CN104745686A - Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method - Google Patents
Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method Download PDFInfo
- Publication number
- CN104745686A CN104745686A CN201510034630.5A CN201510034630A CN104745686A CN 104745686 A CN104745686 A CN 104745686A CN 201510034630 A CN201510034630 A CN 201510034630A CN 104745686 A CN104745686 A CN 104745686A
- Authority
- CN
- China
- Prior art keywords
- transgenic
- seq
- strain
- reaction
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primers and method for specific loop-mediated isothermal amplification (LAMP) detection of a genetically modified alfalfa strain J163 and an application of the method. The sequences of the primers are respectively shown in SEQ ID NO.1- SEQ ID NO.6. Aiming at the genetically modified alfalfa strain J163 from the Monsanto company to which the ministry of agriculture of China has not issued a security certificate of genetically modified organisms in agriculture, the specific LAMP rapid detection method of the alfalfa strain J163 is successfully established by designing a group of specific primers in an adjacent zone between a 5' terminal exogenous insert fragment P-eFMV (promoter) of the genetically modified alfalfa strain J163 and alfalfa genome DNA and promoting LAMP with BstDNA polymerase. The detection method is simple to operate, has strong specificity and high sensitivity, has a minimum detection copy number of 10 and can be used for carrying out detection analysis and identification on the components of genetically modified alfalfa J163 rapidly and accurately.
Description
Technical field
The present invention relates to biological technical field, more specifically, the ring mediated isothermal amplification (LAMP) relating to a kind of transgenic alfalfa grass J163 strain specificity detects primer and detection method and application.
Background technology
The transgenic strain of the herbicide-resistant that transgenic alfalfa grass J163 strain is developed by Monsanto Company, within 2005, America & Canada is ratified Environment release and as feed applications, is not also obtained China's GMO bio-safety certificate at present, not yet ratify its import.
Alfalfa is the U.S. the fourth-largest farm crop after corn, wheat, soybean, because its protein content accounts for 17% ~ 20% of total Hay quality, is a kind of fabulous fodder crop compared with other leguminous forages.
Transgenic alfalfa enters the food chain of animal cultivation by feed, causes the goods such as milk, meat to become genetically modified food, may have an impact for the health of people.According to " agriculture GMO bio-safety management rules ", " agriculture genetically modified organism import security evaluation management way ", " agriculture genetically modified organism import security management method " and " agriculture genetically modified organism identity management way ", every genetically modified organism sold within Chinese territory, must identify.Transgenic product mark is needed to the support of detection method.4 kinds of inspection policies can be divided into based on the detection on nucleic acid basis at present: 1) examination method: examination is carried out to universal genetic such as the promotor in the promotor in transgenic product, terminators to transgenic product; 2) gene specific detects: detect the external source goal gene in transgenic product; 3) specific detection is built: the special catenation sequence of external source goal gene and promotor or terminator is detected; 4) strain specificity/transformation event specific detection: exogenous sequences and the special catenation sequence of host genome DNA are detected.
Because promotor, terminator, goal gene can have multiple combination relation, same combination transforms same plant also can produce different transformation event, therefore examination method, gene specific detect and build specific detection and have limitation, can not meet that transgenic product authentication etc. detects completely, the demand of monitoring and security control.And strain specificity/transformation event refers to that certain exogenous gene expression frame (or fragment) is inserted into certain position of host genome and the genetic stability that formed transforms.Therefore transformation event just has uniqueness once generation, and the detection for transformation event can play the effect of identification.At present, domestic transgenic alfalfa grass inspection policies mostly adopts examinations such as detecting promotor, terminator or EPSPS gene to detect thus determines whether transgenic alfalfa grass, but can not distinctive detection be carried out for the transgenic alfalfa grass of different lines, cannot meet that transgenic product authentication etc. detects, the demand of monitoring and security control.
