CN104789559A - Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker - Google Patents
Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker Download PDFInfo
- Publication number
- CN104789559A CN104789559A CN201510126985.7A CN201510126985A CN104789559A CN 104789559 A CN104789559 A CN 104789559A CN 201510126985 A CN201510126985 A CN 201510126985A CN 104789559 A CN104789559 A CN 104789559A
- Authority
- CN
- China
- Prior art keywords
- chalk
- chalk5
- white
- rice
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention belongs to the technical field of plant biology and particularly discloses a molecular marker for identifying a genotype of a rice chalkiness major effect gene and application of the molecular marker. The molecular marker consists of a pair of outer primers Chalk5-O-F and Chalk5-O-R and a pair of inner primers Chalk5-C-F and Chalk5-T-R, and a primer sequence is shown in SEQ IDNO:1-4. The marker is moderate in amplified fragments and strong in specificity; when the marker is utilized for identifying the genotype of the rice chalkiness major effect gene Chalk5, gene typing can be performed on the rice chalkiness major effect gene only through simple PCR without sequencing; rice varieties with high and low chalkiness are distinguished, so that molecular marker-assisted selection performed on rice chalkiness characters is realized. The molecular marker disclosed by the invention can be used for the molecular marker-assisted selection of a rice improvement and separation population, improves the breeding efficiency and meets the large-scale molecular breeding requirements.
Description
Technical field
The present invention relates to plant biotechnology field, more specifically, relate to a kind of genotypic molecule marker and the application thereof of identifying the white major gene of paddy rice chalk.
Background technology
Paddy rice is the important farm crop of China, and rice quality is directly connected to the economic benefit of Rice Production and the quality of life of the people.Chalk is opaque part in rice endosperm in vain, is one of most important measurement index in China's Appearance Quality of Paddy Rice.Chalky grain rate is low, have excellent appearance characteristics without the rice that chalk is white; In addition, the rice head rice rate that chalkness ratio is low is general also corresponding higher, and crack rice after milling few, commodity value is high.Therefore, low chalk plain boiled water rice varieties is subject to the welcome of Rice Milling Enterprises and human consumer deeply.Paddy rice Chalkiness trait is by inherited genetic factors and environmental factors co-controlling, and wherein inherited genetic factors is the principal element affecting rice chalkiness proterties.
In fine quality rice breed breeding process, the white characteristic of low chalk is the important goal of breeding man always.Tradition Chalkiness trait often needs, after paddy rice maturation obtains some amount seed, to utilize the methods such as range estimation, image scanning to carry out classification or calculating to the white degree of chalk.Visual method is due to subjective random large, and the sensitivity of mensuration, accuracy and repeatability are all difficult to be guaranteed; And image scan method is more accurate and objective, but operation is relatively loaded down with trivial details and time-consuming, is difficult to select at breeding early generation.Therefore, utilizing molecule marker to realize directly selecting the white regulatory gene of chalk, is the effective means realizing the white characteristic high efficiency selected of the low chalk of paddy rice.
Forefathers' research shows, the LOC_Os05g06480 of encoding vacuolar film Proton Transport Pyrophosphate phosphohydrolase on No. 5 karyomit(e), key gene (the Li Y affecting the quality traits such as the white formation of rice grain chalk and polished rice rate, Fan C, Xing Y, et al. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice. Nature genetics, 2014).In prior art report natural germplasm colony, 7 kinds of haplotypes are roughly contained in this site, and these 7 kinds of haplotypes are classified as two classes by the structure of phylogenetic tree, and find several conservative SNP site.Wherein, the SNP site T/C variation being positioned at the promoter region-576 of this gene has significant application value.Therefore, the Molecular Identification that gene type can realize the white characteristic of different chalk is carried out to this SNP site, improves in the white characteristic efficiency of selection of the chalk of breeding early generation.
The qualification of tradition SNP site usually based on order-checking, enzyme cuts or gene chip is analyzed, when a large amount of sample survey, cost is higher, is difficult to meet breeding demand.Four primer amplifications are obstructed PCR(ARMS-PACR) special equipotential amplification can be carried out for SNP site.For known variant sites, design 1 pair of outer primer and 1 pair of specificity inner primer in both sides respectively, specificity inner primer 3' terminal bases must drop on the position of catastrophe point, thus optionally increase saltant type and wild-type genes of individuals.In same once amplification, wild-type is different with the expanding fragment length that mutated genes produces, individual genotype is differentiated by the presence or absence of particular bands in product fragment, a kind of codominance typing method, have easy and simple to handle, somatotype fast, the advantage such as low cost.
