CN104789584B - A kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins and its application - Google Patents

Abstract

The invention discloses a kind of people source enterotoxic Escherichia coli adhesin EtpA fusion proteins and its applications, and the present invention provides a kind of recombinant plasmid pGEX of the HpaA gene of the enterotoxic Escherichia coli of source containing someoneetpA, by the recombinant plasmid transformed to e. coli bl21 (DE3), induction recombinant expression bacterium BL21 (DE3)/pGEXetpAExpressed fusion protein EtpA.Utilize laying hen at the beginning of the recombinant protein active immunity of expression, it is prepared for the Yolk antibody for this albumen, the Yolk antibody of extraction demonstrates recombinant protein with good antigenicity, and utilize mouse intestinal challenge test and experiment in vitro, it was demonstrated that the Yolk antibody of purification can inhibit ETEC bacterial strains in mouse intestinal and in vitro to the adherency of epithelial cell.

Description

A kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins and its application

Technical field

The invention belongs to technical field of molecular biology, and in particular to a kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins and its application, by the HpaA gene etpA recombinant plasmids for building people source enterotoxigenic escherichia coli PGEX-etpA, is transferred to Bacillus coli expression fusion protein, Immune Laying Hens, and the Yolk antibody of purification can inhibit ETEC bacterium Strain is in mouse intestinal and in vitro to the adherency of epithelial cell.

Background technology

Enterotoxigenic escherichia coli（Enterotoxigenic Escherichia coli, ETEC）It is the master for causing diarrhea Want pathogenic bacteria（Black1990;Ericsson2003）.Annual ETEC can cause 2.8-4 hundred million times below 5 years old according to statistics in children Diarrhea, state of an illness weight differ, and can only have mild diarrhea, also can be in severe cholera sample, cause ten thousand infants of annual about 30-50 dead It dies（WHO2004）.It is also related to the malnutrition of many infants and hypoevolutism（Qadri et al2007;PGEX- KGri et al2008）.ETEC diarrhea also accounts for 1/3-1/2 in Africa, Asia and Hispanic traveler's diarrhea （WHO2004）.The pathogenesis of ETEC diarrhea be adhered to first by adhesin host mucous membrane of small intestine brush border epithelium it is thin On the receptor of born of the same parents, the cleaning of intestines peristalsis and content is resisted, realize after colonizing and discharges one or two kinds of enterotoxins （enterotoxin）, intracellular fluid and electrolyte balance is caused to be lacked of proper care, so as to generate watery diarrhea（Natro and Kaper1998;Sack1980）.Adhesin and enterotoxin are important antigen indispensable in traditional ETEC vaccine researches （Svennerholm and Tobias2008）.

It is considered that adhesin refers mainly to pili adhesin i.e. phage surface fimbrial antigen CFAs or CS.People source ETEC at present In identified more than 22 kinds CFAs, common are CFA/I, CS1-CS7, CS14, CS17, CS21（Qadri et al2005）, but Without cross-protection between heterologous pili（Qadri et al2006）.In addition research finds that adhesion process is also required to non-pili and glues The participation of attached element.Escherichia coli include ETEC can bear flagellum on the whole body or both ends, and quantity is few compared with pili, but length is thalline Several times.Recent study shows other than the pili for spreading all over phage surface, raw flagellum to be held to act not only as locomotory apparatus Official, and this motility（motility）It is risen in pathogenic courses such as the field planting of some Gram-negative bacterias, invasion and proinflammatory reactions Effect, such as salmonella（Allen-Vercoe et al1999）, chicken pathogenic escherichia coli（La Ragione et al2000）.

Roy etc.（2006）A kind of albumen EtpA of ETEC secretions is found that with swivel base plasmid, is double companion's secretins（TPS） One of member, it is peculiar for ETEC.Be distributed in 59% CFAI, 56% CFA II, 75% CS14 or CS17 ETEC bacterial strains In, and these types of fimbriae type occupies about 60% ETEC（Wolf1997）.It is to pass through in bacterial adhesion that research, which illustrates EtpA, In extracellular and flagellin（FliC）Conserved region interaction, mediate what the function served as bridge of flagellum and host cell played（Roy et al2009a）.Test cell line confirms that this interaction has key effect for effective field planting of ETEC by lacking and recombinating, i.e., EtpA or fliC deletion mycopremna adherent cell abilities compared to wild type substantially reduce or add in the medium the antibody of the two It can reduce the bacterial population of adherency, and that gene-deleted strain can be made to regain adherency is thin for external source addition recombinant protein or the homologous recombination gene The function of born of the same parents（Roy et al2009a）.

The conserved region of usual flagellin is hidden in flagellum neck, but it can be exposed to flagellum top with moment, captures EtpA molecules are used to identify eukaryocyte surface receptor.Flagellum mediate adhesion does not have serotype limitation, such as in flic（H11）Mutation Flic is recombinated in strain（H48）Movement and adhesive capacity can be regained.In addition a variety of H be can inhibit with identical anti-EtpA serum Adherency of the ETEC of serotype to epithelial cell.In mouse model, mouse is immunized with rEtpA and rFliC nasal feedings, obtain with In vitro test it is similar as a result, and the two it is used at the same time suppression adhesiving effect better than be used alone（Roy et al2008, 2009b）.This novel adherence mechanism is present in most ETEC, and other protein moleculars homologous with EtpA are respective This similar mode of action may also be used in Gram-negative bacteria, although specific mediated process is unclear, is speculated Two kinds of albumen can be as the candidate antigens of New-type wide-spectrum vaccine development.

A large amount of result of the test shows by providing exogenous antibodies to young animal（Including blood antibody and Yolk antibody） Its passive immunity level is improved, to prevent and treat the infection of bacterium and virus（Particularly enteron aisle diarrhea）It is effective way Diameter（Hatta et al1993b;King's Jie 2007）.Yolk immunoglobulin（Egg yolk immunoglobulin,IgY）Become A kind of Substitutes For Antibiotic for having much potentiality.U.S. FDA is included in " generally accepted safe material "（Coleman1996）.Mesh The preceding IgY exploitations for various enterogastric diseases have been extensively studied.Researcher prepares IgY treatments ETEC using pili as antigen Diarrhea（Yokoyama et al1992;Ikemori et al1992;Marquardt et al1999）.Earliest report source It can prevent K88, K99 and 987P ETEC from infecting in Perorally administrable antimicrobial hair Yolk antibody（Yokoyama et al1992）.Piglet is born 4h infects ETEC, treatment group afterwards（Oral IgY）Substantially all survival, and dose-dependent effect is shown, placebo and control The group death rate is more than 75%, adds in IgY in vitro and similarly inhibits ETEC to chitling cell adherence.Marquardt etc.（1999） Also Yolk antibody is prepared with purification K88 pilin Immune Laying Hens, 3 ages in days of birth and 21 age in days weanling pigs is carried out attacking poison and are controlled It treats, wherein the diarrhea of age group piglet on the 3rd is cured entirely after oral IgY24h, and the diarrhea of common IgY groups continues and the death rate Up to 62.5%；Weanling pig takes orally IgY after poison is attacked and of short duration diarrhea occurs, all survival and weight gains, and control group also goes out Existing severe diarrhea and dehydration, and there is death after infecting 48h.King's Jie（2007）Take orally anti-ETEC pili subunit yolk Antibody can provide effective passive immune protection to piglet, resist the infection of enteron aisle germ.

More than research background is based on, this research is using EtpA as candidate antigens, using gene engineering method clonal expression thin Key gene EtpA during bacterium adherency epithelial cell is with obtaining a large amount of destination proteins.With reference to IgY technologies, i.e., by immune Laying hen produces the special yolk antibody for EtpA, it is intended to which developing a kind of low-cost has broad spectrum activity anti diar rhea work( The health care egg food of energy.

Invention content

The object of the present invention is to provide a kind of recombinant plasmid pGEX- of the ETEC HpaA genes of source containing someone etpA EtpA, sequence is shown in SEQ ID NO.1.