2000, Notomi etc. developed loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification, LAMP), and enzyme carries out isothermal duplication at about 62 DEG C.The method has highly sensitive, and specificity is good, and the reaction times is short, and result of determination facilitates, do not need the advantages such as expensive instrument, is widely used in virus, bacterium, parasitic diagnosis.After having increased, add special dyestuff, by naked eyes result of determination, visual detection can be realized.But for different detected objects, the screening of primer and targetedly amplification and testing conditions are the keys of acquisition highly sensitive, high specific result, and for same detected object, adopt different combination of primers, its detected result also differs greatly.Do not see this crop lines specificity LAMP visual detection method pertinent literature of transgenic alfalfa grass J163 report at present.
Summary of the invention
The technical problem to be solved in the present invention is the deficiency that the examination detection technique adopted for existing transgenic alfalfa grass can not detect concrete transgenic strain exactly, one group of transgenic alfalfa grass J163 strain specificity LAMP detection primer is provided, this group primer has high specific and sensitivity, based on described primer and combination thereof, the present invention successfully can set up transgenic alfalfa grass J163 strain specificity LAMP visual detection method.
Another technical problem that the present invention will solve is to provide transgenic alfalfa grass J163 strain specificity LAMP visual detection method.
A present invention also technical problem that will solve is to provide the application of described detection method.
Above-mentioned purpose of the present invention is achieved by the following technical programs:
The present invention is by creatively analyzing and lot of experiments summary, adjoining region sequence between 5 ' end external source Insert Fragment P-eFMV (promotor) and Alfalfa genomic dna of transgenic alfalfa grass J163 strain, the analysis of binding sequence information, design obtains one group of totally 6 specific primer.And determine accurately detecting step and condition, set up high specificity, highly sensitive transgenic alfalfa grass J163 strain specificity LAMP detection method.
Particularly, one group of transgenic alfalfa grass J163 strain specificity LAMP detection primers F 3, B3 is provided, FIP, BIP, LF and LB, its sequence is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6:
SEQ ID NO.1:F3:5’-CTTCTTTGCCGGGACAAG-3’。
SEQ ID NO.2:B3:5’-CATGTGCTGGAACAGTAGTT-3’。
SEQ ID NO.3:FIP:5’-AATTAGCTTCCACTCGAGCAGGAACTGAAGTGTTCGGTGG-3’。
SEQ ID NO.4:BIP:5’-AAAGCCTCAACAAGGTCAGGGTTCTTCATTGATCTCCTGTAGC-3’。
SEQ ID NO.5:LF:5’-ACCTGCAGAAGCTTGATGG-3’。
SEQ ID NO.6:LB:5’-GAGTCTCCAAACCATTAGCCA-3’。
The present invention provides a kind of transgenic alfalfa grass J163 strain specificity LAMP detection method simultaneously, comprises the following steps:
S1. the template of DNA as reaction is extracted;
S2. adopt described primers F 3, B3, FIP, BIP, LF and LB, carry out LAMP visual detection;
Wherein, the reaction system that LAMP described in S2 detects is 25 μ L:10 × Thermopol buffer2.5 μ L, F3 and B3 each 0.5 μ L (10 μMs), each 0.5 μ L (40 μMs) of each 1 μ L of FIP and BIP (40 μMs), LF and LB, dNTPs4 μ L (10mM), MgSO
41 μ L (100mM), Bst DNA polymerase 1 μ L (8U/ μ L), Template DNA1 μ L and 11.5 μ L ddH
2o.
Preferably, the response procedures detected described in S2 is: 63 DEG C of isothermal reaction 60min, and 85 DEG C of heating 2min make enzyme deactivation, and namely reaction terminates.
Preferably, MgSO in real-time fluorescence PCR detecting reaction system described in S2
4final concentration is 2mM.
The method carrying out judging according to detected result can adopt one of them of following two kinds of methods:
Method one: carry out result judgement according to colour-change: end-body system adds 0.2 μ LSYBR green I, 1min observations to reaction, and positive reaction presents yellow-green colour, and the reaction of feminine gender keeps orange;
Method two: electrophoresis detection judges: the stem-loop structure DNA according to the product of LAMP method amplification being various different lengths, the product of therefore positive reaction detects in trapezoid-shaped strips through 1.5% agarose electrophoresis, and negative reaction does not then have trapezoidal amplified band to occur.