The design of ARMS-PCR primer is the key determining this technology for detection sensitivity, and secondly, ARMS-PCR also depends on the optimization of reaction conditions to SNP recall rate.
Summary of the invention
Technical problem to be solved by this invention overcomes the technological deficiency that existence differentiated in vain by paddy rice chalk in prior art, provides the genotypic molecule marker of a kind of qualification paddy rice chalk white major gene Chalk5.
Second object of the present invention is to provide above-mentioned molecule marker in qualification paddy rice chalk white major gene Chalk5 genotype or/and application in Chalkiness trait.
3rd object of the present invention is to provide the application of above-mentioned molecule marker in rice breeding.
4th object of the present invention utilizes above-mentioned molecular markers for identification paddy rice Chalkiness trait or identify paddy rice Chalkiness trait and the genotypic method of paddy rice chalk white major gene Chalk5 simultaneously.
5th object of the present invention utilizes the genotypic method of above-mentioned molecular markers for identification paddy rice chalk white major gene Chalk5.
The object of the invention is to be achieved by the following technical programs:
The genotypic molecule marker Chalk5-T/C of a kind of qualification paddy rice chalk white major gene Chalk5, described molecule marker is made up of a pair outer primer Chalk5-O-F, Chalk5-O-R and a pair inner primer Chalk5-C-F, Chalk5-T-R, and primer sequence is as shown in SEQ ID NO:1 ~ 4.
Molecule marker of the present invention designs for the promotor SNP site "-576-T/C " of the white gene of chalk, and this molecule marker contains difference site.
In order to increase the specificity of primer, the above-mentioned primer of the present invention utilizes online tetra-primer ARMS-PCR design of primers instrument Primer1(http: //primer1.soton.ac.uk/primer1.html) design obtain, meanwhile, 3 ' end the 3rd base of inner primer of the present invention introduces base mismatch.
There is provided above-mentioned molecule marker in qualification paddy rice chalk white major gene Chalk5 genotype or/and application in paddy rice Chalkiness trait.
The application of above-mentioned molecule marker in rice breeding is provided.
There is provided and utilize the genotypic method of above-mentioned molecular markers for identification paddy rice chalk white major gene Chalk5; Particularly, the method comprises the following steps:
S1 testing sample DNA extraction;
The sample DNA that S2 obtains with S1, for template, builds PCR reaction system, utilizes described molecule marker to carry out pcr amplification;
S3 utilizes the product after gel electrophoresis or capillary electrophoresis analysis pcr amplification, carries out result judgement, and described result is judged to be: if there is 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of low chalk; If there is 150bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of high chalk; If there is 150bp, 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is heterozygous.
The method utilizing above-mentioned molecular markers for identification paddy rice Chalkiness trait or identify paddy rice chalk white major gene Chalk5 genotype and paddy rice Chalkiness trait is simultaneously provided, particularly, comprises the following steps:
S1 testing sample DNA extraction;
The sample DNA that S2 obtains with S1, for template, builds PCR reaction system, utilizes described molecule marker to carry out pcr amplification;
S3 utilizes the product after gel electrophoresis or capillary electrophoresis analysis pcr amplification, carry out result judgement, described result is judged to be: if there is 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of low chalk, testing sample is the white kind of low chalk; If there is 150bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of high chalk, testing sample is the white kind of high chalk; If there is 150bp, 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is heterozygous, testing sample is intermediate variety.
The sensitivity that ARMS-PCR detects is except the specificity being decided by primer, also be subject to the impact that PCR reacts various condition, as the concentration etc. of primer concentration, annealing temperature, Taq DNA polymerase, therefore, preferably, in aforesaid method, described PCR reaction system is: DNA profiling 1.0 uL, Chalk5-C-F 0.5uL, Chalk5-T-R 0.5uL, Chalk5-O-F 0.3uL, Chalk5-O-R 0.3uL, 2 × Power Taq PCR Master Mix 7.5uL, complements to 15uL with two aqua sterilisa that steams.
Preferably, in aforesaid method, the condition of described pcr amplification is: 94 DEG C of denaturation 5min, 94 DEG C of 30s, 55 DEG C of 30s, and 72 DEG C of 35s run 35 circulations altogether, and last 72 DEG C extend 10min.
