CN104774965B - Sperm long non-coding RNA detection method for embryonic development quality evaluation - Google Patents
Sperm long non-coding RNA detection method for embryonic development quality evaluation Download PDFInfo
- Publication number
- CN104774965B CN104774965B CN201510220115.6A CN201510220115A CN104774965B CN 104774965 B CN104774965 B CN 104774965B CN 201510220115 A CN201510220115 A CN 201510220115A CN 104774965 B CN104774965 B CN 104774965B
- Authority
- CN
- China
- Prior art keywords
- sperm
- coding rna
- embryonic development
- long non
- rna molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 230000013020 embryo development Effects 0.000 title claims abstract description 31
- 108091046869 Telomeric non-coding RNA Proteins 0.000 title claims abstract description 29
- 238000001514 detection method Methods 0.000 title claims abstract description 26
- 238000013441 quality evaluation Methods 0.000 title claims abstract description 14
- 230000014509 gene expression Effects 0.000 claims abstract description 30
- 238000006243 chemical reaction Methods 0.000 claims abstract description 27
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims abstract description 22
- 238000003753 real-time PCR Methods 0.000 claims abstract description 18
- 238000010839 reverse transcription Methods 0.000 claims abstract description 17
- 239000002299 complementary DNA Substances 0.000 claims abstract description 10
- 210000000582 semen Anatomy 0.000 claims abstract description 9
- 238000000034 method Methods 0.000 claims description 15
- 108090000623 proteins and genes Proteins 0.000 claims description 13
- 239000003153 chemical reaction reagent Substances 0.000 claims description 7
- 239000001046 green dye Substances 0.000 claims description 7
- 230000000692 anti-sense effect Effects 0.000 claims description 4
- 238000012360 testing method Methods 0.000 claims description 2
- 230000000694 effects Effects 0.000 abstract description 4
- 210000001161 mammalian embryo Anatomy 0.000 description 24
- 239000000523 sample Substances 0.000 description 15
- 238000005516 engineering process Methods 0.000 description 7
- 238000011161 development Methods 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 5
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 3
- 238000011156 evaluation Methods 0.000 description 3
- 102000007469 Actins Human genes 0.000 description 2
- 108010085238 Actins Proteins 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 230000002159 abnormal effect Effects 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 238000003776 cleavage reaction Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000004720 fertilization Effects 0.000 description 2
- 108091027963 non-coding RNA Proteins 0.000 description 2
- 102000042567 non-coding RNA Human genes 0.000 description 2
- 239000013558 reference substance Substances 0.000 description 2
- 230000007017 scission Effects 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108700039887 Essential Genes Proteins 0.000 description 1
- 101001064774 Homo sapiens Peroxidasin-like protein Proteins 0.000 description 1
- 101001038163 Homo sapiens Sperm protamine P1 Proteins 0.000 description 1
- 101000794200 Homo sapiens Testis-specific serine/threonine-protein kinase 6 Proteins 0.000 description 1
- 206010021929 Infertility male Diseases 0.000 description 1
- 208000007466 Male Infertility Diseases 0.000 description 1
- 208000036830 Normal foetus Diseases 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 102100031894 Peroxidasin-like protein Human genes 0.000 description 1
- 238000010806 PrimeScriptTM RT Reagent kit Methods 0.000 description 1
- 208000002312 Teratozoospermia Diseases 0.000 description 1
- 102100030141 Testis-specific serine/threonine-protein kinase 6 Human genes 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000001109 blastomere Anatomy 0.000 description 1
- 238000004422 calculation algorithm Methods 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000013211 curve analysis Methods 0.000 description 1
- 230000003247 decreasing effect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000008143 early embryonic development Effects 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 210000002257 embryonic structure Anatomy 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000006062 fragmentation reaction Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000033001 locomotion Effects 0.000 description 1
- 108091031326 miR-15b stem-loop Proteins 0.000 description 1
- 238000002493 microarray Methods 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 230000003562 morphometric effect Effects 0.000 description 1
- 238000013425 morphometry Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 230000008010 sperm capacitation Effects 0.000 description 1
- 230000019100 sperm motility Effects 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000035899 viability Effects 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of sperm long non-coding RNA detection method for embryonic development quality evaluation.The RNA in subject's seminal fluid is extracted, carries out reverse transcription reaction, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5 expression is compared with eupyrene sperm sample.The potential of embryonic development can accurately be predicted clinically by the LA16c390E6.5 expression of sperm, and has directive significance to examination of curative effect and supplementary reproduction way choice.