It is another object of the present invention to provide a kind of genetic engineering bacterium BL21 containing recombinant plasmid pGEX-etpA (DE3)/pGEX-etpA.Recombinant plasmid pGEX-etpA is transformed into Escherichia coli（Escherichia coli）BL21（DE3）, The genetic engineering bacterium of acquisition can express adhesin EtpA fusion proteins.

Another object of the present invention is the provision of a kind of people source enterotoxigenic escherichia coli adhesin EtpA fusions Albumen, sequence is shown in SEQ ID NO.2.The fusion protein immunization originality is good, and production cost is low.By the protein immunization laying hen Afterwards, the egg with anti-ETEC can be obtained.

It is also an object of the present invention to provide a kind of Yolk antibodies prepared using EtpA fusion proteins.The yolk Antibody has the function of to inhibit ETEC adherency.

The present invention the last one be designed to provide a kind of Yolk antibody and preparing anti-human source enterotoxigenic escherichia coli Application in immune vaccine.

In order to achieve the above object, the present invention uses following technical measures：

A kind of preparation method of the recombinant plasmid pGEX-etpA of the ETEC HpaA genes of source containing someone etpA（Fig. 1,2）, It is as follows：

The locus of Serial No. AY920525 is searched in the GenBank of NCBI, wherein etpA is located at code area 2718- 8021, overall length 5304bp, target fragment are the 1701bp at 5' ends.Using people source enterotoxigenic escherichia coli type strain H10407 as examination Material is tested, primer is designed, the target fragment after PCR amplification is connected to expression vector, is successfully constructed in bacterial adhesion epithelium The recombinant expression plasmid of key gene etpA genes in cell processes.Digestion identification and sequencing are carried out to recombinant plasmid, as a result Display structure is correct, is named as pGEX-etpA, sequence is shown in SEQ ID NO.1.

A kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins, preparation process are as follows：

Recombinant plasmid pGEX-etpA is transformed into e. coli bl21（DE3）, with inducer isopropyl-β-d- thio half Lactoside（Isopropyl- β-d-Thiogalactoside, IPTG）Do induced expression.With different inducing temperature and derivant Concentration successive optimization prokaryotic expression, obtaining best induced expression condition is：37 DEG C of shaking table cultures reach 0.5- to OD600 1.0, IPTG is added in suitable concentration（0.1mM）, continue to cultivate 3-4h, final expression quantity is more than 20%, with the shape of inclusion body Formula exists.The inclusion body protein EtpA fusion proteins that inclusion body is obtained after the concentration of pressure breaking, denaturation and renaturation, sequence For shown in SEQ ID NO.2, protein concentration is measured with Bradford methods.

A kind of refolding method of people source enterotoxic Escherichia coli adhesin EtpA fusion proteins, its step are as follows：

In inoculating strain to 300mL culture mediums, induced expression collects thalline from culture solution, then is resuspended in precooling In the BufferA of 30ml, pressure breaking instrument crushes 3-5 times, and centrifugation reservation precipitation, 30ml BufferA are resuspended precipitation, slowly add Enter 10%SKL, keep stirring to precipitation and dissolve, solution clarification, 4 DEG C of standing 2h.Continuously add final concentration 0.2% PEG4000, 600 μ L50m M oxidizeds form of glutathione and 100mM reduced glutathiones, 4 DEG C of standing 2h, 10000rpm centrifugation 15min are discarded Undissolved thalline impurity to get.

BufferA：Tris6.055g, EDTA0.186g, NaCl2.925g, glycerine 50mL add in ddH₂O is settled to 1L, DTT to final concentration 0.5mmol/L is now added in using preceding.

A kind of Yolk antibody prepared using EtpA fusion proteins, preparation process are as follows：

The tween-80 of sterilizing is added in into the EtpA fusion protein solution after renaturation, concentration to final concentration 4%, then with etc. Volume white-oil adjuvant mixes 30min in tissue refiner, it is fully emulsified to protein concentration be 0.5mg/mL.Laying hen is divided at random 2 groups, blank group 50（Physiological saline）With immune group 100.It is injected using chest muscle（Per 500 μ L of side）.Head is each after exempting from 2 weeks Group is primary with same oil breast seedling booster immunization respectively, and interval is immunized for 2 weeks again, two exempt from after 5 pieces of eggs of each group random acquisition weekly, Purifying, collecting Yolk antibody, indirect ELISA monitoring antibody titer variation, western-blot identify the specificity of Yolk antibody, Treat Yolk antibody potency up to 1:2⁹After collect egg.It by the egg decladding of collection, stirs, spray drying（150 DEG C of air inlet, outlet 70℃）, it is packed into the sample sack of sealing after cooling.

A kind of application of Yolk antibody in anti-human source enterotoxigenic escherichia coli immune vaccine is prepared, application process is such as Under：

Field planting models of the ETEC in mouse intestinal is established, with clinical common ETEC bacterial strains（H10407）Malicious mouse is attacked, After Yolk antibody prepared by early period is taken orally simultaneously, different antibody groups produces bacterium suppression adhesiving effect in various degree.Its The antibody group of Plays bacterial strain H10407 reduces the quantity of infecting mouse.Pass through cell adhesion experiment, it was confirmed that Yolk antibody Similar anti-adhesion effect has equally been played in vitro.

Compared with prior art, the present invention has the following advantages：

The destination protein expressed in this experiment mainly exists in inclusion body, in order to which the later stage is made to prepare antibody titer higher, Antibody effects are more preferable, we by using SKL, oxidized form of glutathione and reduced glutathione to the destination protein of expression into Row renaturation.The Yolk antibody of more efficient valency is obtained in later stage immunologic process.

Description of the drawings

Fig. 1 is a kind of construction of recombinant plasmid route schematic diagram of etpA genes.

PMD18-T is cloning vector in figure, and pGEX-KG is expression vector.PGEX-etpA is the weight for inserting etpA genes Group plasmid, BamHI, XhoI are the restriction endonuclease sites on plasmid.

Fig. 2 is the agarose gel electrophoresis schematic diagram of PCR amplification etpA products.

Product etpA molecular size ranges are 1700bp in figure；M is DNA molecular amount standard DL2000.

The double digestion that Fig. 3 is recombinant expression plasmid pGEX-etpA identifies electrophoresis schematic diagram.

M is DNA molecular amount standard DL2000 in figure；Swimming lane EtpA：PGEX-etpA, Insert Fragment 2260bp.

Fig. 4 is the front and rear SDS-PAGE electrophoresis detection schematic diagrames of genetic engineering bacterium IPTG inducible proteins expression.

In figure 1,2 represent respectively recombinant protein EtpA induction before and after, gained molecular weight of albumen be 84kDa.

Fig. 5 is the soluble analysis schematic diagram of genetic engineering bacterium recombinant protein after induction.

1,2 in figure：Supernatant precipitation after pGEX-etpA BL21 (DE3) inductions；M is protein molecular weight standard.

Fig. 6 is influence schematic diagram of the condition of different temperatures to EtpA fusion protein expressions.

1、2：Supernatant precipitation after 37 DEG C of inductions；3、4：Supernatant precipitation after 25 DEG C of inductions；5、6：After 17 DEG C of inductions Supernatant precipitation；Arrow：Destination protein.

Fig. 7 is influence schematic diagram of the inducer concentrations to EtpA fusion protein expressions.

1：Before induction；2、3、4、5、6：IPTG concentration is respectively 0.1,0.3,0.5,1.0,1.2mmol/L；Arrow：Purpose Albumen.

Fig. 8 is the protein s DS-PAGE electrophoretic analysis schematic diagrames concentrated after renaturation.

Fig. 9 is the antigenic schematic diagram that Western-Blot detects recombinant protein EtpA.

Figure 10 for second it is immune after Yolk antibody potency change with time rule schematic diagram.

Figure 11 is anti-adhesion effect schematic diagram of the Yolk antibody to people source ETEC H10407 mouse intestinals.

Horizontal line represents geometric mean, and * represents significant difference, and * * represent that difference is extremely notable.

Figure 12 is anti-adhesion effect schematic diagram of the Yolk antibody to people source ETEC H10407 epithelial cells.

Horizontal line represents geometric mean, and * represents significant difference, and * * represent that difference is extremely notable.

