CN104761629A - A broadspectrum efficient antimicrobial peptide Pb-CATH-OH1, a gene thereof, a preparing method of the peptide and applications of the peptide - Google Patents

Abstract

A broadspectrum efficient antimicrobial peptide Pb-CATH-OH1, a gene thereof, a preparing method of the peptide and applications of the peptide are disclosed. The antimicrobial peptide Pb-CATH-OH1 is a straight-chain polypeptide. The sequence of the antimicrobial peptide Pb-CATH-OH1 is as follows: lysine-arginine-phenylalanine-lysine-lysine-phenylalanine-phenylalanine-arginine-lysine-isoleucine-lysine-lysine-glycine-phenylalanine-arginine-lysine-isoleucine-phenylalanine-lysine-lysine-threonine-lysine-isoleucine-phenylalanine-isoleucine-glycine-glycine-threonine-isoleucine-proline-isoleucine. A precursor gene comprises 528 nucleotides, and nucleotides from the number 433 site to the number 525 site code the antimicrobial peptide. The antimicrobial peptide is rich in basic amino acids, low in molecular weight, simple in structure, extremely high in broadspectrum antimicrobial activity, low in hemolysis and not liable to generate drug resistance and has activity for gram-positive bacteria, gram-negative bacteria and fungi. The antimicrobial peptide can be used as an additive for preparation of medicines, cosmetics, foods, feed, and the like which are resistant to pathogenic microorganism infection.

Description

A kind of broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1 and gene, preparation method and application

Technical field

The invention provides cathelicidin family broad spectrum antimicrobial peptide Pb-CATH-OH1 and encoding gene thereof that one derives from burmese python (Python molurus bivittatus), aminoacid sequence and its application in the daily use chemicals additives such as makeup, healthcare products, food, feed and anti-infective field of medicaments, belong to field of biomedicine technology.

Background technology:

To be a class hold the mature peptide region of high special to form by N end signal peptide region, middle conservative cathelin structural domain and C to Cathelicidin has multi-functional host's antibacterial peptide family, and constructional feature is: the mature peptide region (12-100 residue) with N end signal peptide region (about 30 residues), middle conservative cathelin structural domain (99-114 residue) and C end high special.Cathelicidin has the anti-microbial activity of wide spectrum, can fast, kill multiple pathogenic microorganisms wide spectrum, comprise gram positive organism, gram-negative bacteria, fungi, parasite and virus etc., particularly to many clinical drug-resistant bacteriums, there is effect equally, which results in the attention of people.In addition, it is active that cathelicidin also has many other biologicals, transcribes, promotes wound healing, induction of vascular generation, induce variation cell line cell apoptosis and lymphocyte activation etc. as having chemotaxis, induction mastocyte threshing and histamine releasing, adjustment scavenger cell to panimmunity cell (neutrophil leucocyte, monocyte, mastocyte and T cell).These advantages make it have good prospect in clinical application.

In recent years due to antibiotic abuse, various resistance and super resistant organism emerge in an endless stream, and cause grave danger to clinical anti-infective therapy, and therefore the research and development of novel resisting pathogenic microbes template are extremely urgent.Cathelicidins has very strong fungicidal activity to many clinical drug-resistant bacteriums, the speed of murdering effect to many pathogenic bacterium will be far longer than the effect of conventional antibiotic, in vitro antimicrobial test, most of Cathelicidin mature peptide can kill microorganism widely fast under the concentration of micromole and sub-micromolar.The most important thing is, due to its special bactericidal mechanism, can not resistance be caused.The sterilization Machine of the Cathelicidins of current discovery is shaped with a lot, commonly by destroying namely being attracted by electrostatic interaction and being attached to electronegative bacterial cell membrane surface of the integrity mediation of bacterial cell membrane, the hole of cross-film is formed further on bacterial cell membrane, cause leaking of bacterial cell contents, thus cause the death of bacterial cell.In addition, antibacterial peptide also has other bactericidal mechanism, as anti-bacteria Cell wall synthesis, changes the synthesis etc. that bacterial cell plasma membrane suppresses barrier film to be formed, activates enzymic activity in autolysin, T suppression cell, suppresses DNA, RNA and protein.Just because of the difference of the mode of action, the germicidal action of Cathelicidin mediation far away faster than conventional antibiotic, and can not produce resistance.

