CN104789565B - Ribozyme type gene expression regulation element and application thereof - Google Patents
Ribozyme type gene expression regulation element and application thereof Download PDFInfo
- Publication number
- CN104789565B CN104789565B CN201510151449.2A CN201510151449A CN104789565B CN 104789565 B CN104789565 B CN 104789565B CN 201510151449 A CN201510151449 A CN 201510151449A CN 104789565 B CN104789565 B CN 104789565B
- Authority
- CN
- China
- Prior art keywords
- ribozyme
- gene
- gene expression
- regulation element
- expression regulation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a ribozyme type gene expression regulation element, the nucleotide sequence of which is shown as SEQ ID NO: 1 is shown in the specification; and simultaneously discloses a ribozyme-mediated gene regulation system constructed by utilizing the regulation element, specifically, a nucleotide sequence of the ribozyme type gene expression regulation element is inserted into a non-coding region of a target gene, and when the target gene is transferred into a host cell, theophylline is added into a culture medium of the host cell, the expression level of the target gene is improved along with the increase of the concentration of the theophylline. The regulatory element disclosed by the invention is exquisite in shortness and smallness, can show ON-type regulatory performance in various eukaryotic cells, and the constructed gene regulatory system can conveniently and effectively regulate the expression of genes, so that a platform can be widened for the fields of gene therapy, gene function research and the like.
Description
【Technical field】
The invention belongs to gene engineering technology field, and in particular to a kind of ribozyme type gene expression regulation element and utilize it
Build the gene regulatory system of ribozyme mediation.
【Background technology】
By control transcription from DNA to mRNA or translation from mRNA to protein, can effective regulatory gene expression.
The most frequently used gene regulatory system is all based on transcribing control at present, i.e., using exogenous ligand control protein-based trans-acting because
The combination of son and promoter originates or suppresses transcription, and such as tetracycline transcriptional switching, such regulator control system is bulky,
Special promoter, trans-acting factor are needed, there is immunotoxicity to host, it is difficult to meets gene therapy, gene function and grinds
The demand of multiple fields such as study carefully.In recent years, be based only upon RNA regulator control system with its without immunotoxicity, it is easily designed the advantages of obtain
To extensive concern.
Hammerhead ribozyme (hammerhead ribozyme) is the RNA fragments of a class energy self cracked, and this section of RNA can be certainly
I folds to form specific secondary structure：Stem I, stem II and stem III, three stem ends are cross-linked to form " tup " shape structure, only
Forming such structure just has self cracked active, the interaction pair in especially stem I, stem II between cyclic structure (loop)
The effectively cracking of hammerhead ribozyme in the cell is essential.For all Eukaryotic mRNA, noncoding region fracture
Its translation efficiency all will be effectively influenceed, therefore ribozyme is applied to any eucaryote, the expression regulation of any gene.
Aptamer (aptamer) is the RNA fragments of a class energy specific binding ligand, and the RNA can be with ligand molecular one
Rise and form highly stable higher structure, likewise, the RNA is only pre-formed specific structure ability and ligand binding.
Fit to be connected on the stem of hammerhead ribozyme, the fit change with ligand molecular combination front-end geometry can cause changing for ribozyme construct
Become, ribozyme is lost or recover self cracked ability.So obtained ligand-dependent type ribozyme (or allosteric ribozyme,
Allosteric ribozyme) mRNA noncoding region is inserted into, target gene is realized as a kind of cis element tight
Close regulation and control.Though there are a large amount of ligand-dependent type ribozymes to be screened or design at present, mammalian cell gene tune can be used for
What is controlled is considerably less, and especially ON types regulation and control (i.e. gene expression amount rises with the increase of ligand concentration) are less；And current document
The ON type ribozyme type gene expression regulation elements reported, are connected fit with the stem II of hammerhead ribozyme, but due to stem II
Of crucial importance for the intracellular lytic activity of hammerhead ribozyme, the insertion of fit sequence is unfavorable for the shape of ribozyme activity conformation
Into；When not having part, ribozyme not sufficiently forms activity conformation, causes the expression of gene to reveal；In the presence of having part, core
Enzymatic activity conformation can not be fully suppressed, and reduce gene expression efficiency；Therefore, current ON type ribozyme types gene expression is adjusted
The gene expression regulation for controlling element is not rigorous enough, i.e., target gene has more leakage expression when ligand concentration is 0.Also have
People is connected to fit on the stem III of hammerhead ribozyme, but obtain is OFF type gene expression regulation elements.