Compared with prior art, the present invention has following beneficial effect:
The invention provides the genotypic molecule marker of a kind of qualification paddy rice chalk white major gene Chalk5, this mark amplified fragments is moderate, high specificity; Utilize this Marker Identification paddy rice chalk white major gene Chalk5 genotype, do not need through order-checking, gene type can be carried out to the white major gene of paddy rice chalk only by simple PCR, distinguish the rice varieties that high and low chalk is white, achieve the molecular marker assisted selection to paddy rice Chalkiness trait, molecule marker of the present invention may be used for the molecular marker assisted selection of rice modification segregating population, improves breeding efficiency, meets the demand of large-scale molecular breeding.
Accompanying drawing explanation
Fig. 1 is Chalk5-T/C primer sequence and position view; Wherein allelic variation site is respectively with red background mark, and primer base mismatch identifies with underscore.
Fig. 2 is the gel electrophoresis somatotype of Chalk5-T/C amplified production; Wherein: 1-bright extensive 63; The 2-Bath horse base of a fruit 370; 3-Zhenshan 97B; 4-IR64; 5-Zhenshan 97B/bright extensive 63.
Fig. 3 is that Chalk5-T/C combines full-automatic capillary electrophoresis detected result; Wherein M is DNA ladder; 1 ~ 10 for detecting rice material, and 1,3,6 is C/C type; 2,8,10 is T/T type; 4,5,7,9 is C/T type.
Embodiment
Further illustrate content of the present invention below in conjunction with Figure of description and specific embodiment, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the simple modification do the inventive method, step or condition or replacement, all belong to scope of the present invention; If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art.
the design of primers of embodiment 1 paddy rice chalk white gene function mark Chalk5-T/C and amplified fragments analysis
1, design of primers
For promotor SNP site "-576-T/C " (the white kind of T-height chalk of the white gene C halk5 of chalk, the white kind of the low chalk of C-), utilize online tetra-primer ARMS-PCR design of primers instrument Primer1(http: //primer1.soton.ac.uk/primer1.html) design the functional label Chalk5-T/C containing difference site, introduce base mismatch at 3 ' end the 3rd base place of equipotential special primer simultaneously, increase specificity (Fig. 1).Described Chalk5-T/C is made up of 4 primers Chalk5-O-F, Chalk5-O-R, Chalk5-C-F and Chalk5-T-R, primer sequence (5 '-3 ') as follows:
Chalk5-O-F：TCAAAAACCACCATTCGAAATGA
Chalk5-O-R：TGTGTATAAACATTTTTGTTGTTTTTGCA
Chalk5-C-F：CATTTTCAGTGCGTCCAAA
ACC
Chalk5-T-R：AAGTTATATACGGTGCGTCTCAT
GGA
(base with underscore in primer sequence is the base mismatch introduced, and the base adding frame is the variation base that will detect)
2, amplified fragments analysis
The white genotype of low chalk (C/C is homozygous), the white genotype of high chalk (T/T is homozygous) and heterozygous (C/T heterozygous), the band that Chalk5-O-F and Chalk5-O-R can be utilized to amplify size be about 298 bp, this band may be used for pcr amplification whether monitoring.In addition, the white genotype of low chalk (C/C is homozygous) can also utilize Chalk5-C-F and Chalk5-O-R to amplify the band of 196 bp; The white genotype of high chalk (T/T is homozygous) can utilize Chalk5-O-F and Chalk5-T-R to amplify the band of 150 bp; The band that heterozygous (C/T heterozygous) can amplify 196 bp can amplify again the band of 150 bp.