The present invention provides the application of described transgenic alfalfa grass J163 strain specificity LAMP detection method simultaneously, is applied to and differentiates transgenic alfalfa grass J163 strain and other crops.Especially with the detection and identification aspect of Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat, non-transgenic great Ye clover.
Compared with prior art, beneficial effect of the present invention is:
The present invention is according to 5 ' end promotor (P-eFMV) of transgenic alfalfa grass J163 strain and endogenous alfalfa grass genomic dna adjoining region sequence, devise the LAMP detection primer of J163 strain specificity, outer primer F3 and B3 covers region, adjoining region, can realize carrying out strain specificity discriminating to J163.The design of the present invention's screening and the primer of screening, realize adopting LAMP method J163 to be carried out to the qualification of strain specificity first.
The present invention provides one group of totally 6 primer first, and the identification in 6 distinguished sequence districts of this group primer pair adjoining region sequence, ensure that the high degree of specificity that detection method LAMP increases; The ring primer of the present invention's design makes amplification efficiency greatly improve further, consuming time short, can realize the qualification to J163 strain in 1h.Three. amplification system of the present invention adopts specific enzymes to increase all under isothermal conditions, and require low to laboratory apparatus, testing cost is low; By adding ingrain dye(stuff), without the need to by instrument, by naked eyes rapid examination result, being beneficial to on-the-spot clinical sample quick visualization and detecting.
Further, the present invention successfully establishes Alfalfa J163 strain specificity LAMP detection system, simple to operate, detected result is accurate.Shown by the specific test carried out farm crop such as Alfalfa J163, the present invention set up LAMP method only to the detected result of Alfalfa J163 strain for positive; Detecting most low DNA concentration for (1imit of detection, LOD) is 16pg, is equivalent to 10 copy transgenic alfalfas grass J163 genomic dnas.
The transgenic alfalfa grass J163 strain specificity LAMP detection method specificity that the present invention sets up is good, highly sensitive, can carry out detection analysis fast, accurately, stably to transgenic alfalfa grass J163 composition.
Accompanying drawing explanation
Fig. 1 is transgenic alfalfa J163 strain external source Insert Fragment schematic diagram, and A is amplification region.
Fig. 2 is J163 strain specificity LAMP specific test result (electrophoresis detection), wherein 8 is J163, and 1 ~ 6 is Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat, non-transgenic great Ye clover.
Fig. 3 is J163 strain specificity LAMP specific test result (color judgement), wherein 8 is J163, and 1 ~ 6 is Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat, non-transgenic great Ye clover.
Fig. 4 is J163 strain specificity LAMP sensitivity test result (electrophoresis detection), 2 ~ 8 J163 genomic DNA template being respectively 16ng, 1.6ng, 0.16ng, 0.08ng, 0.016ng and 0.008ng.
Fig. 5 is J163 strain specificity LAMP sensitivity test result (color judgement), 1 ~ 6 J163 genomic DNA template being respectively 16ng, 1.6ng, 0.16ng, 0.08ng, 0.016ng and 0.008ng.
Fig. 6 is the J163 strain characteristic LAMP sensitivity test of primer, 1 ~ 6 J163 genomic DNA template being respectively 16ng, 1.6ng, 0.16ng, 0.08ng, 0.016ng and 0.008ng.
Embodiment
The inventive method is further illustrated below in conjunction with the drawings and specific embodiments.Following embodiment and accompanying drawing, only for exemplary illustration, can not be interpreted as limitation of the present invention.Unless stated otherwise, the biomaterial used in following embodiment, reagent raw material for routine is commercial or commercial sources obtain biomaterial and reagent raw material, unless stated otherwise, the method and apparatus that the method and apparatus used in following embodiment uses for this area routine.