About antimicrobial peptide medicaments, the study hotspot of current cathelicidin mainly concentrates on anti-inflammatory, the aspect such as anti-infective and antimycotic, application mode can be local also can be system, formulation can be oral also can external application.Especially because the expression of cationic antibacterial peptide and dermatitis, invasive are burnt the Correlation between Pathology between wart that pyemia, tumour virus cause etc., the topical therapeutic of these antibacterial peptides to these diseases has good DEVELOPMENT PROSPECT.Have part antimicrobial peptide medicaments to enter clinical experimental stage at present, such as Pexiganan is the analogue of magainin Magainin, and enter clinical experimental stage as treatment foot infection medicine at present, it is also first antibacterial peptide of commercializing; Hlf1-11 is the antibacterial peptide of front 11 amino-acid residues composition of human lactoferrin, by I/II clinical trial phase research show Hlf1-1 by during intravenously administrable be safe, tolerance is good; The IB-367 deriving from pig protegrin is used for the treatment of tumour patient stomatocace, enters phase III clinical trial etc.The application of Cathelicidin is not limited only to field of medicaments, and in agricultural, livestock industry and cosmetics of everyday use field, cathelicidin also exists huge application potential.

2002, the World Health Organization (W H O) issues a public proclamation and points out " in livestock breeding process; stop the in the past usual antibiotic way of fodder additives, by under the prerequisite not endangering animal and peasant benefit, can reduce the threat to human health.Microbiotic is applied in animal productiong as fodder additives, important effect is played to the development of livestock industry, but its residual in animal body with in animal product, and the resistance problems that pathogenic bacteria produces, create negative impact to the health of the mankind and environment.And make China's export meat completely, sea-food etc. are restricted, thus affect income.Find novel, safe antiseptic-germicide and replace microbiotic, become an important content of the outer feed subject of Present Domestic.Antibacterial peptide has the anti-microbial effect of wide spectrum, livestock and poultry is had to the function of growth promotion and disease therapy, is green product that is nontoxic, harmless, noresidue, is expected to become antibiotic substitute, husbandry sector plays an important role.At present in Production of Livestock and Poultry, aquaculture etc. all have should be had.

Burmese python (Python molurus bivittatus), be one of subspecies of Ophidia Boidae Python India boa, huge famous with build, mean lengths is paramount reaches 7 meters, body weight can reach 91 kilograms, is also one of the hugest in the world six kinds of snake classes.Burma's Python, in the native species of south east asia, is a kind of nocturnal habit snake class, occupy in tropical forest more, be more common in the ground such as Guangdong, Guangxi, Fujian, Yunnan, Hainan, Guizhou in China.Also do not report about the investigation and application of burmese python cathelicidin host defense peptide at present.

Summary of the invention

The invention provides a kind of a kind of antimicrobial peptide deriving from burmese python namely under sub-micromolar dosage with very strong antimicrobial acivity, Pb-CATH-OH1 and gene, aminoacid sequence and application.The object of the invention is based on above-mentioned theory research and prior art basis, a kind of burmese python antimicrobial peptide Pb-CATH-OH1 and the application thereof with strong anti-microbial activity are provided, medicine preparation emphatically, the application in makeup, healthcare products, food and novel fodder additive etc.

In order to realize object of the present invention, the invention provides following technical scheme:

Pb-CATH-OH1 is a kind of straight-chain polypeptide of burmese python cathelicidin genes encoding, containing 31 amino-acid residues, molecular weight is 3800.82Da, and theoretical iso-electric point (pI) is 12.33, a kind of basic polypeptide (containing 13 alkaline amino acid residues).