embodiment 2 utilizes functional indicia Chalk5-T/C to analyze the white genotype of chalk of 5 rice varieties
1, the extraction of oryza sativa genomic dna
With 5 rice varieties for material: bright extensive 63, the Bath horse base of a fruit 370, Zhenshan 97B, IR64, Zhenshan 97B/bright extensive 63.Choose paddy rice individual plant tender leaf, adopt CTAB method to extract oryza sativa genomic dna, concrete steps are as follows: (1) is got proper amount of fresh blade and is placed on and adds liquid nitrogen in 2 mL centrifuge tubes and smash to pieces, adds 1 mL CTAB extract, shake up in centrifuge tube; (2) be placed in water-bath or the thermostat container of 65 DEG C, shake gently once every 10min, take out after 30 ~ 45min; (3) after cooling 2 min, add chloroform-isoamyl alcohol (24:1) to full packages, acutely shake up and down, make both mix; (4) centrifuge tube puts into whizzer 15, takes out after centrifugal 10 min of 000 r/min; (5) careful Aspirate supernatant is in new sterile centrifugation tube, then adds the Virahol of 600 μ L precoolings, shakes gently up and down, Virahol is fully mixed with water layer; Place 20 min, DNA is fully precipitated for (6)-20 DEG C; (7) 10,000 r/min moment is centrifugal, outwells liquid immediately, then is stood upside down by centrifuge tube on the paper handkerchief spread out; (8) upright centrifuge tube after 1min, adds ethanol and the 80 μ L 3M NaAc solution of 720 μ L 70%, shakes gently, flick tip with finger, DNA is precipitated and swims in liquid; (9) at least place 30min, impurity is fully dissolved; (10) 10,000 r/min moment is centrifugal, outwells liquid immediately, adds the ethanol of 800 μ L 70% by DNA rinsing 20 ~ 30min again; Centrifugal 3 ~ the 5min of (11) 15,000 r/min, outwells liquid immediately, is stood upside down by centrifuge tube on the paper handkerchief spread out; (12) upright centrifuge tube after several minutes, ventilating kitchen inner drying DNA; (13) add 100 μ L 1 × TE Buffer, DNA is fully dissolved; (14)-20 DEG C of preservations, for subsequent use are placed in.
2, the mensuration of 5 kind Chalkiness trait
Random taking-up head milled rice 100 from head milled rice sample, be placed on sheet glass, observe under spot light lamp, sort out the grain of rice of chalk white (comprise core white, white belly, the back of the body are white), by formula: chalk rice rate (%)=(chalk rice grain number/total grain number) × 100%), obtain the percentage of chalk rice.Repeat once, get the mean value that secondary measures, be chalk rice rate.Get chalk rice 10 at random, keep flat under spot light lamp, amass by grain range estimation chalk fine flour the percentage ratio accounting for whole kernel area, obtain the mean value that chalk fine flour is long-pending.Repeat once, the mean value of secondary measurement result is Chalkiness size.Chalkiness degree calculates as follows: chalkiness degree=chalk rice rate × Chalkiness size.The white analytical results of chalk shows, bright extensive 63 and the Bath horse base of a fruit 370 are low chalk plain boiled water rice varieties (chalkiness degree=0.5%); Zhenshan 97B and IR64 are high chalk plain boiled water rice varieties (chalkiness degree=15.3%); Zhenshan 97B/bright extensive 63 are intermediate variety, chalkiness degree=5.6%.
3, functional indicia Chalk5-T/C is utilized to identify the white genotype of the chalk of 5 kinds
Functional label Chalk5-T/C is utilized to carry out pcr amplification to the DNA of 5 rice varieties, reaction system is 15 uL, comprise: DNA profiling 1.0 uL, Chalk5-C-F 0.5uL, Chalk5-T-R 0.5uL, Chalk5-O-F 0.3uL, Chalk5-O-R 0.3uL, 2 × Power Taq PCR Master Mix 7.5uL, residue distilled water (ddH
2o) supply.
PCR reaction conditions: 94 DEG C of denaturation 5min, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 35s run 35 circulations altogether, and last 72 DEG C extend 10min.
4, the polyacrylamide gel electrophoresis of amplified production detects and genotype judgement
Amplified production through 8.0% native polyacrylamide gel electrophoresis (electrophoretic buffer 1 × TBE, voltage 110 V, the time 2.5 h), by 0.1% AgNO
3dyeing, utilizes BIORAD gel imaging system to observe, take pictures, read tape.Genotype is judged:
Amplified production is 298 bp and 196 bp, two kinds of fragments, show tags idiotype be C/C homozygous (in Fig. 2 the 1st and 2 detect samples); Amplified production is 298 bp and 150 bp, two kinds of fragments, and show tags idiotype is T/T homozygous (the 3rd in Fig. 2 and 4 detection samples); Amplified production is 298 bp, 196 bp and 150 bp, tri-kinds of fragments, and show tags idiotype is C/T heterozygous (the 5th in Fig. 2 is detected sample).