Description
Technical field
The invention belongs to medical detection technology, and in particular to a kind of sperm length for embryonic development quality evaluation is non-
Coding RNA detection method.
Background technology
The quality of embryo quality appraisal procedure is directly connected to the quality of supplementary reproduction Clinical Outcome.At present, in embryo
In tire method for evaluating quality, most widely used is the morphometric evaluation to be scored the morphological feature in gamete embryo each period
Method.Mainly the development by observing embryo is evaluated with indexs such as fragmentations, lacks objective appraisal index.
Document " progress of Spermatozoal total RNAs "（《Canceration distortion mutation》, volume 2011 the 23rd, the 5th phase）Disclose essence
Sub- RNA plays very important effect during the motion of sperm, capacitation, fertilization and embryonic development etc..Spermatozoal total RNAs can be made
To weigh sperm quality, predicting an important indicator of sperm fertilizing ability, meanwhile, it is capable to the development of after fertilization embryo is influenceed,
Early embryonic development is played an important role.
Pass through the technologies such as genetic chip, foreign literature " Human reproduction update "（Human
Reprodtion Update, 2,013 19 (6) 602-24）Report and detected weak sperm by detecting the RNA molecule in sperm
The exception of the sperm morphologies such as disease, teratozoospermia and mobility.The label being currently known such as PRM1, TSSK6, miRNA-Let-
7d etc. differential expression can be used for distinguishing sperm motility exception.Although nearly 3000 RNA can be detected in the transcript of sperm
Molecule, however, there is presently no find reliable gene index by cDNA microarray, if there is single rna molecule can conduct
The index of embryonic development is still unclear, the specific RNA molecule of expression can't be found from Spermatozoal total RNAs and confirms it to embryo
The effect of development.
The content of the invention
The problem of lacking objective evaluation index to embryonic development for existing auxiliary procreation technology, the invention provides one
Sperm long non-coding RNA detection method of the kind for embryonic development quality evaluation.It is non-clinically by the molecular marked compound length of sperm
Coding RNA molecule L A16c390E6.5（Ensembl databases, gene accession number：ENSG00000261641）It can accurately predict
The potential of embryonic development, and have directive significance to examination of curative effect and supplementary reproduction way choice.
In order to realize foregoing invention purpose, the present invention adopts the following technical scheme that：
Sperm long non-coding RNA detection method for embryonic development quality evaluation, it is characterised in that：Extract subject's essence
RNA in liquid, reverse transcription reaction is carried out, obtain template cDNA and carry out real-time fluorescence quantitative PCR, detect long non-coding RNA molecule
LA16c390E6.5 expression is compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID
NO:1。
During real-time fluorescence quantitative PCR, the amplification of target sequence and the detection of fluorescence signal are carried out simultaneously, quantitative
The whole collection fluorescence signal of PCR instrument, experiment terminate post analysis software and deduct autofluorescent background signal by mathematical algorithm automatically and set
Threshold value is so as to obtaining the Ct values of each sample.
Real-time fluorescence quantitative PCR reaction of the present invention uses SYBR Green dye methods.
The primer of real-time fluorescence quantitative PCR reaction of the present invention,
Sense primer is（SEQID NO:2）：CTCAACATCACAGCACAGGG；
Anti-sense primer is（SEQID NO:3）：AGCTGCTTGGCCTCATTTTC.
Above-mentioned primer is the special fluorescence probe for LA16c390E6.5, by the principle of quantitative fluorescent PCR, specifically
Amplify for the long non-coding RNA relative to house-keeping gene（actin）Relative expression quantity.
Preferably, described reverse transcription uses the reverse transcription reagent box of TAKARA companies, article No. RR037A.