The clone of burmese python antibacterial peptide Pb-CATH-OH1 gene comprises:

Burmese python lung Total RNAs extraction, mRNA purifying, mRNA reverse transcription and cDNA library build, design primer, utilize PCR method to screen burmese python antibacterial peptide Pb-CATH-OH1 gene.5 ' end primer is respectively P1 (5'-ATGATGGAAGGGTGCTTCTGG-3') and another amplimer of P2 (5'-GCTGAACTTCACCATCAAAGAGAC-3'), PCR is CLONTECH company Creator ^tMsMART ^tM3 ' PCR Primer primer in cDNA Library Construction Kit, its sequence is 5 ’ – ATTCTAGAGGCCGAGGCGGCCGACATG – 3 '.Obtain positive monoclonal and carry out gene nucleotide series mensuration.Gene sequencing result shows that the gene of coding burmese python antibacterial peptide Pb-CATH-OH1 precursor cathelicidin is made up of 528 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

Coding burmese python mature peptide Pb-CATH-OH1's is the nucleotide sequence of 433 to 525, and aminoacid sequence of its coding is: Lys ¹-Arg ²-Phe ³-Lys ⁴-Lys ⁵-Phe ⁶-Phe ⁷-Arg ⁸-Lys ⁹-Ile ¹⁰-Lys ¹¹-Lys ¹²-Gly ¹³-Phe ¹⁴-Arg ¹⁵-Lys ¹⁶-Ile ¹⁷-Phe ¹⁸-Lys ¹⁹-Lys ²⁰-Thr ²¹-Lys ²²-Ile ²³-Phe ²⁴-Ile ²⁵-Gly ²⁶-Gly ²⁷-Thr ²⁸-Ile ²⁹-Pro ³⁰-Ile ³¹.

Burmese python antibacterial peptide Pb-CATH-OH1 gene is as the application of preparation burmese python antibacterial peptide Pb-CATH-OH1.

The chemical preparation process of Pb-CATH-OH1:

According to the mature peptide Pb-CATH-OH1 aminoacid sequence that the antimicrobial peptide gene of coding burmese python cathelicidin is inferred, synthesize its complete sequence with automatic Peptide synthesizer (433A, Applied Biosystems).By HPLC reversed phase column chromatography desalting and purifying, and determine that its purity is greater than 97%.Measure its molecular weight with Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF), isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.The Pb-CATH-OH1 antibacterial peptide of synthesis can be dissolved in sterilizing ultrapure water, detects for pharmacologically active.

Beneficial effect of the present invention is:

Gene clone obtains the gene of coding burmese python cathelicidin antimicrobial peptide, obtains mature peptide Pb-CATH-OH1 by chemical synthesis process.This antimicrobial peptide is rich in basic aminoacids, has very strong anti-microbial activity, and antibacterial experiment shows it also has good killing action to various clinical resistant organism.In addition, it also has very low cytotoxicity, and without hemolytic activity, structure is simple, not containing disulfide linkage and ring texture, facilitates chemosynthesis and preparation.

Accompanying drawing explanation

Accompanying drawing is the sterilization kinetics figure of Pb-CATH-OH1 to E.coil ATCC25922.

Embodiment

Describe specific embodiments of the invention in detail below in conjunction with technical scheme, but content of the present invention is not limited thereto.

Strict reference reagent box specification sheets, adopts RNeasy AxyPrep ^tMmultisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) extracts Burma's boa lung tissue total serum IgE, then utilizes Creator ^tMsMART ^tMcDNA Library Construction Kit builds storehouse test kit and builds burmese python lung tissue cDNA library.Utilize PowerScript Reverse Transcriptase reverse transcription synthesis cDNA first chain in test kit, primer is:

Forward SMART IV Oligonucleotide primer:

5'–AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG–3'

Reverse CDS III/3'PCR primer: 5 ’ – ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) ₃₀n _-1n – 3 ' (N=A, C, G, or T; N _-1=A, G, or C).