The above results show bright extensive 63 and the Bath horse base of a fruit 370 are the white genotype of low chalk; Zhenshan 97B and IR64 are the white genotype of high chalk; Zhenshan 97B/bright extensive 63 are the white genotype of heterozygosis chalk; Consistent with the result that manual method above detects the Chalkiness trait of paddy rice.
comparative example 1 utilizes functional indicia to analyze the white genotype of chalk of 5 rice varieties
Experimental technique with embodiment 2, uniquely unlike, the inner primer sequence of molecule marker used is as follows:
SEQ ID NO：5：5’-CATTTTCAGTGCGTCCAAA
GCC-3’
SEQ ID NO：6：5’-AAGTTATATACGGTGCGTCTCAT
AGA-3’
Utilize the molecule marker of this comparative example to identify 5 rice varieties described in embodiment 2, result shows: utilize each sample standard deviation of this primer to amplify 3 bar segment, specificity is bad, effectively, significantly cannot carry out effective somatotype to allelotrope.Illustrate, use different base mismatch can cause undesirable expanding effect, the specific amplification of this primer is bad, and gene type is undesirable.，
comparative example 2 utilizes functional indicia to analyze the white genotype of chalk of 5 rice varieties
Experimental technique with embodiment 2, uniquely unlike, PCR reaction system used is as follows:
Reaction system is 15 uL, comprise: DNA profiling 1.0 uL, Chalk5-C-F 0.3uL, Chalk5-T-R 0.3uL, Chalk5-O-F 0.5uL, Chalk5-O-R 0.5uL, 2 × Power Taq PCR Master Mix 7.5uL, residue distilled water (ddH2O) is supplied.
Utilize this reaction system to identify 5 rice varieties described in embodiment 2, result shows: under this PCR reaction system condition, identical sample amplified production all has 3 bands, and illustrate that equipotential increases unsuccessfully, different allelotypes can not effectively be distinguished.This result shows that the PCR reaction system needs that this marks increase by specific primer concentration.
embodiment 3 utilizes paddy rice chalk white gene molecule marker Chalk5-T/C to identify the white genotypic rice individual plant of low chalk
1, experiment material: rice varieties China accounts for and is polymerized is 10 parts of paddy rice individual plants that " H463 " hybridizes F2 offspring.
2, the extraction of oryza sativa genomic dna: with embodiment 2.
3, functional indicia Chalk5-T/C increases: with embodiment 2.
4, the capillary electrophoresis of amplified production detects and genotype judgement
Amplified production is carried out diluting and is transferred to the Fragment Analyzer Automated CE System(U.S., AATI) detect, operate according to the process specifications of test kit DNF-910-K2000, and use PROSize 2.0 data analysis software to carry out data analysis, finally genotype is judged:
Amplified production is 298 bp and 196 bp, two kinds of fragments, and show tags idiotype is C/C homozygous (in Fig. 3, the 1st, 3,6 is detected sample); Amplified production is 298 bp and 150 bp, two kinds of fragments, and show tags idiotype is T/T homozygous (the 2nd in Fig. 3,8,10 are detected sample); Amplified production is 298 bp, 196 bp and 150 bp, tri-kinds of fragments; Show tags idiotype is C/T heterozygous (the 4th, 5,7,9 in Fig. 3 is detected sample).
The above results shows to pick out the white genotype individuals of the low chalk of C/C totally 3 from 10 parts of paddy rice individual plants, thus realizes the Chalkiness trait qualification of breeding early generation.
SEQUENCE LISTING
<110> Agricultural University Of South China
<120> mono-kind identifies genotypic molecule marker and the application thereof of the white major gene of paddy rice chalk
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> Chalk5-O-F
<400> 1
tcaaaaacca ccattcgaaa tga 23
<210> 2
<211> 29
<212> DNA
<213> Chalk5-O-R
<400> 2
tgtgtataaa catttttgtt gtttttgca 29
<210> 3
<211> 22
<212> DNA
<213> Chalk5-C-F
<400> 3
cattttcagt gcgtccaaaa cc 22
<210> 4
<211> 26
<212> DNA
<213> Chalk5-T-R
<400> 4
aagttatata cggtgcgtct catgga 26
<210> 5
<211> 22
<212> DNA
Inner primer forward sequence in <213> comparative example 1
<400> 5
cattttcagt gcgtccaaag cc 22
<210> 6
<211> 26
<212> DNA
Inner primer reverse sequence in <213> comparative example 1
<400> 6
aagttatata cggtgcgtct cataga 26
Claims (9)
1. the genotypic molecule marker of qualification paddy rice chalk white major gene Chalk5, it is characterized in that, described molecule marker is made up of a pair outer primer Chalk5-O-F, Chalk5-O-R and a pair inner primer Chalk5-C-F, Chalk5-T-R, and primer sequence is as shown in SEQ ID NO:1 ~ 4.
