments in accordance with the present invention, based on the FR values that above-mentioned formula is obtained, are made using Dronpa fluorescins
It is donor, used as acceptor, the threshold value is at least 1, preferably 1.5~4 to rsTagRFP fluorescins.Specifically, FR values are near 1
When, without interaction between expression albumen.When FR values are between 1.5-4, represent between them there is interaction, FR values reach 4
When, the interaction between albumen be believed that reach it is most strong.
In an experiment, generally cell mass or tissue are measured, obtain the FR values of each cell in the cell mass or tissue,
And the FR set of values of the cell mass or tissue is constituted, and statistical analysis is carried out to the FR set of values, judge the cell mass or tissue
With the presence or absence of interaction between intracellular protein.
The species of " cell " of the invention is not particularly limited, and both can be eukaryotic, or prokaryotic,
For example, zooblast, plant cell, yeast, Escherichia coli etc..Additionally, the cell both can come from vitro culture (for example,
The cell of induction is bred in culture medium), or exist in vivo in body cell (for example, first fusion protein of expression
Cell in the transgenic animals body of the DNA of DNA and the second fusion protein).
Compared with prior art, the present invention at least has one of technique effect following prominent：
(1) for the measurement of FRET efficiency, can realize it is quantitative, compareed without donor and acceptor, temporal resolution
Disclosure satisfy that the detection of the protein interaction of the demand of cell general dynamics process and to dimer or double cross reality
The protein tested is applicable；
(2) on a cellular level, FRET parameters and FRET efficiency are obtained based on cells in situ, as a result closer to actual feelings
Condition, compared to conventional method, its measured value is more accurate；
(3) without control experiment, experiment expense is saved；
(4) on subcellsular level, FRET quantitative determinations are realized based on intracellular parameter in situ, obtains the born of the same parents of FRET efficiency
Inside it is scattered in picture.
Below with reference to specific embodiment, the present invention will be described, it is necessary to explanation, these embodiments are only explanation
Property, and be not considered as limiting the invention.
The solution of the present invention is explained below in conjunction with embodiment.It will be understood to those of skill in the art that following
Embodiment is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.Unreceipted particular technique or bar in embodiment
Part, (for example write with reference to J. Pehanorm Brookers etc., Huang Peitang etc. is translated according to the technology or condition described by document in the art
's《Molecular Cloning:A Laboratory guide》, the third edition, Science Press) or carried out according to product description.Agents useful for same or instrument
Unreceipted production firm person, be can by city available from conventional products, can for example purchase from Illumina companies.
Embodiment 1 (dsFRET feasibilities)
The feasibility of dsFRET is proved using the dimer and coexpression experiment of Dronpa and rsTagRFP.
1st, experimental technique：
Dronpa and rsTagRFP (medical college of Tsing-Hua University transmembrane signal transduction laboratory) be all it is existing can backlight cut
Fluorescin is changed, we are by DNA sequence dna (the i.e. SEQ ID NO of its purpose fragment：DNA sequence dna shown in 1 and 2) using PCR's
Mode is connected on eukaryotic vector pcDNA3.1.
By Dronpa and two sections of purpose fragments of rsTagRFP according to traditional FRET dimers CFP-YFP connected mode,
One section of base sequence of TCCGGACTCAGATCT is added in centre, being connected and be connected to eucaryon Dronpa with rsTagRFP carries
On body pcDNA3.1.
In cell experiment, we are transfected using transfection reagent lipo2000, and carrier is transfected into HEK293T cells
It is interior.Transfection terminates latter 24-48 hours, and cell can give expression to substantial amounts of destination protein, to test.
DsFRET imaging devices and 3cube-FRET imaging devices shown in Fig. 2 are utilized respectively, destination protein is examined
Survey, and testing result is analyzed.