The present invention passes through gene expression chip and long non-coding chip（ArrayStar long non-coding Gene Chip systems）,
Filter out the most significant long non-coding RNA molecule of differential expression in the mankind spermatozoon sample of normal fetus and low quality embryo
LA16c390E6.5, and be verified by enlarged sample.Beneficial effect is：
1st, current embryo quality appraisal procedure can not accomplish quantitatively to carry out embryonic development objective evaluation, of the invention
Detection method is started with from the expression quantity of the non-coding RNA of sperm, detects that required sample size is few, and speed is fast, and the time is short, to prediction
The specificity of the potentiality of development of embryo is high, detection method standardization, is easy to clinical expansion.
2nd, unknown cause embryo is caused as prediction present invention firstly provides sperm long non-coding RNA LA16c390E6.5
Stagnate the Testing index of the male sterility patient of development, and further confirmed by clinical sample, be clinical diagnosis and
The not clear embryonic development of reason is treated to stop providing clear and definite foundation.
3rd, can be by controlling for the abnormal male patient of long non-coding RNA LA16c390E6.5 Indexs measures in sperm
Treat with after intervention, being instructed by the change for detecting the index if appropriate for the cycle for doing auxiliary procreation technology.
Brief description of the drawings
Fig. 1 is the long non-coding RNA point that the high and low sperm sample of embryonic development quality detects to obtain respectively through this method
The distribution map of sub- LA16c390E6.5 relative expression quantities.
Wherein, ctl is high embryo quality group, and p is low embryo quality group.
The expression change and point of the survivorship curve of embryo quality that Fig. 2 is sperm long non-coding RNA LA16c390E6.5
Analyse result figure.
Embodiment
The essentiality content of the present invention is described in further detail with reference to embodiment.
Embodiment 1
For the sperm long non-coding RNA detection method of embryonic development quality evaluation, the RNA in subject's seminal fluid is extracted,
Reverse transcription reaction is carried out, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5
Expression compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID NO:1.
Embodiment 2
For the sperm long non-coding RNA detection method of embryonic development quality evaluation, the RNA in subject's seminal fluid is extracted,
Reverse transcription reaction is carried out, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5
Expression compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID NO:1.
Described real-time fluorescence quantitative PCR reaction uses SYBR Green dye methods.
Embodiment 3
For the sperm long non-coding RNA detection method of embryonic development quality evaluation, the RNA in subject's seminal fluid is extracted,
Reverse transcription reaction is carried out, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5
Expression compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID NO:1.
Described real-time fluorescence quantitative PCR reaction uses SYBR Green dye methods.
Embodiment 3
For the sperm long non-coding RNA detection method of embryonic development quality evaluation, the RNA in subject's seminal fluid is extracted,
Reverse transcription reaction is carried out, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5
Expression compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID NO:1.
Described real-time fluorescence quantitative PCR reaction uses SYBR Green dye methods.
The primer of the real-time fluorescence quantitative PCR reaction,
Sense primer is：CTCAACATCACAGCACAGGG；
Anti-sense primer is：AGCTGCTTGGCCTCATTTTC.
Embodiment 4
For the sperm long non-coding RNA detection method of embryonic development quality evaluation, the RNA in subject's seminal fluid is extracted,
Reverse transcription reaction is carried out, template cDNA is obtained and carries out real-time fluorescence quantitative PCR, detection long non-coding RNA molecule L A16c390E6.5
Expression compared with eupyrene sperm sample；The gene order of the LA16c390E6.5 is：SEQID NO:1.
Described real-time fluorescence quantitative PCR reaction uses SYBR Green dye methods.
The primer of the real-time fluorescence quantitative PCR reaction,
Sense primer is：CTCAACATCACAGCACAGGG；
Anti-sense primer is：AGCTGCTTGGCCTCATTTTC.
Described reverse transcription uses the reverse transcription reagent box of TAKARA companies, article No. RR037A.