Utilize Advantage DNA Polymerase to synthesize cDNA second chain, primer is: forward 5' – AAGCAGTGGTATCAACGCAGAGT-3', reverse primer is all CDS III/3'PCR Primer..

Design two specific forward primer (P1, P2) and a reverse non-specific universal primer (CDS III), with burmese python lung cDNA for template, adopt the cDNA of the method amplification cathelicidin of heminested PCR.

Forward P1:5'-ATGATGGAAGGGTGCTTCTGG-3';

Forward P2:5'-GCTGAACTTCACCATCAAAGAGAC-3';

Reverse non-specific universal primer is CDS III/3'PCR Primer, and its sequence is: 5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) ₃₀n _-1n-3 '.

The positive monoclonal that obtains carries out gene nucleotide series mensuration, and pMD19-T Vecter checks order universal primer:

Forward M13F:5'-CGCCAGGGTTTTCCCAGTCACGAC-3';

Reverse M13R:5'-GAGCGGATAACAATTTCACACAGG-3';

Concrete steps are as follows:

The first step, burmese python lung Total RNAs extraction (experiment utensil used and reagent are all through DEPC water treatment below, without RNase):

A. from the various flesh tissue of male burmese python of size in one-year-old age, take off a mung bean size fritter, be put in the cryopreservation tube marked respectively, be placed in rapidly liquid nitrogen and save backup;

B. taken out by the organization material be kept in liquid nitrogen, put into the mortar of precooling, rapidly fully grinding, period constantly adds a little liquid nitrogen in mortar; The powder of organizing of about 30mg is transferred in the 1.5ml centrifuge tube of precooling, add 400 μ l Buffer R-I (lysates wherein respectively, RNA Miniprep Kit provides), repeatedly aspirate 8-10 time with the syringe of 21-25 syringe needle, proceed in 1.5ml centrifuge tube, add 150 μ l Buffer R-II, vortex oscillation 15-30s, 4 DEG C, the centrifugal 5min of 12000rpm;

C. get supernatant to be transferred in new 1.5ml centrifuge tube, add 250ul Virahol, inhale rapidly and play mixing; Mixed solution is transferred in 2ml centrifuge tube respectively and (provides in test kit), 4 DEG C, the centrifugal 1min of 6000rpm; Abandon waste liquid, put get back in 2ml centrifuge tube by preparing pipe, then add 500 μ l Buffer W1A, 4 DEG C, the centrifugal 1min of 12000rpm; Abandon waste liquid, add 700 μ l BufferW2A, 4 DEG C, the centrifugal 1min of 12000rpm; Abandon waste liquid, add 700 μ l Buffer W2A, 4 DEG C, the centrifugal 1min of 12000rpm; Abandon waste liquid, the centrifugal 1min of blank pipe 12000rpm; Be transferred to by centrifugal adsorbing column in new 1.5ml centrifuge tube, then directly to adsorption film dripping 70-100 μ l Buffer TE, room temperature places 1min, and 4 DEG C, 12000rpm is centrifugal, and 1min wash-out obtains total serum IgE;

The structure of second step, burmese python lung tissue cDNA library

The synthesis (mRNA reverse transcription) of the first chain:

A. the following mixed solution of preparation in new 0.2ml PCR pipe (without DNase and RNase):

Mix, of short duration centrifugal; In PCR instrument after 72 DEG C of insulation 2min, then ice bath 2min; Of short duration centrifugal after, in above-mentioned pipe, be formulated as follows inverse transcription reaction liquid:

After mixing, of short duration centrifugal; Following program is completed in PCR instrument:

42 DEG C, 90min; 68 DEG C, 10min; Ice bath termination reaction.CDNA is stored in-80 DEG C.

The synthesis of the second chain:

Flick tube wall, of short duration centrifugal, put into the PCR instrument of preheating in advance, reaction conditions is: 95 DEG C, and 1min, 21cycles (95 DEG C, 15s; 65 DEG C, 30s; 68 DEG C, 6min).Get the product electrophoresis detection analysis of 5 μ l.