Specific embodiment

The method without special instruction is with reference to U.S.'s J. Pehanorm Brookers and D.W. Russells in specific examples below（J. Pehanorm Brooker and D.W. Russells write, and Huang Peitang etc. is translated.Molecular Cloning:A Laboratory guide（The third edition）, Beijing：Science Press, 2002）.Agents useful for same of the present invention, cell or bacterial strain unless otherwise noted, derive from commercial channel.

Embodiment 1：The structure of enterotoxic Escherichia coli EtpA recombinant plasmids

1st, the bacterial strain and plasmid vector that the present embodiment uses see the table below 1.

1 bacterial strain of table and plasmid

2nd, main agents and kit

PCR related reagents：Taq archaeal dna polymerases, dNTP（2.5mM）、10×Taq buffer、DNA marker（2kb and 10kb）：Beijing Quanshijin Biotechnology Co., Ltd；

Restriction enzyme：Dalian treasured bioengineering Co., Ltd；

Agarose：Biowest Agarose are dispensed；

Tryptone, yeast extract：Britain OXOID；

Pancreatin digests soybean broth：Bi Di Medical Devices Co., Ltd.s of the U.S.；

DNA gel QIAquick Gel Extraction Kit：Shanghai Sheng Gong Bioisystech Co., Ltd；

Plasmid extraction kit：Shanghai Sheng Gong Bioisystech Co., Ltd.

3rd, solution is prepared

3.1 DNA of bacteria extract related solution

PBS（0.012M）：Weigh NaCl8g, KCl0.2g, Na₂HPO₄·12H₂O3.58g, KH₂PO₄0.27g adds ddH₂O 1L is settled to, dispenses 121 DEG C of sterilizing 30min.

Chloroform/isoamyl alcohol（24：1）：Chloroform 480ml, isoamyl alcohol 20ml, mixing move into 4 DEG C of preservations in Brown Glass Brown glass bottles and jars only.

Proteinase K（20mg/mL）：It weighs powder 20mg and is dissolved in ddH₂O1mL, -20 DEG C of preservations of mixing.

3.2 culture medium

1）LB culture mediums:Tryptone 1g, yeast extract 0.5g, NaCl1g, agar powder 1.5g（LB tablets）, add ddH₂O is dissolved to 100mL, stirs evenly, masking foil sealing high pressure steam sterilization 30min.

2）TSB：0.3g TSB are weighed, add ddH₂O is dissolved to 100mL, with 1）Sterilizing.

3）Ampicillin liquid storage（100mg/mL）：1g powder is added in into 10mL ddH in aseptic operating platform₂O dissolves, nothing Bacterium filter filters, and dispenses to 1.5mL EP and manages, -20 DEG C of preservations.

4）Kanamycins liquid storage（50mg/mL）：1g powder is added in into 20mL ddH in aseptic operating platform₂O dissolves, remaining is same （3）.

3.3DNA gel electrophoresis related solutions

1）50×TAE：Tris242g, EDTA37.2g, glacial acetic acid 57.1mL, add ddH₂O is dissolved to 900mL, adjust pH to 8.0, it is settled to 1L.1 × TAE is diluted to during use.

2）6 × DNA sample-loading buffers：EDTA7.4g, sucrose 40g, diformazan cyanophenyl 0.25g, bromophenol blue 0.25g add ddH₂O 100mL is dissolved to, is stirred evenly, four degree of preservations.

3）EB dye liquors（10mg/mL）：1g powder is weighed, is carefully added into 100mLddH₂O, stirring is to being completely dissolved, tinfoil packet Wrap up in body room temperature preservation.Per 200mL ddH during use₂O adds in 10 μ L EB.EB is paid attention to for strong mutagens, and when operation pays attention to whole body Protection.

4th, the structure of EtpA recombinant plasmids

Construction recombination plasmid process is shown in Fig. 1.

The extraction of 4.1 DNA of bacteria

1）In aseptic operating platform, picking ETEC H10407 bacterium solutions apply TSB tablets, next day picking from slant medium Single bacterium is fallen in 5mL TSB culture mediums, and 37 DEG C are incubated overnight.

2）Thalline were collected by centrifugation by next day 10000rpm, and PBS is washed 2 times and thalline is resuspended to 500 μ L.

3）100 μ L10%SDS are added in, 10 μ L20mg/mL Proteinase Ks, 50 DEG C are incubated 3h or 37 DEG C overnight.

4）Isometric phenol is added in supernatant：Chloroform：Isoamyl alcohol（25：24：1）, overturn mixing 5min, 10000rpm centrifugation 5min shifts supernatant.It is repeated once.

5）Isometric chloroform/isoamyl alcohol is added in, mixing 5min, 10000rpm centrifugation 5min is overturned, shifts supernatant.

6）Add in 0.6（V/V）Isopropanol overturns mixing, stands 5min, 10000rpm centrifugation 5min, the precipitation warp of collection 75% ethanol wash of precooling, is dissolved in 100 μ L ddH after drying₂In O, -20 DEG C of preservations.

4.2 design of primers

The locus of Serial No. AY920525 is searched in the GenBank of NCBI, wherein EtpA is located at code area 2718- 8021, overall length 5304bp, target fragment are the 1701bp at 5' ends.Specific primer sequence see the table below 2.

Table 2PCR amplimers

Note：Underscore represents restriction enzyme site.

4.3PCR amplifying target genes

Add in ddH₂Primer is first diluted to 10 μM by O, and genomic DNA is diluted to 0.05mg/mL.Using 25 μ L reaction systems as Example（Unit：μL）：

Reaction condition is as follows（Recurring number：35）：

Program	Pre-degeneration	Denaturation	Annealing	Extension	Finally extend
						Temperature（℃）	95	94	See that primer synthesis is single	72	72
Time（min）	3	3	0.5	1kb/min	8

4.4PCR product detections and recycling

1）Detection：Ago-Gel is prepared according to clip size, takes the PCR product of 5 μ L and sample solution mixing point sample, and DNAmarker is clicked and entered in side.After electrophoresis, gel is put into EB dye liquors, is taken pictures guarantor in gel imaging system after 10min It deposits.

2）Recycling：Change comb when detecting into wide comb, other electrophoresis steps are consistent.Band in gel is in ultraviolet lamp Lower to be cut off rapidly with blade, remaining step illustrates to operate according to QIAquick Gel Extraction Kit.

The clone of 4.5DNA segments

1）Prepare competence DH5 α：

A. bacterium solution is dipped from the glycerol tube preserved and draws LB tablets, picking single bacterium colony expands culture 16-18h.

B. next day expands culture with 1% inoculum concentration in triangular flask（37 DEG C, 3-4h）, the specific time is in mist with bacterium solution Until shape.

C. in aseptic operating platform in transfer bacterium solution to the centrifuge tube being pre-chilled, 30min is placed in continuation on ice.Then 4 DEG C of centrifugations Collect thalline（4000rpm, 10min）.

D. most supernatant is abandoned, adds in the 0.1mol/L CaCl of 10mL precoolings₂Thalline is resuspended, places 25-30min on ice.

E. above two steps are repeated 2 times.

F.2mL the 0.1mol/L CaCl being pre-chilled₂Thalline is resuspended, sterile glycerol is added in final concentration 15-20%, with 100 μ L/ Pipe dispenses, and -80 DEG C save backup.

2）Connection：5 μ L linked systems are as follows, and 4 DEG C overnight.

PCR product	2
		PMD18-T	0.5
Solution I	2.5

3）Conversion

A. 10 μ L connection products is taken to add in the DH5 α competence just thawed, mixing is gently beaten, places on ice 30min.Recirculated water bath is opened at this time is preheated to 42 DEG C.

B.42 DEG C water-bath thermal shock 90s, it is quick to place 1-2min on ice.

C. LB culture mediums 400 μ L, 37 DEG C of shake culture 1h are added in.

D. it centrifuges（8000rpm, 2min）Bacterium solution is concentrated to 100 μ L, and is applied on the LB tablets of Amp resistances, it is permanent Warm incubator is incubated overnight.