Embodiment 1: design primer and screening and LAMP detection system composition
Design primer:
The present invention is analyzed in conjunction with lot of experiments by creative, holds the adjoining region sequence between external source Insert Fragment P-eFMV (promotor) and Alfalfa genomic dna, see shown in accompanying drawing 1A based on 5 ' of transgenic alfalfa grass J163 strain.The analysis of binding sequence information, adopts LAMPdesigner software design to design, obtains a set of specific LAMP primer by screening, sets up high specificity, highly sensitive transgenic alfalfa grass J163 strain specificity LAMP detection method.
Determine described transgenic alfalfa grass J163 strain specificity LAMP detection primers F 3, B3, FIP, BIP, LF and LB, its sequence is respectively as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6:
SEQ ID NO.1:F3:5’-CTTCTTTGCCGGGACAAG-3’。
SEQ ID NO.2:B3:5’-CATGTGCTGGAACAGTAGTT-3’。
SEQ ID NO.3:FIP:5’-AATTAGCTTCCACTCGAGCAGGAACTGAAGTGTTCGGTGG-3’。
SEQ ID NO.4:BIP:5’-AAAGCCTCAACAAGGTCAGGGTTCTTCATTGATCTCCTGTAGC-3’。
SEQ ID NO.5:LF:5’-ACCTGCAGAAGCTTGATGG-3’。
SEQ ID NO.6:LB:5’-GAGTCTCCAAACCATTAGCCA-3’。
Described primer can adopt this area ordinary method synthesis.The primer of the present embodiment application entrusts precious biosynthesizing.It is BIORAD S1000 that LAMP described in the embodiment of the present invention detects the instrument used.
The present embodiment, based on above-mentioned primers F 3, B3, FIP, BIP, LF and LB, provides a kind of transgenic alfalfa grass J163 strain specificity LAMP detection method, comprises the following steps:
S1. the template of DNA as reaction is extracted;
S2. adopt described primers F 3, B3, FIP, BIP, LF and LB, carry out LAMP visual detection;
Wherein, wherein, S1 extracts DNA concrete grammar and is: take the testing sample that about 100mg grinds to form dry powder, uses sky to take root in thing genome DNA extracting reagent kit and extracts genomic dna according to its process specifications.The genomic dna extracted micro-spectrophotometer nanodrop2000c measures concentration.The DNA solution extracted saves backup at-20 DEG C.
In S3 the present embodiment, LAMP system composition is: 10 × Thermopol buffer, F3, B3, FIP, BIP, LF and LB, dNTPs, MgSO
4, Bst DNA polymerase, Template DNA.
The response procedures that LAMP described in S2 detects is: 63 DEG C of isothermal reaction 60min, and 85 DEG C of heating 2min make enzyme deactivation, and namely reaction terminates;
The method carrying out judging according to detected result can adopt one of them of following two kinds of methods:
Method one: carry out result judgement according to colour-change: end-body system adds 0.2 μ LSYBR green I, 1min observations to reaction, and positive reaction presents yellow-green colour, and the reaction of feminine gender keeps orange;
Method two: electrophoresis detection judges: the stem-loop structure DNA according to the product of LAMP method amplification being various different lengths, the product of therefore positive reaction detects in trapezoid-shaped strips through 1.5% agarose electrophoresis, and negative reaction does not then have trapezoidal amplified band to occur.
The choice experiment of embodiment 2:J163 strain specificity LAMP detection system temperature of reaction
The present embodiment, based on SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 primer, comprises the following steps:
S1. the template of DNA as reaction is extracted; Take the testing sample that about 100mg grinds to form dry powder, use sky to take root in thing genome DNA extracting reagent kit and extract genomic dna according to its process specifications.The genomic dna extracted micro-spectrophotometer nanodrop2000c measures concentration.The DNA solution extracted saves backup at-20 DEG C.