Specific experiment operation is as follows：
1st, RNA is extracted：3ml semen samples are collected into 15ml centrifuge tubes, add 5mlPBS, 1000g, 5min washing two
It is secondary, supernatant is abandoned, collects precipitation, adds 1ml Trizol Reagent（Life technologies, REF15596026）Extraction
RNA。
2nd, reverse transcription：Reverse transcription system use primer come from PrimeScript RT Reagent kit (TAKARA,
RR037A)。
Reverse transcription reaction system is sequentially prepared by table 1
Table 1
| Reagent | Volume/dosage |
| 5×Prime Script buffer | 2ul |
| PrimeScript RT Enzyme mixI | 0.5ul |
| Oligo dt primer | 0.5ul |
| Random 6 mers | 0.5ul |
| RNA | 500ng |
| RANfree H2O | Up to 10ul |
37 DEG C of reaction 15min, 85 DEG C of reaction 5s, 4 DEG C preserve.
3rd, quantitative fluorescent PCR：Using SYBR Green dye methods detection tested sample and miR-15b in positive reference substance
Expression, the primer of pcr amplification reaction system are LA16c390E6.5 of the present invention specific primer.SYBR Green reagents come from
In life technologies, REF4472897.
PCR reaction systems are prepared by table 2
Table 2
| Reagent | Volume/dosage |
| SYBR Green mix | 5ul |
| RT product | 3ul |
| Primer(forward and reverse) | 2ul |
50 DEG C of reaction 2min,（95 DEG C of reactions 10min, 95 DEG C of reactions 15s, 60 DEG C of reaction 60s）40cycles, inspection
Tested sample and the Ct values of positive reference substance are surveyed, and relative expression quantity is converted into using 2- Ct methods.
Clinical trial
In clinical trial, it is divided into high quality and low quality group, high embryo quality group 12 by the quality of embryonic development（I.e.
Fertile men）, low embryo quality group 14.
Standards of grading of the Embryonic quality score with reference to Gardner in 1999 to blastaea（Gardner DK, Sakkas D.
Assessment of embryo viability: the ability to select a single embryo for
Transfer-a review.Placetna, 2,003 24 (suppl B):S5）.
Embryo quality refers to：Add after essence or after ICSI 66-68 hour cleavage stage embryos observation：A. cleavage stage number is big
In or equal to 8；B. fragment is less than 20%；C. without the blastomere of multinuclear；Add after essence or 106-108 hour blastaeas after ICSI
The observation of phase embryo：A. blister cavities expansion is full of；B. inner cell mass is fine and close, and cell number is more；c:Trophocyte's number is more.
It is then low quality embryo not reach above standard.
The present invention has carried out statistical analysis, the knot of table 3 to the bridegroom's or husband's side seminal parameters of embryo's high quality and low quality group respectively
There were significant differences compared with high quality group for the seminal fluid volume of fruit display low quality group and the average of A level motiles（P<0,001）,
It is one of factor of possible influence embryo quality to illustrate male's asthénospermie.
Table 3：Normal reproduction and the seminal parameters of low quality patient embryo
Further, embryo's high quality and long non-volume in the bridegroom's or husband's side sperm of low quality group are detected respectively by the inventive method
Code RNA molecule LA16c390E6.5 Ct values, and relative expression quantity is converted into using 2- Ct methods.Ct=Ct purposes
Gene（LA16c390E6.5）- Ct reference genes (β-actin).
Fig. 1 shows the expression quantity of the sperm LA16c390E6.5 genes of embryonic development low quality group relative to high quality group
Expression quantity is decreased obviously, and embryonic development index has given confirming by detecting LA16c390E6.5 relative expression quantity.
By the ratio of relative expression quantity, using the average value of high quality group as 1, calculated using ABI-7500 analysis softwares
Go out the relative expression quantity that low quality group is 1 relative to the average value of high quality group, be critical value with relative expression quantity 0.3726, it is low
What it is in the critical value is abnormal expression quantity.
Survivorship curve analysis is carried out using the statistical softwares of Graphpad Prism 5, using critical value（0.3726）Draw life
Curve is deposited, the relative expression quantity of the molecular target that is applied is for predicting the design sketch of embryonic development quality（See Fig. 2）.Draw
The sensitivity and specificity of detection method is respectively 100% and 100%, has good detection efficiency.（Sensitiveness refers to
The subject LA16c390E6.5 relative expression quantities of embryonic development difference are less than the ratio of critical value；Specificity refers to embryonic development just
Normal subject LA16c390E6.5 relative expression quantities are higher than the ratio of critical value.）.