3rd step, heminested PCR carry out the gene clone screening of burmese python cathelicidin

The centrifugal 5min of first 12000rpm before primer uses, then adds the ddH of respective volume according to the mole number indicated ₂o is dissolved to the concentration of 20 μMs.The lung tissue cDNA of synthesis dilutes 20 times as template, with P1 and 3'PCR Primer for primer, carries out first time pcr amplification.Following reagent is added in 0.2ml PCR pipe:

After mixing, of short duration centrifugal.PCR condition is: 94 DEG C of sex change 5min; 28 circulations: 94 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C extend 50s; 72 DEG C extend 10min; 4 DEG C of preservations.After reaction terminates, get 5 μ l products in 1% agarose gel electrophoresis testing goal band.

Get step PCR primer 1 μ l ddH ₂o dilutes 100 times as template, with P2 and 3'PCR Primer for primer, carries out second time pcr amplification.Successively following reagent is added in 0.2ml PCR pipe:

PCR condition is: 94 DEG C of sex change 5min; 28 circulations: 94 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C extend 50s; 72 DEG C extend 10min; 4 DEG C of preservations.After reaction terminates, get 5 μ l, 1% agarose gel electrophoresis testing goal band.

The rear glue that increased reclaims test kit (sky root is biological) and carries out the recovery of object fragment.The target DNA fragment reclaimed is connected with sequencing vector pMD19-T Vecter, is transformed into CaCl ₂the DH5 α competent cell that method prepares.Getting 100 μ l transformed bacteria liquid is uniformly coated on the LB nutrient agar flat board containing 100 μ g/ml penbritins (Amp); After surface is dried, be placed in 37 DEG C of constant incubators to be inverted and cultivate 12-16h.Picking list bacterium colony M13 primer PCR detects Insert Fragment size.The positive bacterium colony of picking, shakes bacterium and extracts plasmid, and use Applied Biosystems DNA sequencer, model ABIPRISM 377 carries out nucleotide sequencing.

The gene sequencing of the 4th step, burmese python cathelicidin and result:

The gene of its precursor cathelicidin of encoding is made up of 528 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

The sequence table of the cDNA Nucleotide of burmese python cathelicidin coding region is: sequence length is 528 bases, sequence type: nucleic acid, chain number: strand, topology: straight-chain, sequence kind: cDNA, source: burmese python lung.

Coding burmese python cathelicidin mature peptide Pb-CATH-OH1 is the nucleotide sequence of 433 to 525, and the aminoacid sequence of its coding is: Lys ¹-Arg ²-Phe ³-Lys ⁴-Lys ⁵-Phe ⁶-Phe ⁷-Arg ⁸-Lys ⁹-Ile ¹⁰-Lys ¹¹-Lys ¹²-Gly ¹³-Phe ¹⁴-Arg ¹⁵-Lys ¹⁶-Ile ¹⁷-Phe ¹⁸-Lys ¹⁹-Lys ²⁰-Thr ²¹-Lys ²²-Ile ²³-Phe ²⁴-Ile ²⁵-Gly ²⁶-Gly ²⁷-Thr ²⁸-Ile ²⁹-Pro ³⁰-Ile ³¹.

The chemical preparation process of Pb-CATH-OH1:

I, according to the mature peptide Pb-CATH-OH1 aminoacid sequence that coding burmese python cathelicidin gene is inferred, its complete sequence is synthesized with automatic Peptide synthesizer (Applied Biosystems), by HPLC reversed phase column chromatography desalting and purifying, and determine that its purity is greater than 97%.