E. next day picking single bacterium colony, bacterium solution PCR detects the presence of positive clone molecule, and the T clones of acquisition are respectively designated as pMD-etpA。

4.6 structure expression plasmids

1）Picking positive bacteria, which is fallen, is enlarged culture, illustrates progress plasmid extraction according to small amount plasmid extraction kit, And double digestion and connection are done to the carrier T containing target fragment and empty expression vector by following 20 μ L systems, wherein in linked system The ratio of DNA and carrier is with mole ratio 1:1-5:Between 1：

2）PMD-etpA, pGEX-KG are passed through to the double digestion of BamHI and XhoI, segment is recycled after agarose gel electrophoresis EtpA and vector pGEX-KG, connection, conversion, detection obtain pGEX-etpA, and target fragment 5 ' is connected with GST label proteins at this time Gene, sequencing result display sequence is identical with expection, and pGEX-etpA is built successfully.

3）Bacterium colony PCR selects more than positive clone molecule, expands culture through correct bacterial strain is sequenced, extracts recombinant plasmid in a small amount Do digestion identification, -20 DEG C of preservations.It is easy for writing, recombinant expression plasmid is abbreviated as：pGEX-etpA.Its etpA base contained Because sequence is shown in SEQ ID NO.3, does double digestion to recombinant plasmid with BamHI and XhoI, as a result sees Fig. 3.

After agarose gel electrophoresis, mesh is observed in about 1700bp after double digestion by the pGEX-etpA that the present invention obtains Segment, the positive clone molecule sequencing result of gained show with the NCBI sequence alignments announced and expected base sequence and size Consistent, recombinant plasmid sequence is shown in SEQ ID NO.1.

Embodiment 2：

The induced expression and extraction purification of recombinant protein

1st, reagent

Tryptone, yeast extract：Britain OXOID；

Pancreatin digests soybean broth：Bi Di Medical Devices Co., Ltd.s of the U.S.；

Tris alkali, glycine, SDS：Amresco is dispensed；

IPTG, Amp, Kan, oxidized form of glutathione, reduced glutathione, PEG4000：BIOSHARP is dispensed；

2nd, solution is prepared

LB culture mediums are as shown in Example 1.

IPTG liquid storages（1mol/L）：The powder of 1g is added in into 4.2mL sterilizings ddH in aseptic operating platform₂O, sterile filters mistake After filter in packing to 1.5mLEP pipes.

SDS-PAGE electrophoresis related solutions：

1）2 × albumen sample solution：Tris-HCl（1M,pH=6.8）10mL, SDS4g, bromophenol blue 200mg, glycerine 20mL add ddH₂O is settled to 100mL, and when use adds in 2-3% beta -mercaptoethanols（It is now with the current）.

2）5 × electrophoretic buffer：Tris15.10g, Gly72.06g, SDS5g add ddH₂O is settled to 1L.It is diluted during use 5 times.

3）30% polyacrylamide：N is weighed successively, and N'- methylene diacrylamide 1g, acrylamide 29g add ddH₂O constant volumes To 100mL, it is transferred to four degree of preservations in brown bottle.Weighing process pays attention to protecting.

4）Separation gel buffer solution：Tris18.17g adds ddH₂O90mL, dense HCl adjust pH to 8.8, are settled to 100mL, and four Degree preserves.

5）Concentrate glue buffer solution：Tris12.11g adds ddH₂O90mL, dense HCl adjust pH to 6.8, are settled to 100mL, and four Degree preserves.

6）10%SDS：Lauryl sodium sulfate 10g is weighed, adds ddH₂O is settled to 100mL, and room temperature preserves.

7）10% ammonium persulfate：It weighs in ammonium persulfate 0.1g to EP pipes, adds in 1mLddH₂O, four degree of preservations, makes in two weeks With.

8）1%TEMED：N, N, N' are drawn, N'- tetramethylethylenediamine 1mL add ddH₂O to 100mL is transferred to four in brown bottle Degree preserves.Pay attention to environment ventilation.

9）Coomassie brilliant blue staining liquid：Coomassie brilliant blue R_250 1.25g, methanol 450mL, glacial acetic acid 50mL add ddH₂O450mL。

10）Destainer：Methanol 50mL, glacial acetic acid 75mL add in ddH₂O875mL mixings.

Inclusion body purification related reagent：

1）BufferA：Tris6.055g, EDTA0.186g, NaCl2.925g, glycerine 50mL add in ddH₂O is settled to 1L.DTT to final concentration 0.5mmol/L is now added in using preceding.

2）10%SKL：Dodecyl creatine sodium 1g is weighed, adds in ddH₂O10mL, stirring are complete to dissolving.

3）50mM oxidizeds form of glutathione：The powder of 1g packagings adds in ddH₂O32.65mL, pressure-vaccum to dissolving.

4）100mM reduced glutathiones：The powder of 1g packagings adds in ddH₂O32.54mL, ibid.

5）20%PEG4000：Macrogol 4000 20g is weighed, adds in ddH₂O is settled to 100mL.

6）Bag filter treatment fluid A（2% sodium bicarbonate, 1mMEDTA, pH8.0）：Sodium bicarbonate 20g, EDTA0.372g are weighed, Add ddH₂O to 900mL adjusts pH to 8.0, is settled to 1L.

7）Bag filter treatment fluid B（1mM EDTA, pH8.0）：Sodium bicarbonate is removed in A liquid.

3rd, the induced expression of recombinant protein and SDS-PAGE detections

Successful expression plasmid conversion expression bacterial strain BL21 will be built（DE3）, picking single bacterium colony is incubated overnight.Next day bacterium solution It is added in fresh cultures of the 5mL containing resistance by 1% inoculum concentration, 37 DEG C of shaking table culture 3-4h.When OD600 reaches 0.5-1.0 When, IPTG to final concentration 1mmol/L is added in, continues to cultivate 3-4h.Taking 500 μ L bacterium solutions, thalline were collected by centrifugation, and 50 μ LPBS are resuspended, Isometric to add in sample solution, boiling water bath 5min takes 10 μ L supernatants to carry out SDS-PAGE electrophoresis detections.Derivant training is not added in control Support same time.

4th, the soluble analysis of recombinant protein

As above recombinant strains are seeded in the LB of 50mL and expand culture, collect the thalline of induced expression, Thalline is fully resuspended in 5mLbufferA, is placed on ice.It treats that pressure breaking instrument temperature is down to 4 DEG C, starts broken thalline, repeat 3 times. Supernatant is centrifuged, 5mL bufferA are fully resuspended precipitation, 50 μ L is respectively taken to carry out SDS-PAGE electrophoretic analysis.

5th, the optimum induction of recombinant protein

During protein expression, the concentration and inducing temperature of derivant are an important factor for influencing expression quantity.Therefore it is logical Cross design different temperatures（37、25、17℃）With IPTG concentration gradients（0.1、0.3、0.5、1.0、1.2mM）, it is studied to albumen The influence of expression.As above inoculated and cultured 5mL bacterium solutions add in derivant when OD values reach 0.5-1.0 at different conditions, remove 25 DEG C and 17 DEG C of need continue to be incubated overnight, remaining collects thalline after cultivating 3-4h, and such as 3 carry out SDS-PAGE electrophoresis detections.

6th, the extraction purification of recombinant protein

In inoculation recombinant expression bacterium to 300mL culture mediums, with the condition induced expression after optimization.Bacterium is collected from culture solution Body, then be resuspended in the BufferA of 1/10 volume of precooling, pressure breaking instrument crushes 3-5 times, notices that whole process keeps low Temperature.Centrifugation retains precipitation, and precipitation is fully resuspended with the BufferA of equal above-mentioned volume, is slowly added to 10%SKL, keep stirring to Precipitation dissolving, solution clarification, 4 DEG C of standing 2h.Continuously add the PEG4000 of final concentration 0.2%, 600 μ L oxidizeds form of glutathione with Reduced glutathione, 4 DEG C of standing 2h, 10000rpm centrifugation 15min discard undissolved thalline impurity.Bag filter processing side Method：Bag filter is cut out by the length of 20-30cm.The boiling water bath 10min in A liquid, distilled water cleaning.The boiling water bath in B liquid 10min, distilled water cleaning, 4 DEG C of preservations.Band gloves are paid attention to when taking.The bag filter handled well of protein liquid loading of renaturation, totally 2 My god, during which change liquid for several times, PEG embedding bag filters are concentrated into required concentration.SDS-PAGE electrophoresis detection purity of protein, Bradford Method measures protein concentration.