S2. adopt described primer SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 to carry out LAMP visual detection, judge according to detected result;
Wherein, LAMP detection reaction system described in S2 is 25 μ L:10 × Thermopol buffer2.5 μ L, F3 and B3 each 0.5 μ L (10 μMs), each 0.5 μ L (40 μMs) of each 1 μ L of FIP and BIP (40 μMs), LF and LB, dNTPs 4 μ L (10mM), MgSO
41 μ L (100mM), Bst DNA polymerase 1 μ L (8U/ μ L), Template DNA1 μ L and 11.5 μ L ddH
2o.
The response procedures detected described in S2 is: adopt 60 DEG C respectively, 61 DEG C, 62 DEG C, 63 DEG C, 64 DEG C, presses isothermal reaction 60min for 65 DEG C, and 85 DEG C of heating 2min make enzyme deactivation, and namely reaction terminates.
Product according to the amplification of LAMP method is the stem-loop structure DNA of various different lengths, and the product of therefore positive reaction detects in trapezoid-shaped strips through 1.5% agarose electrophoresis, gets 3 μ L amplified productions expanding effect when electrophoresis detection result shows 63 DEG C best.
Embodiment 3:J163 strain specificity LAMP detection system Mg
2+the selection of concentration:
The present embodiment, based on SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 primer, comprises the following steps:
S1. the template of DNA as reaction is extracted; Take the testing sample that about 100mg grinds to form dry powder, use sky to take root in thing genome DNA extracting reagent kit and extract genomic dna according to its process specifications.The genomic dna extracted micro-spectrophotometer nanodrop2000c measures concentration.The DNA solution extracted saves backup at-20 DEG C.
S2. adopt described primer SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 to carry out LAMP visual detection, judge according to detected result;
Wherein, LAMP detection reaction system described in S2 is 25 μ L:10 × Thermopol buffer (1 ×), each 10 μMs of F3 and B3, each 40 μMs of FIP and BIP, each 40 μMs of LF and LB, dNTPs 10mM, MgSO
4, Bst DNA polymerase 8U/ μ L, Template DNA1 μ L, surplus ddH
2o supplies.Wherein MgSO
4final concentration is adopted to be 1,2,4,6 and 8mM respectively.
The response procedures detected described in S2 is: by 63 DEG C of isothermal reaction 60min, and 85 DEG C of heating 2min make enzyme deactivation, and namely reaction terminates.
According to the stem-loop structure DNA that the product of LAMP method amplification is various different lengths, the product of therefore positive reaction detects in trapezoid-shaped strips through 1.5% agarose electrophoresis.Get 3 μ L amplified productions without trapezoidal shape band when electrophoresis detection result display 1,2mM, 4,6 and 8mM difference not obvious, therefore MgSO in system
4select 4mM concentration.
Embodiment 4: the specific test of the inventive method
The present invention adopts multiple kinds of crops to carry out specificity experiments, below with 8 kinds of farm crop, comprise transgenic alfalfa grass J163 strain, Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat, the detection and identification aspect of non-transgenic great Ye clover (all stores from after conventional random sampling, therefore do not limit the scope of the invention) genomic dna be template, the transgenic alfalfa J163 strain specificity LAMP detection method adopting the present invention to set up carries out amplified reaction, detect the specificity of the method that the present invention sets up.Observe amplified production to add after SYBR green I color with or without flavescence after green or electrophoresis with or without specificity ladder-tape or.Experimental result is shown in shown in accompanying drawing 2 and Fig. 3.Experimental result shows, have and only have J163 to have specificity ladder-tape to produce, other are without amplified band; Add SYBR green I have yellow-green colour change (in Fig. 3 sequence number be 8 for yellow-green colour), other kinds be brown (in Fig. 3 sequence number be 1 ~ 7 for brown).Show that the LAMP detection method specificity of the J163 strain specificity that the present invention sets up is good.