II, molecular weight determination adopts Matrix Assisted Laser Desorption ionization time of flight mass spectrometry (MALDI-TOF), and isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.The Pb-CATH-OH1 antibacterial peptide of synthesis can be dissolved in sterilizing ultrapure water, detects for pharmacologically active.

The pharmacological evaluation of burmese python antimicrobial peptide Pb-CATH-OH1:

1.Pb-CATH-OH1 anti-microbial activity detects:

The Pb-CATH-OH1 of chemosynthesis is dissolved in aseptic ultrapure water with the concentration of 2mg/ml; With the microorganism that transfering loop picking newly activates, be then uniformly coated on new LB agar plate; The circular aseptic filter paper sheet of diameter 0.5cm is placed on above-mentioned agar plate, on the scraps of paper, then drips 10 μ l Pb-CATH-OH1 sample solutions; Put into 37 DEG C of constant incubators and cultivate 12-24h; Observe inhibition zone whether to be formed, record to the bacterial strain of Pb-CATH-OH1 sensitivity.

2.Pb-CATH-OH1 is to the mensuration of sensitive strain minimal inhibitory concentration (Minimum Inhibitory Concentration, MIC).

This experiment makes negative control with aseptic LB liquid nutrient medium, observes and has the concentration in bacterial growth hole and the concentration without the hole of bacterial growth, average and be minimal inhibitory concentration.

The microorganism that picking newly activates, is seeded to sterile liquid LB substratum, and in 37 DEG C of constant temperature oscillators, 200rpm cultivates 10-16h to logarithmic phase; Survey the light absorption value at bacterium liquid 600nm place with ultraviolet spectrophotometer, when light absorption value is 1, concentration is approximately 10 ⁹cfu/ml, is diluted to 2 × 10 by bacterium liquid sterile liquid LB substratum ⁵cfu/ml, stand-by on ice; Be the Pb-CATH-OH1 sample solution of 200 μ g/ml, 100 μ g/ml, 50 μ g/ml, 25 μ g/ml, 12.5 μ g/ml, 6.25 μ g/ml, 3.13 μ g/ml, 1.56 μ g/ml, 0.78 μ g/ml, 0.39 μ g/ml, 0.20 μ g/ml by sterile LB medium compound concentration gradient on 96 microwell plates with doubling dilution, every hole 50 μ l; Every hole adds 50 μ l above-mentioned dilution bacterium liquid; In constant temperature oscillator 37 DEG C, 100rpm shaking culture 10-16h; Microplate reader is used to survey 600nm light absorption value or visual inspection; Above-mentioned experiment repeats 3 times.

The minimal inhibitory concentration (MIC) of table 1 Pb-CATH-OH1

* MIC: minimal inhibitory concentration; ND: Bactericidal test detects without bacteriostatic activity; IS: Clinical isolation.Above result is independently repeat laboratory mean values three times.

From table 1, Pb-CATH-OH1 has the anti-microbial activity of wide spectrum to tested microorganism, its MIC value is mostly between 0.62-4.93 μM, and anti-microbial activity is obviously better than the antibiotics ampicillin (MIC value is mostly between 12.62 – 201.9 μMs) that tradition uses.Pb-CATH-OH1 is not only to gram-positive microorganism (G ⁺) and Gram-negative bacteria (G ^-) there is anti-microbial activity, also have anti-microbial activity to all fungies of test, particularly to the pathogenic strains of several frequently seen clinical separation as lung gram bacillus, Pseudomonas aeruginosa, staphylococcus epidermidis and Candida albicans etc. have good germicidal action.Pb-CATH-OH1 is to dysentery bacterium, and Bacillus cereus is the most responsive, and minimal inhibitory concentration is only 0.31 μM.

The sterilization kinetic measurement of 3.Pb-CATH-OH1.