7th, result of the test

IPTG induction recombination bacillus coli BL21 (DE3)/pGEX-etpA expression, are as a result shown in Fig. 4.Corresponding positions are equipped with expection The albumen of size occurs, and EtpA molecular weight respectively may be about 89KD, expression quantity about 20%.Soluble analysis is shown（See Fig. 5）Albumen is equal It is most of to be present in precipitation in the form of inclusion body, it is few in supernatant.Fig. 5, which is shown, determines that recombinant protein inductive condition is 37 DEG C Shaking table culture reaches 0.5-1.0 to OD600, adds in IPTG to suitable concentration 0.1mM, continues to cultivate 3-4h, collects thalline.Purifying Afterwards, protein concentration is 0.19g/L.

The amino acid sequence of EtpA fusion proteins that the present invention is built is shown in SEQ ID NO.2.

Embodiment 3：

Yolk antibody is prepared with recombinant protein Immune Laying Hens

1st, reagent

White oil, stearic acid aluminium, Si Ben -80, Tween-80：Wuhan Ke Qian biological products Co., Ltd presents.

HRP rabbit anti-chicken IgGs：sigma

Developing solution Supersignal west pico test kits：Thermo

2nd, solution is prepared

ELISA related reagents：

PBS（0.012M）：Weigh NaCl8g, KCl0.2g, Na₂HPO₄·12H₂O3.58g, KH₂PO₄0.27g adds ddH₂O 1L is settled to, dispenses 121 DEG C of sterilizing 30min.

Coating buffer（0.05M carbonate buffer solutions）：NaHCO₃2.93g Na₂CO₃1.59g adds in ddH₂O900mL has dissolved PH to 9.6 is adjusted after complete, is settled to 1L, room temperature.

Cleaning solution：Final concentration of 0.05% Tween-20 is added in PBS.

Confining liquid：3% bovine serum albumin(BSA)（BSA）It is dissolved in cleaning solution.

OPD developing solutions：O-phenylenediamine 80mg, 0.1mol/L citric acid 4.86mL, 0.2mol/L Na₂HPO₄5.14mL ddH₂O10mL is eventually adding 30%H₂O₂30μL.It is now with the current.

Terminate liquid（2M H₂SO₄）：Concentrated sulfuric acid 22.2mL, distilled water 182mL, acid are slowly added into along wall of cup in water, not Stop stirring evenly.

Western-blot related reagents：

Film transfer buffer solution：Tris5.8g, glycine 2.9g, SDS0.37g, methanol 200mL, ddH₂O is settled to 1L.

TBS：Tris2.42g, NaCl8.78g, ddH₂O900mL, salt acid for adjusting pH to 8.0, constant volume 1L.

TBST：Final concentration of 0.05% Tween-20 is added in TBS.

Confining liquid：TBST containing 1%BSA.

Developing solution：By A liquid, B liquid with 1:1 ratio mixing, it is now with the current.

3rd, the preparation of the newborn seedling of recombinant protein oil

White oil 94mL, aluminum stearate 2g, stirs evenly, and is heated to 80 degree or so, and continues stirring until solution clarification.Slowly The Span-80 of 6mL is added in, continues to stir 20min, is white-oil adjuvant after cooling, 4 DEG C preserve.Albumen after renaturation, concentration The tween-80 that sterilizing is added in solution mixes 30min to final concentration 4%, then with isometric white-oil adjuvant in tissue refiner, It is fully emulsified to protein concentration be 0.5mg/mL.

4th, laying hen is immune

20 week old cage Roman egghens 150 are selected, laying hen are divided to 2 groups at random, blank group 50（Physiological saline）With exempt from Epidemic disease group 100.It is injected using chest muscle（Per 500 μ L of side）.Each group uses same oil breast seedling booster immunization one respectively after head exempts from 2 weeks Secondary, interval is immunized for 2 weeks again, two exempt from after weekly each group random acquisition egg ELISA monitorings see antibody titer variation, treat that yolk resists Body potency is up to 1:2⁹After collect egg, Cord blood.

5th, it is spray-dried dried whole-egg

It by the egg decladding of collection, stirs, spray drying（150 DEG C of air inlet, 70 DEG C of outlet）, the sample of sealing is packed into after cooling In product bag.Dried whole-egg in different time periods in acquisition spray drying, the same Fresh Egg of antibody method of purification, indirect ELISA detection Antibody titer.

6th, the purifying of Yolk antibody

Water dilution method is as follows：

Yolk is detached, i.e., breaks an aperture in eggshell one end, egg white is flow to end, expands broken shell range, yolk is positioned over It is rolled around on filter paper, until egg white blots.Membrane of yolk is punctured, collects egg yolk liquid in centrifuge tube.8 times of volumes of egg yolk liquid Distilled water dilutes, and stirs evenly, salt acid for adjusting pH to 5.0-5.2, and 4 DEG C are placed 6h or stayed overnight.10000rpm centrifuges 20min, receives Collection supernatant obtains water-soluble component WSF（water-solve fract）.Supernatant adds in ammonium sulfate to 50% saturation degree, and stirring is equal Even, 4 DEG C are placed 2h or stayed overnight, and are fully precipitated, and 10000rpm centrifugation 10min abandon supernatant, and precipitation is dissolved in PBS to former egg yolk fluid Product.Ammonium sulfate is added in 33% saturation degree, repeats above step.For 24 hours, -20 DEG C save backup for 4 DEG C of dialysis.

7th, indirect ELISA measures Yolk antibody potency

Two exempt to start in latter week to acquire egg, collect 5 pieces of eggs from 100 laying hens at random weekly, after extracting antibody, with Recombinant protein envelope antigen, indirect ELISA measure two antibody titers for exempting from latter 1-7 weeks.Section sample before, during and after spray-drying process Product in kind detect potency after extracting antibody.

Square formation titration determines best antigen coat concentration.Antigen is done into doubling dilution with coating buffer respectively（1:400,1: 800,1:1600,1:3200,1:6400）, the coating polystyrene reactant plate per 100 μ L of hole, each two parallel holes of dilution, 4 DEG C overnight.By sample, doubling dilution, enzyme mark rabbit anti-chicken IgG make 1 with PBST on demand during determination sample：10000 dilutions, carry out ELISA is detected, and specific sample determination step is as follows：

1）Antigen is pressed, polystyrene reactant plate is coated with per 100 μ L of hole, 4 DEG C overnight；

2）Liquid is discarded, PBST is washed 3 times and patted dry, and adding confining liquid, 37 DEG C are incubated 2 hours per 100 μ L of hole；

3）As above it washs, adds in test antibodies per 100 μ L of hole（It is diluted with PBST）, 37 DEG C are incubated 1 hour；

4）As above it washs, adds in ELIAS secondary antibody（PBST dilutes）Per 100 μ L of hole, 37 DEG C are incubated 1 hour；

5）As above it washs, adds in the 100 μ L of OPD developing solutions now matched, 37 DEG C are protected from light incubation 15min；

6）Add 50 μ L of terminate liquid per hole, the OD values in each hole are measured under 450nm wavelength, are returned to zero with blank well.Test antibodies The ratio of OD values and negative control is judged to the positive when being more than 2.1, antibody titer is highest dilution when there is positive reaction.

8th, western-blot detects recombinant protein immunogenicity

1）SDS-PAGE electrophoresis：Protein sample is pressed into 2 method electrophoresis of example.

2）Transferring film：It is shifted using wet method, electricity turns liquid and is pre-chilled on ice

3）It removes glass plate, takes out gel, according to marker and molecular size range by the glue of 1cm width near purpose band It scales off and is immersed in electricity and turns in liquid.

4）The filter paper and pvdf membrane of same size are cut out according to the size of glue.Filter paper is immersed in electricity and turns in liquid, and film first exists About 30s is infiltrated in methanol, ddH2O rinsing 1-2min is transferred to, is immersed in electricity later and turns in liquid.