【The content of the invention】
The technical problems to be solved by the invention are to provide a kind of length shorter ribozyme type gene expression regulation element,
And disclose the gene regulatory system of the ribozyme for the being capable of Effective Regulation gene expression mediation built using the controlling element.
The present invention is to solve above-mentioned technical problem by the following technical programs：
A kind of ribozyme type gene expression regulation element, its nucleotide sequence such as SEQ ID NO：Shown in 1.
The gene regulatory system of the ribozyme mediation built using the ribozyme type gene expression regulation element, tool are disclosed simultaneously
Body, the nucleotide sequence of the ribozyme type gene expression regulation element is inserted in the noncoding region of target gene, when purpose base
Because being transferred to after host cell, theophylline is added into the culture medium of host cell, then destination gene expression level will be with theophylline concentration
Increase and lifted.
The beneficial effects of the present invention are：
There is provided a kind of ribozyme type gene expression regulation element, it has the short and small exquisiteness of length, in various eukaryotics
ON type performance of control, and the gene regulation of the ribozyme mediation built using the ribozyme type gene expression regulation element can be shown
System, can convenient, effectively controlling gene expression, so as to be widened for fields such as gene therapy, gene functional research
Platform.
【Brief description of the drawings】
The invention will be further described in conjunction with the embodiments with reference to the accompanying drawings.
Fig. 1 is a kind of conformation schematic diagram of ribozyme type gene expression regulation element of the invention.
Fig. 2 is that the ribozyme designed in embodiment 1 is imitated in Hela cells to the regulation and control that renilla luciferase (hRluc) is expressed
Fruit is schemed.
Fig. 3 is the comparison figure of the ribozyme and existing allosteric ribozyme regulator control system that design in embodiment 2.
Fig. 4 is the expression figure of inactivation ribozyme and the lower hRluc of activation ribozyme sequence effect in embodiment 3.
Fig. 5 is the regulating effect curve map in embodiment 3.
Fig. 6 is that the regulating effect in embodiment 4 compares figure.
【Embodiment】
In order to be better understood from the present invention, employed in following examples, and each embodiment
It is normal experiment method, agents useful for same, consumptive material are purchased from routine biochemistry reagent shop.
Plasmid vector psiCHECKTM-2 is purchased from Promega companies, and the carrier contains a Renilla luciferase reporter base
Because of (hRluc), and internal reference is used as containing firefly luciferase gene (Fluc).Ribozyme sequence (SmTheo) is ribozyme of the present invention
The sequence of type gene expression regulation element is given birth to the biological Co., Ltd of work by Shanghai and synthesized, and is inserted by restriction enzyme site XhoI and PmeI
Enter 3 ' UTR of the hRluc genes into plasmid vector psiCHECKTM-2, be used as experimental vehicle；Cell pyrolysis liquid and luciferase
Detection kit is purchased from Promega companies；Theophylline is purchased from Aladdin Reagent Company；Hela cells be purchased from ATCC, using containing
The RPIM-1640 medium cultures of 10% cow's serum are in 5%CO2Cell culture incubator in；96 orifice plates are laid on 10000/hole
On, when degrees of fusion reaches more than 90%, using LipofectamineTM2000 transfection experiments or control vector, more renew after 24h
The culture medium of the fresh, theophylline containing prescribed concentration；Cell lysis after 24h is cultivated, and successively detects the firefly of Fluc, hRluc in each hole
Light value, target gene hRluc expression is calculated according to following formula：
Each result is at least obtained through three independent experiments.
The design of embodiment 1, ribozyme type gene expression regulation element of the present invention
The nucleotide sequence of ribozyme type gene expression regulation element designed by the present invention as shown in SEQ ID NO.1, it
Contain a hammerhead ribozyme (Sm ribozymes) from Schistosoma mansoni and one can specific recognition theophylline it is artificial fit
(Theo-aptamer) it is, fit to be connected on the stem III of hammerhead ribozyme；The controlling element is in the cell with target gene
Two kinds of conformations i.e. A conformations and B conformations shown in Fig. 1 can be formed (according to RNA secondary structure prediction softwares by being transcribed into after RNA
RNAstructure 5.6)；In Fig. 1：A is conformation of the ribozyme when being not bound with part；B is structure of the ribozyme after binding partner
As；1 is Sm ribozymes；2 be theophylline aptamer；3 be intervening sequence), and ribozyme construct, can self cracked；Aptamer structure domain in A conformations
Do not fold correctly, it is impossible to which with ligand binding, and ribozyme construct correctly folds and is folded into activity conformation, can self cracked；B
Fit correct folding in conformation, with the ability with ligand binding, and ribozyme activity is destructurized, loses cracking ability；Between
The folding that can make whole ribozyme every sequence is not influenceed by sequence around；When intracellular ligand concentration is 0, whole sequence is inclined
To in forming A conformations, the cracking of ribozyme causes mRNA to be broken, gene expression amount reduction；With the increase of ligand concentration, whole sequence
Row increasingly tend to form B conformations, and mRNA integrality is maintained, and gene expression amount is consequently increased.