Embodiment 5: detection system sensitivity test of the present invention
It is 200ng/ μ L that J163 genomic dna initial template concentration records its concentration through ND2000C micro-spectrophotometer.After TE dilution, LAMP detection is carried out to the J163 genomic DNA template of 16ng/ μ L, 1.6ng/ μ L, 0.16ng/ μ L, 0.08ng/ μ L, 0.016ng/ μ L and 0.008ng/ μ L, when being template to be more than or equal to 0.016ng/ μ L (16pg/ μ L) genomic dna, amplification after product has characteristic ladder-tape through electrophoresis, adds SYBR green I and has yellow-green colour generation.And during with the J163 genomic DNA template of 0.008ng/ μ L, then without above-mentioned reaction result.Show that the lowest detection that this LAMP system can detect J163 genomic dna is limited to 0.016ng (16pg/ μ L), due to Alfalfa genomic dna be estimated as 1510Mbp, accordingly, weight is approximately estimated as 1.6pg (arumuganthan, K, 1991) 10 J163 genomic dnas copied then can be detected.Amplification is shown in shown in accompanying drawing 4 and Fig. 5 (in Fig. 5 sequence number be 1 ~ 5 be yellow-green colour, sequence number be 6 for brown).
Embodiment 6: comparative example
Adjoining region between 5 ' end external source Insert Fragment P-eFMV (promotor) and Alfalfa genomic dna of transgenic alfalfa grass J163 strain also obtains another when carrying out design of primers and organizes primers F 3-2, B3-2, FIP (F1c+F2)-2, BIP (B1c+B2)-2, LoopF-2, LoopB-2, and its sequence is respectively as shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12::
F3-2：CTCATGGATTTGTAGTTGAG
B3-2：GCTGGAATTAGCAAGATAAG
FIP(F1c+F2)-2：ATCGATGCGGCCACCACTGACTTGCCAATTGATTGACAAC
BIP(B1c+B2)-2：CCCATTTGGACGTGAATGTAGATTAATGCATACGATCCGTCG
LoopF-2：GGCTGCAGGTCGATTGAT
LoopB-2：CACGTCGAAATAAAGATTTCCG
It is 200ng/ μ L that J163 genomic dna initial template concentration records its concentration through ND2000C micro-spectrophotometer.After TE dilution, LAMP detection is carried out to the J163 genomic DNA template of 16ng/ μ L, 1.6ng/ μ L, 0.16ng/ μ L, 0.08ng/ μ L, 0.016ng/ μ L and 0.008ng/ μ L, the sensitivity of this group primer is minimum only can detect 0.08ng, lower than the primer that the present invention selects.Detected result as shown in Figure 6 (in Fig. 6 sequence number be 1 ~ 4 for yellow-green colour, sequence number be 5 ~ 6 for brown).
SEQUENCE LISTING
Huangpu Entry-Exit Inspection and Quarantine Bureau of the <110> People's Republic of China (PRC)
<120> transgenic alfalfa grass J163 strain specificity ring mediated isothermal amplification detection primer and detection method and application
<130>
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> primers F 3
<400> 1
cttctttgcc gggacaag 18
<210> 2
<211> 20
<212> DNA
<213> primer B3
<400> 2
catgtgctgg aacagtagtt 20
<210> 3
<211> 40
<212> DNA
<213> primers F IP
<400> 3
aattagcttc cactcgagca ggaactgaag tgttcggtgg 40
<210> 4
<211> 43
<212> DNA
<213> primer BIP
<400> 4
aaagcctcaa caaggtcagg gttcttcatt gatctcctgt agc 43
<210> 5
<211> 19
<212> DNA
<213> primer LF
<400> 5
acctgcagaa gcttgatgg 19
<210> 6
<211> 20
<212> DNA
<213> primer LB
<400> 6
gagtctccaa accattagcc 20
<210> 7
<211> 22
<212> DNA
<213> primers F 3-2
<400> 7
tggatgccca tatcatatca ag 22
<210> 8
<211> 20
<212> DNA
<213> primer B3-2
<400> 8
catgtgctgg aacagtagtt 20
<210> 9
<211> 42
<212> DNA
<213> primers F IP (F1c+F2)-2
<400> 9
aggacctgca gaagcttgat ggacaaaggt catccaaact ga 42
<210> 10
<211> 43
<212> DNA
<213> primer BIP (B1c+B2)-2
<400> 10
aaagcctcaa caaggtcagg gttcttcatt gatctcctgt agc 43
<210> 11
<211> 20
<212> DNA
<213> primer LoopF-2
<400> 11
atcagagtgt cgtttcccac 20
<210> 12
<211> 21
<212> DNA
<213> primer LoopB-2
<400> 12
gagtctccaa accattagcc a 21
Claims (7)
1. group transgenic alfalfa grass J163 strain specificity ring mediated isothermal amplification detection primer, it is characterized in that, described primer is F3, B3, FIP, BIP, LF and LB, and the sequence of described primer is respectively as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6.