5）Plastic plate black flour, sponge, 2 layers of filter paper, gel, pvdf membrane, 2 layers of filter paper, sponge alignment are put well successively, paid attention to Drive the bubble between film and glue away, plastic plate fine flour is clamped with black flour, is put into electric turn trough.

6）Open power supply, 100V constant pressure electrophoresis 1-1.5h（According to molecular weight of albumen）.

7）Closing：It takes out pvdf membrane slightly to be rinsed with TBST, is immersed in the plate containing confining liquid and slowly sways 2h.

8）Primary antibody is incubated：By primary antibody confining liquid with 1:1000 dilutions, pvdf membrane submerge wherein, and 4 DEG C overnight.

9）Secondary antibody is incubated：TBST rinses film three times, each 5-10min.Secondary antibody confining liquid is with 1:10000 dilutions, PVDF Film room temperature shaker is incubated 1h.

10）ECL develops the color：TBST rinsings film 3 times, TBS rinsings film 2 times, each 5-10min.Open imaging system, precooling 30min.It on the developing solution uniform fold to pvdf membrane mixed, will take pictures in time and preserve picture.

9th, result of the test

3 best antigen coat concentration of table

After laying hen is immunized, proves that recombinant protein has good immunogenicity by the detection of antibody titer, can cause The immune response of laying hen, and corresponding specific antibody can be generated.The most preferably coating a concentration of 1 of antigen:3200, i.e., 0.15 Micro- g hole.Reach 12800 in the antibody titer that two exempt from latter week EtpA, two, which exempt from rear second week, potency raising occurs, until the 7th All antibody titers maintain 64000, do not occur potency downward trend.

For the Yolk antibody molecular weight of SDS-PAGE electrophoresis showeds purification 180 or so, purity reaches 70-80%.western- Blot testing results show the good immunogenicity of recombinant protein, proved again laying hen be immunized it is successful.

Embodiment 4：

Application of the Yolk antibody in anti-human source enterotoxic Escherichia coli immune vaccine is prepared, application process are as follows：

1st, subjects

6-8 week old Kunming kind SPF female mices；

2nd, test material

4 bacterial strain of table

Note：CFA, colonization factor antigen;CS, coli surface antigen

Yolk antibody is prepared for embodiment 3, and the Yolk antibody of EtpA groups is obtained by EtpA protein immunizations laying hen（Concentration For 10mg/mL, potency 64000）.

3rd, mouse challenge test

1）It is the 2-3 days laundering period after mouse reaches, random to be grouped, every group 8, free water feeding.

2）24-48h mouse drinking-water is changed to containing streptomysin before attacking poison（5g/L）Sterile water, to eliminate the normal bacterium of enteron aisle Group.

3）Prepare bacterium：Picking ETEC single bacteriums are fallen in fresh TBS culture mediums, and 37 DEG C of shaking table cultures are stayed overnight.Next day attacks poison The same day is inoculated with fresh culture with 1/100 amount again, treats that OD600 reaches 1.0（About 5 × 108CFU/mL）, bacterium solution centrifuges to obtain thalline Precipitation, is resuspended in the sterile PBS of 1/10 bacterium solution volume, for use.

4）12h fasting before poison is attacked, drinking-water is changed to distilled water.

5）Cimetidine is injected intraperitoneally in 1-3h before attacking poison（50mg/kg weight）, reduce influence of the hydrochloric acid in gastric juice to thalline.

6）Every mouse feeds the 200 fresh bacterium solutions of μ L through gastric perfusion needle, and the corresponding 50 μ L yolk of gavage of each processing group resists after 1h Liquid solution, later bio-occlusion food and drinking-water.

7）12h fasting before anesthesia, normal water.

8）It attacks after poison that anesthesia puts to death and dissects mouse after 48-72h, intercepts 3cm ileums（Return the blind upward 6cm in junction）, indulge To enteron aisle is splitted, 2mL PBS dilution contents are incubated at room temperature 10min after being vortexed 5 seconds, are vortexed again for 5 seconds.Gained supernatant is with 10- 1 after 10-2 dilutions with taking 100 μ L to be coated with maconkey agar plate count (Allen et al2006).

9）Each tablet 20 bacterium colonies of picking, the primer of the distinctive heat-stable toxin LT of design ETEC（It is positive:5'- CTAGTTTTCCATACTGAT-3' and reversely:5'-CCCCAGTCTATTACAGAA-3'）PCR detections are carried out, to identify that bacterium colony is No is ETEC, calculates positive bacterium colony ratio.

4th, cell adhesion experiment

Method：In 10mL fresh LBs, by 1/100 inoculated bacteria, in 37 DEG C of 225r/min shaken cultivations to thin Bacterium reaches growth logarithmic phase.Respectively plus 600 μ L bacterium solutions are in the centrifuge tube of 1.5mL, centrifuge 5min in 5000r/min, remove supernatant, Thalline is resuspended in the cell culture medium for adding in 600 μ L, and the Yolk antibody of 100 μ L is added for processing group.With 100:1 infection multiplicity （MOI）It is added in tissue culture plate, by control group（Common Yolk antibody）37 DEG C of incubation 1h are placed in processing group.Incubate 1h Afterwards, it is eluted 3 times with sterile PBS, removes nonadherent bacterium, the bacterium with cell adherence is through 200 μ L0.1%Triton-X- 100 phosphate are incubated 5-10min, even spread LB tablets after 100 μ L suspensions are diluted 1000 times, the clump count of secondary day growth （CFU）The bacterial population adhered to.Adhesion rate=1000* clump counts/total bacteria（Each processing is in triplicate）.

This experiment each group of data is counted using GraphPad Prism5.0, every group of clump count of mouse adherence test It is represented with geometrical mean, cell adhesion experiment is then represented with mean+SD, is compared two-by-two through nonparametric Mann- Whitney one tailed tests.P<0.05 judgement significant difference.

5th, test results and analysis

Malicious mouse, then Yolk antibody prepared by gavage difference albumen are attacked with ETEC H10407, the bacterium of enteron aisle adherency is in wheat It recovers in Kang Kai agar mediums, and 20 bacterium colonies of picking do PCR detections.The clump count of adherency=plate count average value * dilutions Spend * positives clump count/20.

It is divided into 2 groups, is not added with Yolk antibody group and addition Yolk antibody group, each 8 mouse of processing group, adherency situation is adopted With dilution plate counting statistics and it is averaged.In mouse challenge test, when being not added with Yolk antibody, the adherency number of H10407 It is 8.2 × 10⁴；The adherency number of H10407 is 1.2 × 10 when adding Yolk antibody⁴.In test cell line, it is not added with Yolk antibody When, the adhesion rate of H10407 is 0.0022%；The adhesion rate of H10407 is 0.0014% when adding Yolk antibody.

Each group mouse intestinal bacterial adhesion the result is shown in Figure 11, wherein after H10407 attacks poison, albumen EtpA groups are reached with compareing To level of signifiance difference, the suppression adhesive attraction of protein antibodies is shown.

As shown in figure 12, cell adherence is carried out with ETEC H10407, compared with the control group, bacterial strain H10407 is special in addition Bacterial adhesion number pole after different in nature Yolk antibody significantly reduces.Therefore also similar on a cellular level demonstrate the anti-stick of Yolk antibody Attached effect.