2nd, experimental result
As shown in Figure 4 and Figure 5, in fig. 4, dark solid dot represents an expression Donpa and rsTagRFP to experimental result
Dimer rsTagRFP-Dronpa mammalian cell HEK293T dsFRET result of calculations, dark solid is its linear fit
Line, dark solid be in FR values 3-4 between, illustrate Donpa and rsTagRFP dimer two kinds of albumen between have stronger phase
Interaction；Light filled circles represent a dsFRET of the mammalian cell HEK293T of coexpression rsTagRFP and Dronpa and calculate
As a result, light solid line is its Linear Quasi zygonema, and light solid line is between FR values 1-1.5, illustrate to be co-expressed rsTagRFP and
In the mammalian cell of Dronpa, rsTagRFP interacts with the presence of two kinds of albumen of Dronpa, but it is weaker to interact；It is dark
Dotted line and the linear fit that light dotted line is respectively Dronpa and rsTagRFP dimers and 3cube-FRET when being co-expressed, it is real
Test result consistent with the testing result of dsFRET.In Figure 5, during dimer for Dronpa and rsTagRFP,
The experimental result of 3cube-FRET and dsFRET be respectively 3.20 ± 0.18 and 3.51 ± 0.13 (± number before digitized representation average,
± rear digitized representation standard error), the result of the two is consistent, has very strong between two kinds of albumen of the dimer of Donpa and rsTagRFP
Interaction, but dsFRET experimental data differences are smaller, and the standard error of statistics is smaller, and the stability of method is more preferable.It is right
In Dronpa and the situation of the coexpression of rsTagRFP, the experimental result of 3cube-FRET and dsFRET is respectively 1.35 ± 0.12
With 1.15 ± 0.10 (± number before digitized representation average, ± rear digitized representation standard error), the result of the two is consistent, and the two shows
In the mammalian cell of rsTagRFP and Dronpa, be present interaction in two kinds of albumen of rsTagRFP and Dronpa, but interact
It is weaker, and dsFRET experimental data differences are smaller, the standard error of statistics is smaller, and the stability of method is more preferable.
Embodiment 2 (two hybridization experiments)
Using dsFRET methods, using the dsFRET imaging devices shown in Fig. 2, the ICDI albumen of detection Dronpa marks with
RsTagRFP mark PreIQ3-IQD-AD albumen in two hybridization experiments, two kinds of interaction situations of albumen, wherein,
The DNA sequence dna of ICDI albumen is as follows：
ctgcacgtgcctggaacccactcggaccccagccatgggaagaggggcagtgccgacagcttggtggaggctgtgct
tatctcagagggtctgggcctctttgctcgagacccacgtttcgtggccctggccaagcaggagattgcagatgcgt
gtcgcctgacgctggatgagatggacaatgctgccagtgacctgctggcacagggaaccagctctctctatagcgac
gaggagtccatcctctcccgcttcgatgaggaggacttgggagacgagatggcctgcgtccacgccctc(SEQ ID
NO：3)
The DNA sequence dna of Pre-IQ3-AD albumen is as follows：
atcaagactgaaggcaacctggagcaagctaatgaagagctccgcgctgtgataaagaaaatctggaagaagacaag
catgaagctacttgaccaagttgtccctccagctggtgatgatgaggtaaccgtggggaagttctatgccactttcc
tgatacaggactactttaggaaattcaagaagcggaaagagcaaggcctggtggggaaataccctgcgaagaacacc
acgatcgccctacaggcgggattaaggaccctgcatgacattgggccagaaatccgacgggctatatcctgtgactt
gcaagatgacgaaccagaagactccaaaccagaagaggaagatgtattcaaaagaaatggtgccctgcttggaaact
atgtcaatcatgttaatagtgataggagagagtcccttcagcagaccaataccacccaccgtcccctgcatgtccaa
aggccttcaattccacctgcaagtgatactgagaaaccgctgtttcctccagcaggaaattcggtgtgtcataacca
tcataaccataattccatagggaagcaagttcccacctccacaaatgccaatctcaataacgccaatatgtccaaag
ctgcccacggaaagcggcccagcattggggaccttgagcatgtgtctgaaaacggccat(SEQ ID NO：4).
1st, experimental procedure：
DsFRET imaging devices and 3cube-FRET imaging devices shown in Fig. 2 are utilized respectively, in two hybridization experiments
ICDI albumen and PreIQ3-IQD-AD albumen are detected, and analyze the interactively of above two albumen.
2nd, experimental result：As shown in Figure 6 and Figure 7, each independent open circles and solid dot are represented with biography experimental result respectively
The one of the coexpression Dronpa-ICDIF and rsTagRFP-PreIQ3-IQD-AD that system 3-cube FRET and dsFRET method are calculated
The FR values of individual single mammalian cell HEK293T.