Activated strains: by intestinal bacteria ATCC25922 streak inoculation on LB solid medium flat board, is placed in 37 DEG C of incubators and is inverted and is cultured to single bacterium colony and grows.With transfering loop picking list colony inoculation in LB liquid nutrient medium, 37 DEG C of shaken overnight are cultured to logarithmic phase.With fresh LB liquid nutrient medium, bacterium liquid is diluted to 1 × 10 ⁴the concentration of CFU/ml, for subsequent use.

Pb-CATH-OH1 or meropenem are joined in the bacterium liquid diluted, makes its final concentration be 5 times of MIC (the sterilizing distilled waters of negative control respective volume).The bacterium liquid adding sample is put into rapidly 37 DEG C of shaking culture casees and is cultivated, 100 times are diluted respectively at the LB liquid nutrient medium getting 10 μ l bacterium liquid sterilizings when 0min, 10min, 20min, 30min, 45min, 60min, 90min, 120min and 180min, then the bacterium liquid got after 100ul dilution is coated with LB solid medium, 37 DEG C of incubated overnight, calculate colony number.

From accompanying drawing, Pb-CATH-OH1 sterilization is rapid, just can kill whole intestinal bacteria ATCC25922 cell in 10 minutes; And the effect of positive control meropenem is relatively slow, 120 minutes ability is needed all to kill intestinal bacteria ATCC25922.Meropenem is the wide spectrum carbapenem antibiotic of synthetic, produces anti-microbial effect by the synthesis of anti-bacteria cell walls.Compared with meropenem, Pb-CATH-OH1 rapidly sterilizing ability shows that its mechanism of action can not be the synthesis of anti-bacteria cell walls, also can not be anti-bacteria intracellular nucleic acid, the synthesis of protein or the activity of some proteolytic enzyme of anti-bacteria, because this needs just to cause the death of bacterium certain action time, thus can find out that Pb-CATH-OH1 has the sterilization mechanism of the uniqueness being different from conventional antibiotic, also just because of this puts and not easily causes the generation of thalline resistance, the good antibacterial prospect in medicine of Pb-CATH-OH1 is shown.

The hemolytic activity analysis of 4.Pb-CATH-OH1

Extract 5ml Healthy People venous blood, join and 5ml A Shi liquid (Alsever Solution: Trisodium Citrate 8g is housed, citric acid 0.55g, glucose 20.5g, NaCl 4.2g, adds 1L distilled water, adjusts PH to 6.1, after autoclaving, 4 DEG C save backup) centrifuge tube in, the centrifugal 5min of 1000rpm.With physiological saline (0.9%NaCl) washing to supernatant liquor no longer takes on a red color.

The red corpuscle washed is added normal saline dilution and becomes 10 ⁷-10 ⁸the cell suspension (about the cell of 200 μ l precipitation being joined in the physiological saline of 10ml) of cells/ml concentration, then by the red blood cell suspension diluted be dissolved in the sample of the different concns in physiological saline (in PCR pipe, add the sample of cell suspension that 90 μ l have diluted and 10 μ l different concns) at 37 DEG C of insulation 30min, then the centrifugal 5min of 1000rpm, the supernatant liquor getting 50 μ l, in 96 orifice plates, surveys light absorption value at 540nm place.This experiment simultaneously makes positive control with 1%Triton X-100, makes negative control with physiological saline.Often group does 3 parallel tests, hemolysis rate=(sample 540nm absorbance value-negative control) × 100%/(positive control-negative control).

Experimental result shows, when the concentration of Pb-CATH-OH1 is up to 200 μ g/ml (56.2 μMs), it is only 7.73% to HRBC percent hemolysis, 12.5 μ g/ml (3.29 μMs) in its sterilization MIC dosage range, when 25 μ g/ml (6.58 μMs) and 50 μ g/ml (13.15 μMs), the HRBC percent hemolysis of Pb-CATH-OH1 is respectively 1.93%, 4.45% and 5.49%.These all show that Pb-CATH-OH1 does not have hemolytic activity substantially, and low hemolytic activity is also for its medicament research and development is laid a good foundation.