2. described in claim 1, transgenic alfalfa grass J163 strain specificity ring mediated isothermal amplification detection primer is differentiating the application in transgenic alfalfa grass J163 strain and other crops.
3. application according to claim 2, it is characterized in that, other crops described are Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat or non-transgenic great Ye clover.
4. a transgenic alfalfa grass J163 strain specificity loop-mediated isothermal amplification detection method, is characterized in that, comprise the following steps:
S1. the template of DNA as reaction is extracted;
S2. adopt primers F 3, B3, FIP, BIP, LF and LB described in claim 1 to carry out LAMP detection, judge according to detected result;
Wherein, the reaction system that ring mediated isothermal amplification described in S2 detects is 25 μ L:10 × Thermopol buffer2.5 μ L, each 0.5 μ L of the B3 of F3 and 10 μM of 10 μMs, each 1 μ L of the BIP of FIP and 40 μM of 40 μMs, each 0.5 μ L of the LB of LF and 40 μM, the dNTPs4 μ L of 10 mM, the MgSO of 100 mM of 40 μMs
4bst DNA polymerase 1 μ L, the Template DNA1 μ L of 1 μ L, 8 U/ μ L and 11.5 μ L ddH
2o;
The response procedures detected described in S2 is 63 DEG C of isothermal reaction 60min, and 85 DEG C of heating 2min make enzyme deactivation, and namely reaction terminates;
According to the method that detected result carries out judging be:
Method one: carry out result judgement according to colour-change: end-body system adds 0.2 μ LSYBR green I, 1min observations to reaction, and positive reaction presents yellow-green colour, and the reaction of feminine gender keeps orange;
Or, method two: electrophoresis detection judges: detect through 1.5% agarose electrophoresis, the product of positive reaction is trapezoid-shaped strips, and negative reaction does not have trapezoidal amplified band to occur.
5. transgenic alfalfa grass J163 strain specificity loop-mediated isothermal amplification detection method according to claim 4, is characterized in that, MgSO in ring mediated isothermal amplification detection reaction system described in S2
4final concentration is 2mM.
6. the application of transgenic alfalfa grass J163 strain specificity loop-mediated isothermal amplification detection method described in claim 4, is characterized in that being applied to and differentiates transgenic alfalfa grass J163 strain and other crops.