FR is calculated to Dfree and Ab with two methods of dsFRET and 3-cube FRET respectively, wherein, Dfree represents true
Free donor concentrations, Ab represents the binding curve of true bind receptor concentration, binding curve, as a result as shown in Figure 8 and Figure 9,
Compared to 3-cube FRET computational methods, more preferably, the Kd values for obtaining are higher, closer for dsFRET computational methods fitting result
The FR values of Dimer.In the binding curve figure with Dfree, the relative residual error difference of the FR values fitting that two methods are calculated
It is 0.32 and 0.20, from the point of view of residual error, the stability of dsFRET methods is better than traditional 3-cube FRET methods.
To four cells in the visual field of a wide field, calculate what Fig. 6 was measured with two methods of dsFRET and 3-cube FRET
The 3-dimensional figure (reservation sign) of the difference (residual error) of the match value that FR values are combined with it to Dfree, as a result as shown in Figure 10, Figure 11,
20 × 20 equalization processing has been carried out to image.Contrast dsFRET (Figure 10) and 3-cube FRET (Figure 11) two methods, can
To see, the value more stable homogeneous being calculated with dsFRET are more nearly match value, and FR values and the fitting of different cells are tied
Fruit difference is little.And the value being calculated with 3-cube FRET is then not sufficiently stable, part cell has larger relative to match value
Difference.And the two cells are the experiments for having transfected same plasmid, having been carried out under same environment, its FR theoretical value should be identical
's.It is therefore contemplated that dsFRET methods are accurately calculated compared to 3-cube FRET methods, stablize, to different conditions
Cell has more universality, can more embody the interphase interaction situation of real albumen.
One cell interior fluorescence is detected using the dsFRET imaging devices shown in Fig. 2, as a result such as Figure 12-14 institutes
Show.In Fig. 10, when the figure in the figure in the upper left corner and the upper right corner is respectively Dronpa passages figure, the Dronpa passes when rsTagRFP is closed
RsTagRFP passage figures.The figure in the lower left corner and the figure in the lower right corner are respectively that 3-cube FRET and dsFRET schemes.From 3-cube
It is high-visible in FRET figures, kytoplasm FRs of the FR higher than cell on the film of the cell.Actually rsTagRFP-Dronpa does not have
Any film targeting, this can be proved by two above figures.Therefore, the result of calculation of 3-cube FRET brings illusion.And review
DsFRET results, we are not observed similar phenomenon.Then, to having done track line analysis at red line in Figure 12, as a result such as
Shown in Figure 13.Trajectory is 8 results of rolling average.In the statistics of Figure 14, the average value at cell membrane is rail
12 maximum average values of continuous image vegetarian refreshments of average value in 20 pixels wider at cell membrane on trace；And at cytoplasm
Average value be in trajectory at cytoplasm 37 to 141 wait continuous image vegetarian refreshments average value.The above results show,
To intracellular protein, situation is detected dsFRET methods respectively, and accuracy as a result is high, can more really react subcellular fraction
FRET phenomenons under level.
In sum, dsFRET imaging methods of the invention are compared with 3cube FRET imaging methods, and the dynamic of imaging is empty
Between it is big, and using parameter in situ, therefore, fluorescent quantitation measurement effect is good and stably, without control group, and to cytotoxic
Property, can Continuous Observation, it is adaptable to various experiment demands.
Embodiment 3 (subcellsular level cell imaging)
DsFRET provides a kind of means of FRET subcellular fractions imaging, using dsFRET methods, using shown in Fig. 2
DsFRET imaging devices, detect to HEK293T cells, as a result as shown in Figure 15, Figure 16, in fig .15, its first row generation
Dronpa passage figure of the table cell when rsTagRFP is in off status；Secondary series represents cell when Dronpa is in off status
RsTagRFP passage figures；3rd row represent dsFRET FR subcellsular level distribution maps.In figure 16, the FR at cell membrane takes
From three average values of continuous image vegetarian refreshments of maximum average value at cell membrane in a trajectory of cell；FR at cytoplasm takes from
Tens average values of pixel at cytoplasm in the same trajectory of cell.All experimental procedures are consistent with step before, in meter
When calculating FRET values, by the way of pointwise rather than mean value computation.Thus, intracellular original can be based on using dsFRET imaging devices
Position parameter realizes that FRET is quantified, and the intracellular for obtaining FRET efficiency is scattered in picture.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means to combine specific features, structure, material or spy that the embodiment or example are described
Point is contained at least one embodiment of the invention or example.In this manual, to the schematic representation of above-mentioned term not
Necessarily refer to identical embodiment or example.And, the specific features of description, structure, material or feature can be any
One or more embodiments or example in combine in an appropriate manner.