SEQUENCE LISTING

<110>Hua Zhong Agriculture University

<120>A kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins and its application

<130>A kind of people source enterotoxigenic escherichia coli adhesin EtpA fusion proteins and its application

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 6659

<212> DNA

<213>Artificial sequence

<400> 1

acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg 60

gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt 120

tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc 180

tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca 240

cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc 300

aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc 360

gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc 420

ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata 480

tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc 540

ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact 600

ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag 660

atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt 720

tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa 780

aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat 840

ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc 900

atcctccaaa atcggatctg gttccgcgtg gatccatgaa ccgtatatat aaactgaagt 960

ttgacaaacg ccgcaacgaa ctggtggtgg tgagtgaaat caccaccggc gtgggtaatg 1020

caaaagccac gggcagcgtg gagggcgaaa agtccccccg tcgtggcgtg cgcgccatgg 1080

cgctgagcct gctgtcgggt atgatgataa tggcccatcc ggcgatgtca gcaaacctgc 1140

cgaccggtgg ccagattgtg gcaggttcag gcagtatcca gacgccttcc ggcaaccaga 1200

tgaatattca tcagaacagc cagaacatgg tggccaactg gaacagcttt gacattggta 1260

aaggaaatac ggtgcagttt gaccagccca gcagcagtgc ggtggcgctg aaccgtgttg 1320

tgggtggcgg tgaatcgcag attatgggta acctgaaggc gaatggtcag gtgttcctgg 1380

ttaacccgaa cggcgtgctg tttggtgagg gggccagtgt cagcacgtca ggttttgtgg 1440

catcgacccg cgacattaaa aacgacgact tcatgaaccg tcgttacacc ttcagcggcg 1500

gacagaaagc cggggcagcg attgtgaacc agggggaact gaccacaaat gccggtggct 1560

atattgtgct ggcagcagac agggtcagca acagtggcac catccgtacg ccgggcggca 1620

agaccgtcct ggcggccagc gagcgcatca cgctgcagct ggataatggt ggcctgatgt 1680

ccgtgcaggt gacaggagat gtggttaatg ccctggtgga aaaccgcggt ctggtcagtg 1740

cccgggatgg tcaggtgtac ctgaccgcac ttggccgggg tatgctgatg aacacggtac 1800

tgaacgtgag cggggtggtg gaagccagcg gtatgcaccg tcaggacggt aacattgtac 1860

tggacggtgg cgacagtggt gtggtgcacc tgagtggtac cctgcaggcg gacaatgcgt 1920

ccggtcaggg tggtaaggtt gtcgtgcagg gtaagaatat tctgctggac aagggcagca 1980

acatcacagc aaccggtggt cagggcggcg gtgaagtgta tgtcggtggc ggctggcagg 2040

gtaaggacag caacatccgt aatgcggaca aggtggtgat gcagggcggc gcccgcattg 2100

acgtttctgc aacgcagcag ggtaacggcg gtacggctgt gctgtggtca gacagctaca 2160

ccaacttcca tggtcagatt agcgcgaagg gcggtgagac cggcggtaac ggtggtcggg 2220

tggagacctc ttcgcacggt aacctgcagg catttggtac ggtcagtgca tccgcgaaga 2280

aaggcaaggc gggtaactgg ctgctggact cggcggatat caccattgtg aatggtagca 2340

atgttagcaa aactgagacg actcaatcgc cgccgcacac gcaatttgca cccaccgctg 2400

cgggctctgc ggtcagcaat accagtatca acaacaggct gaacaacggg accagtgtca 2460

ctattctgac ccatcgcaca agaacaggca cagctcaggg cgggaatatt accgttaatg 2520

cggcaattaa caaaagcaac ggaagtgatg tcaacctgac gctgcaggct ggcggcaaca 2580

tcacggtaaa caacagcatc acgtccaccg agggtaagct gaatgttaat ctgtcgctcg 2640

agctcaagct taattcatcg tgactgactg acgatctgcc tcgcgcgttt cggtgatgac 2700

ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat 2760

gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca 2820

gccatgaccc agtcacgtag cgatagcgga gtgtataatt cttgaagacg aaagggcctc 2880

gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt 2940

ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca 3000

aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg 3060

aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc 3120

cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg 3180

ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt 3240

cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta 3300

ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat 3360

gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga 3420

gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca 3480

acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact 3540

cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc 3600

acgatgcctg cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact 3660

ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt 3720

ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt 3780

gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt 3840

atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata 3900

ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag 3960

attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat 4020

ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 4080

aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 4140

aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 4200

ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 4260

tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 4320

ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 4380

cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 4440

agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 4500

gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 4560

ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 4620

tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 4680

tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 4740

cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 4800

tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 4860

gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 4920

ataaattccg acaccatcga atggtgcaaa acctttcgcg gtatggcatg atagcgcccg 4980

gaagagagtc aattcagggt ggtgaatgtg aaaccagtaa cgttatacga tgtcgcagag 5040

tatgccggtg tctcttatca gaccgtttcc cgcgtggtga accaggccag ccacgtttct 5100

gcgaaaacgc gggaaaaagt ggaagcggcg atggcggagc tgaattacat tcccaaccgc 5160

gtggcacaac aactggcggg caaacagtcg ttgctgattg gcgttgccac ctccagtctg 5220

gccctgcacg cgccgtcgca aattgtcgcg gcgattaaat ctcgcgccga tcaactgggt 5280

gccagcgtgg tggtgtcgat ggtagaacga agcggcgtcg aagcctgtaa agcggcggtg 5340

cacaatcttc tcgcgcaacg cgtcagtggg ctgatcatta actatccgct ggatgaccag 5400

gatgccattg ctgtggaagc tgcctgcact aatgttccgg cgttatttct tgatgtctct 5460

gaccagacac ccatcaacag tattattttc tcccatgaag acggtacgcg actgggcgtg 5520

gagcatctgg tcgcattggg tcaccagcaa atcgcgctgt tagcgggccc attaagttct 5580

gtctcggcgc gtctgcgtct ggctggctgg cataaatatc tcactcgcaa tcaaattcag 5640

ccgatagcgg aacgggaagg cgactggagt gccatgtccg gttttcaaca aaccatgcaa 5700

atgctgaatg agggcatcgt tcccactgcg atgctggttg ccaacgatca gatggcgctg 5760

ggcgcaatgc gcgccattac cgagtccggg ctgcgcgttg gtgcggatat ctcggtagtg 5820

ggatacgacg ataccgaaga cagctcatgt tatatcccgc cgttaaccac catcaaacag 5880

gattttcgcc tgctggggca aaccagcgtg gaccgcttgc tgcaactctc tcagggccag 5940

gcggtgaagg gcaatcagct gttgcccgtc tcactggtga aaagaaaaac caccctggcg 6000

cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga 6060