Theophylline aptamer is connected on the stem III of hammerhead ribozyme by the present invention, and catenation sequence is that length is 12 nucleotides
Random sequence (with overstriking font show).By hRluc genes in these sequences insertion plasmid vector psiCHECKTM-2
3 ' UTR, obtain experimental vehicle, transfect Hela cells；Using psiCHECKTM-2 plasmids as control vector, pass through luciferase point
Before and after analysis detection theophylline is added, the expression change of hRluc genes；A kind of ON types ribozyme type gene expression regulation is obtained so as to unexpected
Element, through sequencing, the controlling element sequence (i.e. SmTheo) is as shown in SEQ ID NO.1:
AAACAAACAAACTGAGGTGCAGGTACATCCAGCTGACGAGTCCCAAATAGGACGAAAAGCTATACCAGC
CGAAAGGCCCTTGGCAGAGCTAGCTTCCTGGATTCCACTGCTATCCACAAAAAGAAAAATAAAAA；
And other sequences, as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5
SmTheoM1-4 (is specifically shown in Table 1), although there was only the difference of 1-4 base respectively with SmTheo, but carries out each ribozyme in Hela
When being tested in cell to the regulating effect that renilla luciferase (hRluc) is expressed, it has been found that SmTheoM1-4 does not have gene table
Up to regulating and controlling effect (as shown in Figure 2).
The SmTheoM1-4 of table 1 nucleotide sequence
Embodiment 2, the comparison with the ON type ribozyme regulator control systems of document report
Prove that effective ON types ribozyme regulator control system is considerably less in mammalian cell, L2Bulge8 and L2Bulge9
It is two ribozyme regulator control systems available for mammalian cell of the reports such as Win, part is similarly theophylline, but its ribozyme is derived from
The sTRSV hammerhead ribozymes of nepovirus.
The Shanghai biological Co., Ltd of life work is entrusted to synthesize above-mentioned existing L2Bulge8, L2Bulge9 and sTRSV ribozyme sequence
Row, and it is inserted into by restriction enzyme site XhoI and PmeI 3 ' UTR of hRluc genes.Equally with empty carrier (psiCHECKTM- 2) it is
Control, the result after luciferase assay is as shown in Figure 3.
Simple sTRSV ribozymes represent the maximum suppression ability to target gene in all ribozymes of experiment, from Fig. 3
As can be seen that when ligand concentration is 0.Insert the presently disclosed controlling element sequence i.e. gene expression of SmTheo carrier
Level is far below L2Bulge8, L2Bulge9, and relatively sTRSV ribozymes now should illustrate to the inhibition of gene expression
The leakage of vector gene expression is slighter；(1.7 times) of SmTheo regulation and control multiple is higher than L2Bulge8 and L2Bulge9 simultaneously, shows
More preferable regulation and control amplitude is shown.In addition, Fig. 3 also shows the target gene leakage of SmTheo and its mutant nucleotide sequence SmTheoM2~4
Expression quantity is more much smaller than L2Bulge8, L2Bulge9, because the former fit stem III for being connected to hammerhead ribozyme
On, and the fit of the latter is connected on the stem II of hammerhead ribozyme, the interaction in stem I, stem II between cyclic structure (loop)
It is essential to the effectively cracking of hammerhead ribozyme in the cell, therefore this connected mode of the latter may hinder ribozyme construct
The cracking ability in domain.
By preceding described, sequence SmTheo disclosed by the invention is a kind of fit change being connected on hammerhead ribozyme stem III
Structure ribozyme is controlling element, and the regulation and control of ON types are showed to target gene, have more rigorous tune than existing ribozyme regulator control system
Control ability and bigger regulation and control amplitude.