Sequence table
<110>West China No.2 Hospital, Sichuan University
<120>Sperm long non-coding RNA detection method for embryonic development quality evaluation
<130> 2015
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1124
<212> RNA
<213> LA16c390E6.5
<400> 1
tgagaggatt tctttatttc gcgttcagac ccaacacact cggacacctt ggggccctgt 60
gagggctaag cagggtggtg gcgtcagctc ccggggaggc cccactccct ggggaggaaa 120
tacacggcag ggggccgcac ccagcccccc acggagggac ccgtgttgct ctaacaggga 180
cactgaagtt gcctctgccg ccccgtgagg ggcctgtggc ggccccagac ccagcccagc 240
caggccagag gagcctccca ggggccctca ggtggtgagg tgggggcttc ccggccccgg 300
tgcccaccgg cccttctagc tgcctgtgct gggccaggtg tcctctgagg ccggcaggag 360
tctggccccc gctgcacctg cgcttggtgg ctggcagggg cggggtaggg aggtcaccct 420
cgaggccggg gtccccatgt gctaggggaa gacctgcctt cccagccagt gtccacaggg 480
cagcaattcc acgctctgag gctcagggac caaggcaggg ctgggcatgg ggctcagggc 540
cttggaggtt tttctcagct ctcaacatca cagcacaggg cccgtgagtc accccagtcc 600
tctgggcctg tgtacccaag ccggatgcag gccggggagt gcacgtgggg ctcctctgtg 660
gcgccagtgt gaagctgctc tccggggcgg tcgcagcctc caaaccctgg tgctacgagt 720
ccgtgcctca ggcccaggga ccacaggccg tctgctcatg gctgaaaatg aggccaagca 780
gctcccaagt ctcgaagact ccactggtgt ggaggcagag gggcccttcc agggcagggc 840
agccctcggg gcagcagcag gggcaagggc tctgtctcac gcacacgggc acaggcacgc 900
aggtgccggc cctgccgctg gctcccaaga ggccgatagc ccggtaggga ggtcacacac 960
acacagctga tccctggagg taaagaaacc tagacgagga gagtggaggc tgggcctgcg 1020
caaggaggcg ccaagggggg agaccactgc ccacaacagg gtcagtcccg cgagagggtc 1080
agttccgcgc ctgccgcctg cccgcccagc tgcagggtgc tcgc 1124
<210> 2
<211> 20
<212> DNA
<213>Specific forward primer
<400> 2
ctcaacatca cagcacaggg 20
<210> 3
<211> 20
<212> DNA
<213>Specific Down Stream primer
<400> 3
agctgcttgg cctcattttc 20
Claims (4)
1. applications of the sperm long non-coding RNA molecule L A16c390E6.5 in the kit for preparing embryonic development quality evaluation,
It is characterized in that：Sperm long non-coding RNA molecule L A16c390E6.5 is preparing embryonic development quality evaluation as Testing index
Kit in application, the kit include will the RNA reverse transcriptions that be extracted in subject's seminal fluid be template cDNA reversion
Record kit, obtained template cDNA carried out to the PCR reaction systems of real time fluorescent quantitative and for non-with the sperm of detection length
The eupyrene sperm sample that coding RNA molecule L A16c390E6.5 expression is compared；The gene sequence of the LA16c390E6.5
It is classified as：SEQID NO:1.
2. sperm long non-coding RNA molecule L A16c390E6.5 according to claim 1 comments in preparation embryonic development quality
Application in the kit estimated, it is characterised in that：Described real-time fluorescence quantitative PCR reaction uses SYBR Green dye methods.
3. sperm long non-coding RNA molecule L A16c390E6.5 according to claim 1 comments in preparation embryonic development quality
Application in the kit estimated, it is characterised in that：The primer of the real-time fluorescence quantitative PCR reaction,
Sense primer is（SEQID NO:2）：CTCAACATCACAGCACAGGG；
Anti-sense primer is（SEQID NO:3）：AGCTGCTTGGCCTCATTTTC.