7. application according to claim 6, it is characterized in that, other crops described are Transgenic corn lines MIR162, Transgenic corn lines 89034, Transgenic corn lines BT11, genetically modified rice cry IA (a/b), non-transgenic Semen Brassicae campestris, non-transgenic wheat or non-transgenic great Ye clover.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510034630.5A CN104745686B (en) | 2015-01-23 | 2015-01-23 | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510034630.5A CN104745686B (en) | 2015-01-23 | 2015-01-23 | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745686A true CN104745686A (en) | 2015-07-01 |
| CN104745686B CN104745686B (en) | 2017-02-22 |
Family
ID=53585936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510034630.5A Active CN104745686B (en) | 2015-01-23 | 2015-01-23 | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745686B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114657275A (en) * | 2022-03-04 | 2022-06-24 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic alfalfa |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013003558A1 (en) * | 2011-06-30 | 2013-01-03 | Monsanto Technology Llc | Alfalfa plant and seed corresponding to transgenic event kk 179-2 and methods for detection thereof |
| CN103763916A (en) * | 2011-02-11 | 2014-04-30 | 孟山都技术公司 | Pesticidal nucleic acids and proteins and uses thereof |
| WO2014153254A2 (en) * | 2013-03-14 | 2014-09-25 | Pioneer Hi-Bred International Inc. | Compositions and methods to control insect pests |
-
2015
- 2015-01-23 CN CN201510034630.5A patent/CN104745686B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103763916A (en) * | 2011-02-11 | 2014-04-30 | 孟山都技术公司 | Pesticidal nucleic acids and proteins and uses thereof |
| WO2013003558A1 (en) * | 2011-06-30 | 2013-01-03 | Monsanto Technology Llc | Alfalfa plant and seed corresponding to transgenic event kk 179-2 and methods for detection thereof |
| CN103857798A (en) * | 2011-06-30 | 2014-06-11 | 孟山都技术公司 | Alfalfa plant and seed corresponding to transgenic event KK179-2 and methods for detection thereof |
| WO2014153254A2 (en) * | 2013-03-14 | 2014-09-25 | Pioneer Hi-Bred International Inc. | Compositions and methods to control insect pests |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114657275A (en) * | 2022-03-04 | 2022-06-24 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic alfalfa |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745686B (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108796036B (en) | Nucleic acid detection method based on prokaryotic Argonaute protein and application thereof | |
| CA2692633A1 (en) | Method for the simultaneous detection of multiple nucleic acid sequences in a sample | |
| WO2017120309A1 (en) | Comparative locus amplification for determining copy number | |
| CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
| KR101934548B1 (en) | Method for Multiplex Analysis of Cylindrocarpon destructans and Fusarium solani Using Real-time PCR | |
| CN110592268A (en) | RAA constant temperature fluorescence detection method and reagent for lake luo virus (TiLV) | |
| JP6600831B2 (en) | Oligonucleotide for food pest detection | |
| CN104745686B (en) | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J163 and application of method | |
| CN111850155A (en) | Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection | |
| KR101538343B1 (en) | Method and kit for identifying place of origin of deer antlers using dual labeled LNA probe and fluorescence melting curve analysis | |
| CN1932037B (en) | Method of screening transgenic wheat | |
| CN106676166B (en) | Detection reagent and detection method for accurately identifying oat components | |
| CN110894550A (en) | RAA constant temperature fluorescence detection method and reagent for eel Herpes Virus (HVA) | |
| CN101016554A (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN104498593A (en) | Primer pair and kit for identification or assisted identification of stored bean weevils | |
| CN106755557A (en) | A kind of transgenic wheat and the detection method of cotton | |
| CN109468392B (en) | Real-time fluorescence PCR detection method for Ericerus citriodora, and primer and probe for detection | |
| CN104745685A (en) | Primers and method for specific loop-mediated isothermal amplification (LAMP) detection of genetically modified alfalfa strain J101 and application of method | |
| CN104673886A (en) | Primer and probe for real-time fluorescent PCR detection of transgenic alfalfa J163 strains and detection method and applications thereof | |
| JP7091237B2 (en) | Detection method of genetically modified crops | |
| CN101020903A (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application | |
| CN104372098A (en) | Primer for genetically modified alfalfa J163 strain specificity qualitative PCR (Polymerase Chain Reaction) detection and genetically modified alfalfa J163 strain specificity qualitative PCR detection method | |
| JP6421295B2 (en) | Mushroom identification method and identification kit | |
| CN103834746B (en) | The isothermal duplication primer of one group of rapid detection ox, sheep Akabane Disease virus and application thereof | |
| KR101533582B1 (en) | Development of RsAROM gene-specific real time PCR and its use for quantification of rice sheath blight |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 510730 Guangzhou economic and Technological Development Zone, Guangdong Road, No. 17 Patentee after: Complex art service centre of Huangpu Entry-Exit Inspection and Quarantine Bureau Address before: 510730 Guangzhou Development Zone, Guangdong Road, No. 17 Patentee before: HUANGPU ENTRY-EXIT INSPECTION AND QUARANINE |