The curative effect of embodiment 3, ribozyme type gene expression regulation element of the present invention to gene expression regulation
Noncoding region for mRNA transcription, translation for having significant impact, and the insertion of exogenous array may change base
The expression of cause, in order to exclude this non-specific influence of the ribozyme sequence on gene expression in itself, more accurately assesses core
Enzymatic lysis is to the regulating effect of gene expression, and we devise the ribozyme inactivation sequence SmTheoMN as shown in SEQ ID NO.6,
Specially：AAACAAACAAACTGAGGTGCAGGTACATCCAGCTGACGAGTCCCAAATAGGACGAGAAGCTATACCAGCC
GAAAGGCCCTTGGCAGAGCTAGCTTCCTGGATTCCACTGCTATCCACAAAAAGAAA AATAAAAA, mutational site is located at
56th nucleotides (being indicated with underscore), the position is on ribozyme conserved sequence, and ribozyme, which will be lost, after mutation cracks energy
Power, but according to RNAstrure5.6, it has identical secondary structure with SmTheo, equally with empty carrier (psiCHECKTM-2)
For control, carry out expression of the ribozyme to hRluc and test, as a result as shown in figure 4, being known by Fig. 4, lose after cracking ability, whole sequence
The lower destination gene expression level of (SmTheoMN) effect is arranged apparently higher than (being more than 100%) empty carrier (psiCHECKTM- 2), and
Show certain OFF type regulating effects；And when with cracking ability, the whole lower target gene table of sequence (SmTheo) effect
Up to level significantly lower than (being less than 100%) empty carrier, and show obvious ON types regulating effect.
Then we have evaluated sequence SmTheo disclosed in this invention in 0~1000 μM of tea using SmTheoMN as control
To hRLuc regulating effect in the range of alkali concn, as a result as shown in figure 5, so as to show, with the lifting of ligand concentration, purpose
Gene expression dose is gradually stepped up, and obvious dose-effect relationship is presented.
The regulating effect of embodiment 4, controlling element of the present invention ribozyme in a variety of mammalian cells
Equally Lipofectamine is used into HEK293 cells, A549 cells, HUVEC cells, U2OS cellsTM2000 turns
Dye is transferred to the experimental vehicle containing controlling element sequence SmTheo of the present invention, equally with empty carrier (psiCHECKTM- 2) it is control, enters
Go regulating effect experiment, it is disclosed in this invention to adjust in various mammalian cells as a result as shown in fig. 6, being known by Fig. 6
Control element sequences show ON type performance of control.
To sum up there is provided a kind of ribozyme type gene expression regulation element, it has the short and small exquisiteness of length, thin in various eucaryons
ON type performance of control, and the gene of the ribozyme mediation built using the ribozyme type gene expression regulation element can be shown in born of the same parents
Regulator control system, can convenient, effectively controlling gene expression, so as to being the fields such as gene therapy, gene functional research
Platform is widened.
Claims (2)
1. a kind of ribozyme type gene expression regulation element, it is characterised in that：The nucleotide sequence of the controlling element such as SEQ ID
NO：Shown in 1.
2. a kind of gene regulatory system of ribozyme mediation, it is characterised in that：Claim 1 is inserted in the noncoding region of target gene
The nucleotide sequence of the ribozyme type gene expression regulation element, after target gene is transferred to host cell, to host cell
Theophylline is added in culture medium, then destination gene expression level will be lifted with the increase of theophylline concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510151449.2A CN104789565B (en) | 2015-04-01 | 2015-04-01 | Ribozyme type gene expression regulation element and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510151449.2A CN104789565B (en) | 2015-04-01 | 2015-04-01 | Ribozyme type gene expression regulation element and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104789565A CN104789565A (en) | 2015-07-22 |
| CN104789565B true CN104789565B (en) | 2017-10-20 |
Family
ID=53554759
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510151449.2A Active CN104789565B (en) | 2015-04-01 | 2015-04-01 | Ribozyme type gene expression regulation element and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789565B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852650A (en) * | 2018-12-18 | 2019-06-07 | 江南大学 | A kind of artificial aptamer enzyme and application by theophylline regulation |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318972B (en) * | 2016-08-26 | 2020-02-21 | 深圳市第二人民医院 | Theophylline inductivity RNA interference switch system and gene regulation method and application thereof |