caggtttccc gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac 6120

tcattaggca ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt 6180

gagcggataa caatttcaca caggaaacag ctatgaccat gattacggat tcactggccg 6240

tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag 6300

cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc 6360

aacagttgcg cagcctgaat ggcgaatggc gctttgcctg gtttccggca ccagaagcgg 6420

tgccggaaag ctggctggag tgcgatcttc ctgaggccga tactgtcgtc gtcccctcaa 6480

actggcagat gcacggttac gatgcgccca tctacaccaa cgtaacctat cccattacgg 6540

tcaatccgcc gtttgttccc acggagaatc cgacgggttg ttactcgctc acatttaatg 6600

ttgatgaaag ctggctacag gaaggccaga cgcgaattat ttttgatggc gttggaatt 6659

<210> 2

<211> 567

<212> PRT

<213>Artificial sequence

<400> 2

Met Asn Arg Ile Tyr Lys Leu Lys Phe Asp Lys Arg Arg Asn Glu Leu

1 5 10 15

Val Val Val Ser Glu Ile Thr Thr Gly Val Gly Asn Ala Lys Ala Thr

20 25 30

Gly Ser Val Glu Gly Glu Lys Ser Pro Arg Arg Gly Val Arg Ala Met

35 40 45

Ala Leu Ser Leu Leu Ser Gly Met Met Ile Met Ala His Pro Ala Met

50 55 60

Ser Ala Asn Leu Pro Thr Gly Gly Gln Ile Val Ala Gly Ser Gly Ser

65 70 75 80

Ile Gln Thr Pro Ser Gly Asn Gln Met Asn Ile His Gln Asn Ser Gln

85 90 95

Asn Met Val Ala Asn Trp Asn Ser Phe Asp Ile Gly Lys Gly Asn Thr

100 105 110

Val Gln Phe Asp Gln Pro Ser Ser Ser Ala Val Ala Leu Asn Arg Val

115 120 125

Val Gly Gly Gly Glu Ser Gln Ile Met Gly Asn Leu Lys Ala Asn Gly

130 135 140

Gln Val Phe Leu Val Asn Pro Asn Gly Val Leu Phe Gly Glu Gly Ala

145 150 155 160

Ser Val Ser Thr Ser Gly Phe Val Ala Ser Thr Arg Asp Ile Lys Asn

165 170 175

Asp Asp Phe Met Asn Arg Arg Tyr Thr Phe Ser Gly Gly Gln Lys Ala

180 185 190

Gly Ala Ala Ile Val Asn Gln Gly Glu Leu Thr Thr Asn Ala Gly Gly

195 200 205

Tyr Ile Val Leu Ala Ala Asp Arg Val Ser Asn Ser Gly Thr Ile Arg

210 215 220

Thr Pro Gly Gly Lys Thr Val Leu Ala Ala Ser Glu Arg Ile Thr Leu

225 230 235 240

Gln Leu Asp Asn Gly Gly Leu Met Ser Val Gln Val Thr Gly Asp Val

245 250 255

Val Asn Ala Leu Val Glu Asn Arg Gly Leu Val Ser Ala Arg Asp Gly

260 265 270

Gln Val Tyr Leu Thr Ala Leu Gly Arg Gly Met Leu Met Asn Thr Val

275 280 285

Leu Asn Val Ser Gly Val Val Glu Ala Ser Gly Met His Arg Gln Asp

290 295 300

Gly Asn Ile Val Leu Asp Gly Gly Asp Ser Gly Val Val His Leu Ser

305 310 315 320

Gly Thr Leu Gln Ala Asp Asn Ala Ser Gly Gln Gly Gly Lys Val Val

325 330 335

Val Gln Gly Lys Asn Ile Leu Leu Asp Lys Gly Ser Asn Ile Thr Ala

340 345 350

Thr Gly Gly Gln Gly Gly Gly Glu Val Tyr Val Gly Gly Gly Trp Gln

355 360 365

Gly Lys Asp Ser Asn Ile Arg Asn Ala Asp Lys Val Val Met Gln Gly

370 375 380

Gly Ala Arg Ile Asp Val Ser Ala Thr Gln Gln Gly Asn Gly Gly Thr

385 390 395 400

Ala Val Leu Trp Ser Asp Ser Tyr Thr Asn Phe His Gly Gln Ile Ser

405 410 415

Ala Lys Gly Gly Glu Thr Gly Gly Asn Gly Gly Arg Val Glu Thr Ser

420 425 430

Ser His Gly Asn Leu Gln Ala Phe Gly Thr Val Ser Ala Ser Ala Lys

435 440 445

Lys Gly Lys Ala Gly Asn Trp Leu Leu Asp Ser Ala Asp Ile Thr Ile

450 455 460

Val Asn Gly Ser Asn Val Ser Lys Thr Glu Thr Thr Gln Ser Pro Pro

465 470 475 480

His Thr Gln Phe Ala Pro Thr Ala Ala Gly Ser Ala Val Ser Asn Thr

485 490 495

Ser Ile Asn Asn Arg Leu Asn Asn Gly Thr Ser Val Thr Ile Leu Thr

500 505 510

His Arg Thr Arg Thr Gly Thr Ala Gln Gly Gly Asn Ile Thr Val Asn

515 520 525

Ala Ala Ile Asn Lys Ser Asn Gly Ser Asp Val Asn Leu Thr Leu Gln

530 535 540

Ala Gly Gly Asn Ile Thr Val Asn Asn Ser Ile Thr Ser Thr Glu Gly

545 550 555 560

Lys Leu Asn Val Asn Leu Ser

565

<210> 3

<211> 1701

<212> DNA

<213>Artificial sequence

<400> 3

atgaaccgta tatataaact gaagtttgac aaacgccgca acgaactggt ggtggtgagt 60

gaaatcacca ccggcgtggg taatgcaaaa gccacgggca gcgtggaggg cgaaaagtcc 120

ccccgtcgtg gcgtgcgcgc catggcgctg agcctgctgt cgggtatgat gataatggcc 180

catccggcga tgtcagcaaa cctgccgacc ggtggccaga ttgtggcagg ttcaggcagt 240

atccagacgc cttccggcaa ccagatgaat attcatcaga acagccagaa catggtggcc 300

aactggaaca gctttgacat tggtaaagga aatacggtgc agtttgacca gcccagcagc 360

agtgcggtgg cgctgaaccg tgttgtgggt ggcggtgaat cgcagattat gggtaacctg 420

aaggcgaatg gtcaggtgtt cctggttaac ccgaacggcg tgctgtttgg tgagggggcc 480

agtgtcagca cgtcaggttt tgtggcatcg acccgcgaca ttaaaaacga cgacttcatg 540

aaccgtcgtt acaccttcag cggcggacag aaagccgggg cagcgattgt gaaccagggg 600

gaactgacca caaatgccgg tggctatatt gtgctggcag cagacagggt cagcaacagt 660

ggcaccatcc gtacgccggg cggcaagacc gtcctggcgg ccagcgagcg catcacgctg 720

cagctggata atggtggcct gatgtccgtg caggtgacag gagatgtggt taatgccctg 780

gtggaaaacc gcggtctggt cagtgcccgg gatggtcagg tgtacctgac cgcacttggc 840

cggggtatgc tgatgaacac ggtactgaac gtgagcgggg tggtggaagc cagcggtatg 900

caccgtcagg acggtaacat tgtactggac ggtggcgaca gtggtgtggt gcacctgagt 960

ggtaccctgc aggcggacaa tgcgtccggt cagggtggta aggttgtcgt gcagggtaag 1020

aatattctgc tggacaaggg cagcaacatc acagcaaccg gtggtcaggg cggcggtgaa 1080

gtgtatgtcg gtggcggctg gcagggtaag gacagcaaca tccgtaatgc ggacaaggtg 1140

gtgatgcagg gcggcgcccg cattgacgtt tctgcaacgc agcagggtaa cggcggtacg 1200

gctgtgctgt ggtcagacag ctacaccaac ttccatggtc agattagcgc gaagggcggt 1260

gagaccggcg gtaacggtgg tcgggtggag acctcttcgc acggtaacct gcaggcattt 1320

ggtacggtca gtgcatccgc gaagaaaggc aaggcgggta actggctgct ggactcggcg 1380

gatatcacca ttgtgaatgg tagcaatgtt agcaaaactg agacgactca atcgccgccg 1440

cacacgcaat ttgcacccac cgctgcgggc tctgcggtca gcaataccag tatcaacaac 1500

aggctgaaca acgggaccag tgtcactatt ctgacccatc gcacaagaac aggcacagct 1560

cagggcggga atattaccgt taatgcggca attaacaaaa gcaacggaag tgatgtcaac 1620

ctgacgctgc aggctggcgg caacatcacg gtaaacaaca gcatcacgtc caccgagggt 1680

aagctgaatg ttaatctgtc g 1701

Claims (1)

1. a kind of preparation method of people source enterotoxigenic escherichia coli adhesin etpA fusion proteins, which is characterized in that including：

The locus of Serial No. AY920525 is searched in the GenBank of NCBI, wherein etpA is located at code area 2718- 8021, overall length 5304bp, target fragment are the 1701bp at 5' ends；Using people source enterotoxic Escherichia coli type strain H10407 as experiment Target fragment after PCR amplification is connected to expression vector, obtains recombinant plasmid pGEX-etpA by material；

The nucleotides sequence of the recombinant plasmid pGEX-etpA is classified as shown in SEQ ID NO.1；

The primer is in the PCR amplification：

Primer Primer sequence Restriction enzyme site etpA-F GGATCCATGAACCGTATATATAAACTGAAG BamhI etpA-R CTCGAGCGACAGATTAACATTCAG XhoI

Wherein, GGATCC is the restriction enzyme site of etpA-F, and CTCGAG is the restriction enzyme site of etpA-R；

Obtained recombinant plasmid pGEX-etpA is transformed into e. coli bl21 (DE3), it is thio with inducer isopropyl-β-d- Galactoside does induced expression；Induced expression condition is：37 DEG C of shaking table cultures reach 0.5-1.0 to OD600, add in IPTG extremely 0.1mM continues to cultivate 3-4h, and final expression quantity exists more than 20% in the form of inclusion body；Inclusion body is broken through pressure The inclusion body protein etpA fusion proteins obtained after broken, denaturation and renaturation concentration, sequence is shown in SEQ ID NO.2.