2. molecule marker described in claim 1 in qualification paddy rice chalk white major gene Chalk5 genotype or/and application in paddy rice Chalkiness trait.
3. the application of molecule marker described in claim 1 in rice breeding.
4. utilize the genotypic method of molecular markers for identification paddy rice chalk white major gene Chalk5 described in claim 1.
5. utilize molecular markers for identification paddy rice Chalkiness trait described in claim 1 or identify the method for paddy rice chalk white major gene Chalk5 genotype and paddy rice Chalkiness trait simultaneously.
6. method according to claim 4, is characterized in that, comprises the following steps:
S1 testing sample DNA extraction;
The sample DNA that S2 obtains with S1, for template, builds PCR reaction system, utilizes molecule marker described in claim 1 to carry out pcr amplification;
S3 analyzes the product after pcr amplification, and carry out result judgement, described result is judged to be: if there is 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of low chalk; If there is 150bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of high chalk; If there is 150bp, 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is heterozygous.
7. method according to claim 5, is characterized in that, comprises the following steps:
S1 testing sample DNA extraction;
The sample DNA that S2 obtains with S1, for template, builds PCR reaction system, utilizes molecule marker described in claim 1 to carry out pcr amplification;
S3 analyzes the product after pcr amplification, and carry out result judgement, described result is judged to be: if there is 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of low chalk, testing sample is the white kind of low chalk; If there is 150bp and 298bp band, then show that the white major gene of the chalk of testing sample is the white genotype of high chalk, testing sample is the white kind of high chalk; If there is 150bp, 196bp and 298bp band, then show that the white major gene of the chalk of testing sample is heterozygous, testing sample is intermediate variety.
8. the method according to claim 6 or 7, it is characterized in that, described PCR reaction system is: DNA profiling 1.0 uL, Chalk5-C-F 0.5uL, Chalk5-T-R 0.5uL, Chalk5-O-F 0.3uL, Chalk5-O-R 0.3uL, 2 × Power Taq PCR Master Mix 7.5uL, complements to 15uL with two aqua sterilisa that steams.
9. the method according to claim 6 or 7, is characterized in that, the condition of described pcr amplification is: 94 DEG C of denaturation 5min, 94 DEG C of 30s, 55 DEG C of 30s, and 72 DEG C of 35s run 35 circulations altogether, and last 72 DEG C extend 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510126985.7A CN104789559A (en) | 2015-03-23 | 2015-03-23 | Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510126985.7A CN104789559A (en) | 2015-03-23 | 2015-03-23 | Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104789559A true CN104789559A (en) | 2015-07-22 |
Family
ID=53554753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510126985.7A Pending CN104789559A (en) | 2015-03-23 | 2015-03-23 | Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789559A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925689A (en) * | 2016-05-13 | 2016-09-07 | 江苏省农业科学院 | Molecular marker and method for identifying allelotype of rice chalk gene Chalk5 |
| CN106119376A (en) * | 2016-07-06 | 2016-11-16 | 湖南农业大学 | The molecule labelling method in rice chalkiness degree main effect QTL site and application |
| CN107254548A (en) * | 2017-08-17 | 2017-10-17 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying paddy rice Chalkiness trait |
| CN109266774A (en) * | 2018-08-28 | 2019-01-25 | 湖南杂交水稻研究中心 | A kind of surface plasma body resonant vibration measuring method of the white gene C halk5 of rice chalk |
| CN109609674A (en) * | 2018-12-24 | 2019-04-12 | 江西省农业科学院水稻研究所 | A kind of molecular labeling, identification method and application for identifying the white related gene PPDKB of rice chalk |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382479A (en) * | 2012-05-05 | 2013-11-06 | 华中农业大学 | Cloning and application of major gene Chalk5 for chalkiness rate of paddy rice |
-
2015
- 2015-03-23 CN CN201510126985.7A patent/CN104789559A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382479A (en) * | 2012-05-05 | 2013-11-06 | 华中农业大学 | Cloning and application of major gene Chalk5 for chalkiness rate of paddy rice |