| CN111948181A (en) * | 2019-05-17 | 2020-11-17 | 中国科学院沈阳应用生态研究所 | Method for detecting ath-miRNA170-3p targeting MSH2 by using tobacco dual-luciferase reporter system |
| CN113564155B (en) * | 2021-07-22 | 2023-10-31 | 华侨大学 | Aptamer screening method and application thereof |
-
2015
- 2015-04-01 CN CN201510151449.2A patent/CN104789565B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| A modular and extensible ＲNA-based gene-regulatory platform for engineering cellular function;Win等;《PNAS》;20071231;第104卷(第36期);全文 * |
| Expanded hammerhead ribozymes containing addressable three-way junctions;Wieland等;《Rna》;20090531;第15卷(第5期);全文 * |
| Higher-order cellular information processing with synthetic ＲNA devices;Win等;《Science》;20081231;第322卷;全文 * |
| 适体核酶型人工核糖开关的设计;王佳稳等;《中国生物工程杂志》;20140228;第34卷(第2期);第2.2节 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852650A (en) * | 2018-12-18 | 2019-06-07 | 江南大学 | A kind of artificial aptamer enzyme and application by theophylline regulation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104789565A (en) | 2015-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789565B (en) | Ribozyme type gene expression regulation element and application thereof | |
| JP4763681B2 (en) | Multi-promoter expression cassette for simultaneous delivery of RNAi action mediators | |
| Lin et al. | Asymmetry of intronic pre-miRNA structures in functional RISC assembly | |
| Khosravi et al. | Site-directed RNA editing: recent advances and open challenges | |
| Kawa et al. | Inhibition of viral gene expression by human ribonuclease P. | |
| Pinkenburg et al. | Inhibition of NF-κB mediated inflammation by siRNA expressed by recombinant adeno-associated virus | |
| CA2710953A1 (en) | Methods and compositions for increasing gene expression | |
| KR102659219B1 (en) | Regulation of gene expression by aptamer-coordinated RNase P cleavage | |
| Trang et al. | A ribozyme derived from the catalytic subunit of RNase P from Escherichia coli is highly effective in inhibiting replication of herpes simplex virus 1 | |
| JP4908631B2 (en) | Allosteric trans-splicing group I ribozyme whose target-specific RNA replacement activity is regulated by theophylline | |
| Trang et al. | Developing RNase P ribozymes for gene‐targeting and antiviral therapy | |
| Bhakta et al. | Double MS2 guided restoration of genetic code in amber (TAG), opal (TGA) and ochre (TAA) stop codon | |
| Weinberg et al. | Comparative single-turnover kinetic analyses of trans-cleaving hammerhead ribozymes with naturally derived non-conserved sequence motifs | |
| Maguire et al. | Multiple roles for MSH2 in the repair of a deletion mutation directed by modified single-stranded oligonucleotides | |
| Torkzaban et al. | Development of a Tethered mRNA Amplifier to increase protein expression | |
| An et al. | Transient RNAi induction against endogenous genes in Arabidopsis protoplasts using in vitro-prepared double-stranded RNA | |
| Mao et al. | Inhibition of hepatitis C virus by an M1GS ribozyme derived from the catalytic RNA subunit of Escherichia coli RNase P | |
| Kläge et al. | A comparative survey of the influence of small self-cleaving ribozymes on gene expression in human cell culture | |
| Li et al. | Effective inhibition of human cytomegalovirus gene expression and growth by intracellular expression of external guide sequence RNA | |
| WO2016154962A1 (en) | Ribozyme-type gene expression regulation element and use thereof | |
| Li et al. | Expression and suppression of human telomerase RNA | |
| CN104404070A (en) | Method for inhibiting mouse MSTN (myostatin) expression and corresponding MSTN shRNA (short hairpin Ribose Nucleic Acid) segment | |
| Tapping et al. | Upstream interactions of functional mammalian tRNA gene transcription complexes probed using a heterologous DNA-binding protein. | |
| CN104745580B (en) | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people | |
| Carmona | Inhibition of Hepatitis B virus replication using RNAi effectors targeting the viral X-gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220519 Address after: 264100 building 58, No. 500 Binhai East Road, Mouping District, Yantai City, Shandong Province Patentee after: Huaqiao Bioengineering Technology Co.,Ltd. Address before: 266000 household 301, unit 2, building 34, No. 58, Songling Road, Laoshan District, Qingdao, Shandong Patentee before: Zhang Wei Patentee before: Jiang Shimin Patentee before: Xing Dezhong Patentee before: Shanghai Jihao Electronic Technology Co.,Ltd. Effective date of registration: 20220519 Address after: 266000 household 301, unit 2, building 34, No. 58, Songling Road, Laoshan District, Qingdao, Shandong Patentee after: Zhang Wei Patentee after: Jiang Shimin Patentee after: Xing Dezhong Patentee after: Shanghai Jihao Electronic Technology Co.,Ltd. Address before: Fengze District of Quanzhou city of Fujian Province east of Huaqiao University, 362000 Patentee before: HUAQIAO University |