4. sperm long non-coding RNA molecule L A16c390E6.5 according to claim 1 comments in preparation embryonic development quality
Application in the kit estimated, it is characterised in that：Described reverse transcription uses the reverse transcription reagent box of TAKARA companies, and article No. is
RR037A。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510220115.6A CN104774965B (en) | 2015-05-04 | 2015-05-04 | Sperm long non-coding RNA detection method for embryonic development quality evaluation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510220115.6A CN104774965B (en) | 2015-05-04 | 2015-05-04 | Sperm long non-coding RNA detection method for embryonic development quality evaluation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104774965A CN104774965A (en) | 2015-07-15 |
| CN104774965B true CN104774965B (en) | 2018-01-05 |
Family
ID=53616729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510220115.6A Expired - Fee Related CN104774965B (en) | 2015-05-04 | 2015-05-04 | Sperm long non-coding RNA detection method for embryonic development quality evaluation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774965B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750106B (en) * | 2018-12-28 | 2022-03-08 | 山东省农业科学院奶牛研究中心 | Long-chain non-coding RNA combination for evaluating bull sperm motility and detection method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498584A (en) * | 2014-12-31 | 2015-04-08 | 云南农业大学 | Fluorescent staining method of evaluating sperm motility of tree shrew |
| CN104498583B (en) * | 2014-12-31 | 2016-06-08 | 云南农业大学 | Fluorescent staining method to domestic mammals evaluating sperm activity |
-
2015
- 2015-05-04 CN CN201510220115.6A patent/CN104774965B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104774965A (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789684B (en) | A kind of kit and application method for embryonic development quality evaluation | |
| CN111778326B (en) | Gene marker combination for endometrial receptivity assessment and application thereof | |
| CN108342482A (en) | A kind of glioblastoma marker and its application, kit | |
| CN109234399B (en) | MiR-532-3p is preparing the application in High Grade Gliomas and intracranial lymphoma diagnosis and differential diagnosis preparation | |
| CN112779327B (en) | Application of marker in preparation of rheumatoid arthritis diagnosis kit or treatment medicine | |
| JP2021171052A (en) | Microrna serum marker, primer set, kit, and their use to identify sex of sturgeon | |
| CN111424085B (en) | Application of tRNA source fragment in preparation of breast cancer diagnostic reagent | |
| CN104774965B (en) | Sperm long non-coding RNA detection method for embryonic development quality evaluation | |
| CN109055520A (en) | A kind of Cynoglossus semilaevis excretion body Sexual differentially expressed label and kit | |
| CN104975082A (en) | Gene group to assess prognosis of lung cancer and application thereof | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN108588218B (en) | Serum miRNA combined minimally invasive detection kit | |
| CN114807124B (en) | Primer and probe composition for detecting ALK fusion gene, kit and method | |
| CN108624690A (en) | A kind of half adenocarcinoma of colon early screening detection kit of left and right and detection method | |
| CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
| CN107988370A (en) | A kind of application of circRNA genes in diagnosing chronic granulocytic leukemia reagent is prepared | |
| WO2022121960A1 (en) | Method for predicting pan-cancer early screening | |
| CN106755330A (en) | Cancer related gene differential expression detection kit and its application | |
| CN109988834B (en) | Application of plasma exosome molecular marker hsa-miR-219a-5p | |
| CN112322748A (en) | GAS5 gene real-time fluorescent quantitative PCR detection kit and application | |
| CN104059987A (en) | Osteosarcoma diagnostic kit and application of CPE (carboxypeptidase E) gene to preparing osteosarcoma diagnostic kit | |
| CN110218795B (en) | Application of miR-766-3p and miR-766-5p in preparation of high-grade glioma and intracranial lymphoma diagnosis and differential diagnosis preparation | |
| CN104131103B (en) | AMZ1 gene is preparing the purposes in diagnostic kit | |
| CN108611417A (en) | A kind of specific expressed collection of illustrative plates and analysis system for Diagnosis of Bladder | |
| CN107475419A (en) | The application of KNDC1 genes and its expression product in oophoroma detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180105 |