Claims (5)

1. a broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1, it is characterized in that, described cathelicidin family broad spectrum antimicrobial peptide Pb-CATH-OH1 is straight-chain polypeptide, containing 31 amino-acid residues, theoretical iso-electric point is 12.33, molecular weight is 3800.82Da, its sequence is: Lys-Arg-Phe-Lys-Methionin-phenylalanine-phenylalanine-arginine-lysine-Isoleucine-lysine-LYS-GLY-Phe-A taug-Lys-Ile-Phe-Lys-Methionin-TKI-phenylalanine-Isoleucine-glycine-glycine-Threonine-Ile-Pro-Isoleucine.

2. by the gene of broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1 described in claim 1, it is characterized in that, the gene of coding Pb-CATH-OH1 precursor peptide is made up of 528 Nucleotide, from 5 ' end to 3 ' terminal sequence is:

1 atgatggaag ggtgcttctg gaggatcttg ctggtggctg gggctctttc agcctctggg

61 gctgccgcac tgccacacag accactgacc tatgaggagg ctgtggcttt tggtgtggaa

121 ctctacaaca agaaagcagg ggaggactcc cgatataggc tactggaggc tgtccctcag

181 cctgattggg atcccacttc tgagagcatc caagagctga acttcaccat caaagagacg

241 gtgtgcctgg tccaagaaga acgtgccgag gatgaatgcg acttcaaaga cgacgggctg

301 gtcaaagaat gctccggcta ctatttcttt gacgagacgc caccagtggc agttctcact

361 tgtgaaaccg tggggggaaa tgaggaggag acggaagagg agaaggagga ggagaagcag

421 cccaaacgtg tgaagagatt caagaaattc ttccggaaga tcaagaaagg gtttcgcaaa

481 atcttcaaga aaacgaagat tttcattggt ggcaccattc ccatctaa

The nucleotide sequence of 433 to 525 of encoding mature peptide Pb-CATH-OH1, the aminoacid sequence of its coding is: Lys ¹-Arg ²-Phe ³-Lys ⁴-Lys ⁵-Phe ⁶-Phe ⁷-Arg ⁸-Lys ⁹-Ile ¹⁰-Lys ¹¹-Lys ¹²-Gly ¹³-Phe ¹⁴-Arg ¹⁵-Lys ¹⁶-Ile ¹⁷-Phe ¹⁸-Lys ¹⁹-Lys ²⁰-Thr ²¹-Lys ²²-Ile ²³-Phe ²⁴-Ile ²⁵-Gly ²⁶-Gly ²⁷-Thr ²⁸-Ile ²⁹-Pro ³⁰-Ile ³¹.

3. the preparation method of broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1 according to claim 1, is characterized in that, according to the Pb-CATH-OH1 aminoacid sequence of genes encoding, synthesizes its complete sequence with automatic Peptide synthesizer; By HPLC reversed phase column chromatography desalting and purifying, and determine that its purity is greater than 97%; Its molecular weight is measured with Matrix Assisted Laser Desorption ionization time of flight mass spectrometry; Isoelectric focusing electrophoresis measures iso-electric point, measures amino acid sequence structure with automatic Protein Sequencer.

4. broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1 described in claim 1, has extremely strong broad-spectrum anti-microbial activity, is employed as the additive in daily use chemicals such as preparation resisting pathogenic microbes infection medicine or makeup, healthcare products, food, feed etc.

5. the gene of broad-spectrum high efficacy antimicrobial peptide Pb-CATH-OH1 described in claim 2, the Pb-CATH-OH1 antimicrobial peptide according to its synthesis has very strong antimicrobial acivity, can be dissolved in sterilizing ultrapure water, detect for pharmacologically active.