Non-Patent Citations (2)
| Title |
|---|
| SHU YE ET AL.: "An efficient procedure for genotyping single nucleotide An efficient procedure for genotyping single nucleotide polymorphisms", 《NUCLEIC ACIDS RESEARCH》 * |
| YIBO LI ET AL.: "Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice", 《NATURE GENETICS》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105925689A (en) * | 2016-05-13 | 2016-09-07 | 江苏省农业科学院 | Molecular marker and method for identifying allelotype of rice chalk gene Chalk5 |
| CN106119376A (en) * | 2016-07-06 | 2016-11-16 | 湖南农业大学 | The molecule labelling method in rice chalkiness degree main effect QTL site and application |
| CN106119376B (en) * | 2016-07-06 | 2019-11-08 | 湖南农业大学 | The molecule labelling method in rice chalkiness degree main effect QTL site and application |
| CN107254548A (en) * | 2017-08-17 | 2017-10-17 | 辽宁省盐碱地利用研究所 | A kind of molecular labeling, authentication method and application for identifying paddy rice Chalkiness trait |
| CN109266774A (en) * | 2018-08-28 | 2019-01-25 | 湖南杂交水稻研究中心 | A kind of surface plasma body resonant vibration measuring method of the white gene C halk5 of rice chalk |
| CN109609674A (en) * | 2018-12-24 | 2019-04-12 | 江西省农业科学院水稻研究所 | A kind of molecular labeling, identification method and application for identifying the white related gene PPDKB of rice chalk |
| CN109609674B (en) * | 2018-12-24 | 2022-03-18 | 江西省农业科学院水稻研究所 | Molecular marker for identifying rice chalkiness related gene PPDKB, identification method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Demeke et al. | Identification of potato cultivars and clonal variants by random amplified polymorphic DNA analysis | |
| CN104789559A (en) | Molecular marker for identifying genotype of rice chalkiness major effect gene and application of molecular marker | |
| CN107988353B (en) | A kind of mankind MTHFR and/or MTRR genetic polymorphism detection kit | |
| CN109554503B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN105112546A (en) | Primer set for detecting functional genes of wheat on basis of KASP [competitive allele specific PCR (polymerase chain reaction)] technology and application of set primer | |
| CN109609686B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN105506127A (en) | Primers and kit for detecting rice blast resistance genes Pigm and genetic typing method | |
| CN104789654A (en) | Molecular marker for rice blast resistance gene Pita and application thereof | |
| CN109868328B (en) | SSR molecular marker for identifying paeonia rockii varieties and application | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN108103208A (en) | A kind of SNP marker for influencing sheep Fecundity Trait and its application | |
| CN107746896B (en) | SNP (Single nucleotide polymorphism) marker related to peach fruit skin and villus character and application thereof | |
| CN111411168A (en) | Screening method for breeding parent variety of high-quality wheat and primer group combination used by same | |
| CN104789648B (en) | Identify molecular labeling and its application of the section haplotypes of rice CMS restoring genes Rf 1 | |
| CN106987619A (en) | The gene specific mark of brown middle arteries 3 is used for the purposes that character gene penetrates into corn | |
| CN106244687B (en) | A kind of rice GS3 functional gene molecular labeling and detection method | |
| CN108220473A (en) | It is marked using chloroplaset InDel and differentiates CMS-S maize material | |
| CN104789558A (en) | Molecular marker for rice gelatinization temperature control gene and application thereof | |
| CN104593510A (en) | Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes | |
| CN115094158A (en) | KASP marker development of rice blast resistance gene Pid4 and application thereof | |
| Li et al. | Genetic diversity analysis and DNA fingerprinting of the main japonica rice varieties in Heilongjiang Province | |
| CN114317811B (en) | SNP locus and KASP molecular marker primer group for identifying tartary buckwheat unshelling character and application thereof | |
| CN113881802B (en) | SNP molecular marker KQ8-3918 linked with gene for controlling Vc content of pepper fruits, application and special primer | |
| CN114457178B (en) | KASP molecular marker for predicting soluble solids of waxberry fruits and application thereof | |
| CN116397042B (en) | SNP marker related to soybean hundred grain weight and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150722 |