Although an embodiment of the present invention has been shown and described, it will be understood by those skilled in the art that：Not
Can these embodiments be carried out with various changes, modification, replacement and modification in the case of departing from principle of the invention and objective, this
The scope of invention is limited by claim and its equivalent.
Claims (13)
1. the first albumen whether there is phase interaction with the second albumen during one kind determines cell by FRET method
Method, it is characterised in that including：
(1) the first fusion protein and the second fusion protein are expressed in cell, wherein, first fusion protein includes the first egg
Fluorescin can be closed in vain and as the first of donor, second fusion protein includes the second albumen and as acceptor second
Fluorescin can be closed；
(2) under the conditions of each of following three condition：
A () opens described first and can close fluorescin, opening described second can close fluorescin；
B () opens described first and can close fluorescin, closing described second can close fluorescin；And
C () closes described first and can close fluorescin, opening described second can close fluorescin,
Carry out detecting the fluorescent value of the cell under conditions of following three exciting light and launching light respectively：
I the wavelength of () exciting light is n1, the wavelength of launching light is n2, wherein, n1 represents that described first can close fluorescin
Excitation wavelength, n2 represent described first can close fluorescin receive wavelength；
(ii) wavelength of exciting light is n1, and the wavelength of launching light is n4, wherein, n4 represents that described second can close fluorescin
Receive wavelength；And
(iii) wavelength of exciting light is n3, and the wavelength of launching light is n4, wherein, n3 represents that described second can close fluorescin
Excitation wavelength,
To obtain the data set being made up of following fluorescence absolute value：Sn1_n4(D&A)、Sn1_n2(D&A)、Sn3_n4(D&A)、Sn1_n4
(D_Only)、Sn1_n2(D_Only)、Sn3_n4(D_Only)、Sn1_n4(A_Only)Sn1_n2And S (A_Only)n3_n4(A_Only),
Wherein, (D＆A) represents that described first can close fluorescin and second and can close fluorescin and be opened,
(D_Only) expression described first can close fluorescin and be opened, and described second can close fluorescin is closed,
(A_Only) expression described first can close fluorescin and be closed, and described second can close fluorescin is opened；With
And
(3) based on the data set, determine parameter FR numerical value, and based on the parameter FR numerical value determine first albumen with
With the presence or absence of interaction between second albumen.
2. method according to claim 1, it is characterised in that described first can close fluorescin be selected from it is following：
Dronpa, PDM1-4, Dronpa-2, Dronpa-3, reFastLime, bsDronpa, Padron, Mut2Q and reEGFP
One of.
3. method according to claim 2, it is characterised in that described first can close fluorescin for Dronpa.
4. method according to claim 2, it is characterised in that described second can close fluorescin be selected from it is following：
One of RFP, asFP595, KFP1, rsCherry, rsCherryRev and rsTagRFP.
5. method according to claim 4, it is characterised in that described second can close fluorescin for RFP.
6. method according to claim 5, it is characterised in that the RFP is rsTagRFP.
7. method according to claim 2, it is characterised in that the Dronpa has SEQ ID NO：Sequence shown in 1.
8. method according to claim 6, it is characterised in that the rsTagRFP has SEQ ID NO：Sequence shown in 2
Row.
9. method according to claim 8, it is characterised in that n1 is 500nm, and n2 is 540nm, and n3 is 565nm, and n4 is
620nm。
10. the method according to any one of claim 1~9, it is characterised in that in step (3), the parameter FR numerical value
It is to be determined based on following equation：
Wherein,
N1 represents the described first excitation wavelength that can close fluorescin；
N2 represent described first can close fluorescin receive wavelength；
N3 represents the described second excitation wavelength that can close fluorescin；And
N4 represent described second can close fluorescin receive wavelength.
11. methods according to claim 10, it is characterised in that in step (3), it is true based on resulting parameter FR numerical value
It is fixed to include with the presence or absence of interaction between first albumen and second albumen：By the parameter FR numerical value with it is predetermined
Threshold value is compared,
If the parameter FR numerical value is less than the threshold value, in the absence of mutual between first albumen and second albumen
Effect,
If the parameter FR numerical value is more than the threshold value, there is phase interaction between first albumen and second albumen
With.
12. methods according to claim 11, it is characterised in that the threshold value is at least 1.
13. methods according to claim 12, it is characterised in that the threshold value is at least 1.5~4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155923.9A CN104792751B (en) | 2015-04-02 | 2015-04-02 | By the protein protein interaction in FRET method in situ quantitation living cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510155923.9A CN104792751B (en) | 2015-04-02 | 2015-04-02 | By the protein protein interaction in FRET method in situ quantitation living cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104792751A CN104792751A (en) | 2015-07-22 |
| CN104792751B true CN104792751B (en) | 2017-06-23 |
Family
ID=53557736
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510155923.9A Active CN104792751B (en) | 2015-04-02 | 2015-04-02 | By the protein protein interaction in FRET method in situ quantitation living cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104792751B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106918584B (en) * | 2017-04-25 | 2019-07-12 | 清华大学 | A method of the single molecular fluorescence Resonance energy transfer based on photoactivation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4257306A (en) * | 1978-01-23 | 1981-03-24 | Daniel Laflamme | Electronic display device for fretted stringed instruments |
| CN101375164A (en) * | 2005-12-20 | 2009-02-25 | 奥里巴Abx股份有限公司 | Method of discriminating at least two cell populations, and application |
-
2015
- 2015-04-02 CN CN201510155923.9A patent/CN104792751B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4257306A (en) * | 1978-01-23 | 1981-03-24 | Daniel Laflamme | Electronic display device for fretted stringed instruments |
| CN101375164A (en) * | 2005-12-20 | 2009-02-25 | 奥里巴Abx股份有限公司 | Method of discriminating at least two cell populations, and application |
Non-Patent Citations (2)
| Title |
|---|
| Monitoring multiple distances within a single molecule using switchable FRET;Stephan Uphoff等;《nature methods》;20101031;第7卷(第10期);全文 * |
| Tomographic imaging of ratiometric fluorescence resonance energy transfer in scattering media;Yi Zhang等;《APPLIED OPTICS》;20120720;第51卷(第21期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104792751A (en) | 2015-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sun et al. | Monitoring protein interactions in living cells with fluorescence lifetime imaging microscopy | |
| Ishikawa-Ankerhold et al. | Advanced fluorescence microscopy techniques—Frap, Flip, Flap, Fret and flim | |
| Festy et al. | Imaging proteins in vivo using fluorescence lifetime microscopy | |
| JP6223538B2 (en) | Digitally enhanced microscope for multiplexed tissue | |
| JP5307539B2 (en) | Biological sample imaging method and biological sample imaging apparatus | |
| CN107532333A (en) | Microtraps screening device, method and product | |
| Podgorski et al. | Ultra-bright and-stable red and near-infrared squaraine fluorophores for in vivo two-photon imaging | |
| Yengo et al. | Fluorescence anisotropy and resonance energy transfer: powerful tools for measuring real time protein dynamics in a physiological environment | |
| Wouterlood et al. | Two-laser dual-immunofluorescence confocal laser scanning microscopy using Cy2-and Cy5-conjugated secondary antibodies: unequivocal detection of co-localization of neuronal markers | |
| Götz et al. | A multicolor single-molecule FRET approach to study protein dynamics and interactions simultaneously | |
| Siegel et al. | Strengths and weaknesses of recently engineered red fluorescent proteins evaluated in live cells using fluorescence correlation spectroscopy | |
| Brameshuber et al. | Detection and quantification of biomolecular association in living cells using single-molecule microscopy | |
| Li et al. | Autofluorescence detection in analytical chemistry and biochemistry | |
| Schoberer et al. | Investigating protein–protein interactions in the plant endomembrane system using multiphoton-induced FRET-FLIM | |
| Courty et al. | Tracking individual proteins in living cells using single quantum dot imaging | |
| Liu et al. | The F-techniques: advances in receptor protein studies | |
| CN104792751B (en) | By the protein protein interaction in FRET method in situ quantitation living cells | |
| Wen et al. | Advances in protein analysis in single live cells: Principle, instrumentation and applications | |
| Bathe-Peters et al. | Linescan microscopy data to extract diffusion coefficient of a fluorescent species using a commercial confocal microscope | |
| Ross et al. | Multiple color single molecule TIRF imaging and tracking of MAPs and motors | |
| US20060281104A1 (en) | Leuco dye particles and uses thereof | |
| CN204832040U (en) | Nanometer OCT imaging system based on broadband stimulated emission | |
| Wouters | F örster Resonance Energy Transfer and Fluorescence Lifetime Imaging | |
| Buranachai et al. | Fluorescence lifetime imaging in living cells | |
| RU2780954C1 (en) | Method for application of phycobiliproteins as optical sensors of local temperature in living cells and tissues |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |