CN104744573A - Liquid-phase-chip detection kit for detecting blue-eared pig disease virus - Google Patents
Liquid-phase-chip detection kit for detecting blue-eared pig disease virus Download PDFInfo
- Publication number
- CN104744573A CN104744573A CN201510140002.5A CN201510140002A CN104744573A CN 104744573 A CN104744573 A CN 104744573A CN 201510140002 A CN201510140002 A CN 201510140002A CN 104744573 A CN104744573 A CN 104744573A
- Authority
- CN
- China
- Prior art keywords
- virus
- liquid
- detection kit
- pet28a
- chip detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a liquid-phase-chip detection kit for detecting the blue-eared pig disease virus. The virus can be detected by the liquid-phase-chip detection kit when the concentration of the virus is up to 101TCID50. No cross reaction occurs among the blue-eared pig disease virus and the swine epidemic encephalitis virus, the porcine tiny virus, the swine fever virus, the type-2 porcine circovirus virus, the pig brain myocarditis virus, the pig pseudo rabies virus and the pig polio virus. The invention also discloses an antigen standard. The working concentration of the antigen standard is 2 mu g/L.
Description
Technical field
The invention belongs to inspection and quarantine field, being specifically related to the liquid-phase chip detection kit for detecting PRRS virus.
Background technology
Pig blue-ear disease is the hyperinfection disease caused by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV), is one of main epidemic disease of planting pig breeding dysfunction at present.Main manifestations is infected pigs's heating, apocleisis; pregnant sow late abortion, premature labor, product stillborn foetus, weak tire and mummy tire; various age pig (particularly piglet) dyspnoea; also can cause immunosuppression and cause multiple other diseases; also be cause respiratory diseases in pigs complex body (porcine respiratory disease complex simultaneously; PRDC) one of important pathogen body, produces to the pig of mass-producing in China and even world wide and brings huge threat.
Differ greatly because the clinical symptom of this disease and anatomy and pathology change, lack distinctive pathological change, therefore quite difficult in clinical diagnosis, usually carry out comprehensive diagnos according to the diagnosis of Clinical symptoms Binding experiment room, mainly comprise Detection of antigen and serodiagnosis.Because the wide-scale distribution of PRRSV causes huge financial loss to world's pig industry, this disease has caused the great attention of various countries.Therefore, develop a kind of high specificity, novel detection method that is highly sensitive, simple, that be applicable to batch operation will have important practical significance.
Liquid-phase chip, also referred to as microsphere suspending chip (Suspension Array, liquid chip), is based on xMAP(flexible Multi-Analyte Profiling) the Novel biological chip technology platform of technology.This technology grows up the mid-90 in 20th century, be called the chip technology of genome times afterwards comprehensively, it is the new bio molecule high throughput testing technology that collecting type technology, fluorescent microsphere, laser, digital signal processing and conventional chemical techniques are integrated, it is the association reaction carrying out Ag-Ab, enzyme-substrate, ligand-receptor on the microballoon that difference is fluorescence-encoded, detects microballoon coding respectively and reporter fluorescence reaches the object of quantitative and qualitative analysis by red, green two bundle laser.The advantage of this technology is that detection flux is large, speed is fast, highly sensitive, flexible operation, sample consumption are few, sensing range wide, high specificity, accuracy are high, reproducible, expense is low.
In view of some drawbacks that harm and this viral methods of existing detection of PRRS virus remain, the present invention utilizes immunological technique and liquid-phase chip technology to combine the liquid-phase chip detection kit of development for detecting PRRS virus.In brief, adopt monoclonal antibody technology of preparing to prepare PRRS virus monoclonal antibody, and with carboxylated No. 21 microballoon couplings, obtain and catch monoclonal antibody-microballoon; Adopt how anti-technology of preparing to prepare rabbit source PRRS virus polyclonal antibody, obtain detection through biotinylation and resist more; Recombinant DNA technology is adopted to prepare PRRS virus 3 antigen protein couplet MNM, as examination criteria product.
Summary of the invention
The object of this invention is to provide a kind of liquid-phase chip detection kit for detecting PRRS virus.
A kind of recombinant protein gene, its nucleotide sequence is as shown in sequence table SEQ ID NO.5.
A kind of recombinant protein, it is the albumen of the genetic expression shown in sequence table SEQ ID NO.5.
A kind of expression recombinant protein plasmid, it is the total serum IgE with PRRSV, and the cDNA that reverse transcription becomes is template;
1) with primer:
PM1:5'
AAGCTTATGGGGTCGTCTCTAGA 3'
PM2:5'
CTCGAGTTTGGCATATTTGACA 3'
Amplification, inserts in pMD18T;
2) with primer:
PMN2-1:5'
GGATCCATGGGGTCGTCTCTAGA 3'
PMN2-2:5'
GAATTCTGCTGAGGGTGATGCT 3'
Amplification, inserts in pET28a;
3) by 1), 2) plasmid that obtains, to cut with Xho I enzyme with Hind III respectively and adopt T4DNA ligase enzyme to be connected.
A kind of recombinant protein detects the application in PRRS virus detection kit in preparation.
For detecting the liquid-phase chip detection kit of PRRS virus, the albumen that its antigen standard is the genetic expression shown in sequence table SEQ ID NO.5;
The working concentration of described antigen standard is 2 μ g/mL.
The invention provides the liquid-phase chip detection kit for detecting PRRS virus, the concentration of virus reaches 10
1tCID
50in time, still can be detected, PRRS virus, epidemic encephalitis b of swine virus, pig parvoviral, Pestivirus suis, porcine circovirus 2 type, porcine encephalomyocarditis virus, PRV (Pseudorabies virus), porcine enteroviruses no cross reaction, high specificity, present invention also offers antigen standard, its working concentration is 2 μ g/mL.
Accompanying drawing explanation
Fig. 1 cytogamy;
The detected result of Fig. 2 purified polyclonal antibodies;
The best effort concentration of Fig. 3 monoclonal antibody coupling microballoon;
Fig. 4 test kit sensitivity technique result;
Fig. 5 test kit specific detection result; Wherein: 1-3 PRRS virus virus; 5-6 epidemic encephalitis b of swine virus; 7-9 pig parvoviral (PPV); 10-12 Pestivirus suis (CSFV); 13-15 porcine circovirus 2 type (PCV2); 16-18 porcine encephalomyocarditis virus (EMCV); 19-21 PRV (Pseudorabies virus); 22-24 porcine enteroviruses.
Accompanying drawing 6 test kit repeatability detected result.
Embodiment
the preparation of embodiment 1 PRRS virus monoclonal antibody
(1) cultivation of PRRSV and immunogenic preparation
The recovery of Marc-145 cell routine is cultivated, and after Marc-145 cell grows up to individual layer, by the PRRSV virus (preservation of this laboratory) after purifying, is diluted to 100 TCID
50after, get 1mL and be inoculated on Marc-145 cell monolayer, routine propagation anti-virus operation, observation of cell pathology (CPE) day by day under inverted microscope, occur about 80% draw in the net, results virus after the cytopathy such as cavity, bunching.When receiving poison Tissue Culture Flask put fast-70 DEG C and 37 DEG C of multigelations three times, in 4 DEG C of centrifugal 30min of 5000r/min, collect supernatant liquor (containing PRRSV), with the formalin-inactivated virus 36h of 0.1%, adopt differential centrifugation purified virus, by the virus liquid after deactivation in 15000r/min, 4 DEG C of centrifugal 20min, discard precipitation, get ultracentrifugal supernatant liquor in 4 DEG C, 30000r/min ultracentrifugation 1h, supernatant discarded, suspend with appropriate PBS damping fluid and precipitate, then carry out 2 differential centrifugations, finally use appropriate PBS by resolution of precipitate.4 DEG C, the centrifugal 20min of 5000r/min, gets the virus liquid that supernatant is purifying.
Get the virus of purifying, the cracking of ultrasonic grinding instrument, under 260nm and 280nm, absorbancy is measured with U2010 ultraviolet spectrophotometer, calculate its protein concentration, the Freund's complete adjuvant of 150 μ g/ml and equivalent is diluted to or Freund's incomplete adjuvant is mixed and made into emulsion with PBS, put 4 DEG C and place 3d, if it is not stratified to be creamy white, namely can be used as immunogen.
(2) mouse immune and serum titer detect
Select 4-6 female Balb/c mouse 5 in age in week, carry out head with the Freund's complete adjuvant vaccine of above-mentioned preparation to exempt from, two to exempt from, three vaccines of exempting to use Freund's incomplete adjuvant to prepare carry out immunization, be immune to for the last time to merge and strengthen for first 3 days, concrete immune programme for children sees attached list 1.
Cut tail blood sampling before each immunity, separation of serum also detects the immune antibody level of mouse with indirect ELISA method.Through groping, in indirect ELISA method, the anti-extent of dilution of sheep anti mouse Ig bis-that the antigen coated concentration of PRRSV is 8.75 μ g/mL, standard positive serum extent of dilution is 1:3200, confining liquid is 1%BSA, HRP mark is 1:15000, concrete operation step is by published conventional indirect elisa method operation, and the volume of often kind of reagent is 100 μ L/ holes.After third time immunity, during mice serum antibody titer > 1:12800, be used for cytogamy experiment.
(3) cytogamy
The SP2/0 myeloma cell and 10 being in logarithmic phase is obtained according to published conventional SP2/0 myeloma cell and mouse peritoneal feeder cell technology of preparing
6the feeder cell of/mL.
Get the splenocyte 1.0 × 10 of mice serum antibody titer > 1:12800 respectively
7individual and 2.0 × 10
6the suspension of individual myeloma cell, merges and joins in a 50mL glass centrifugal bottle, mix gently.The centrifugal 10min of 1500r/min, abandons supernatant liquor.Bottom finger attack centrifugal bottle, make the cell uniform loose of centrifugation, every 10min once, after continuous 3 times, draw 1mL and slowly instill in centrifuge tube through 45% PEG of 37 DEG C of pre-temperature, drip off in 1min.Jog leaves core barrel 30s, make cell fully with PEG effect, then standing 90-120s.After leaving standstill, in 1min, add 1mL HAT nutrient solution, in 2min, add 2mL HAT nutrient solution, in 3min, add 3mL HAT nutrient solution, then add 10mL HAT nutrient solution, stop the effect of PEG.Fused cell after termination reaction, with the centrifugal 10min of 1500r/min, abandons supernatant.Add HAT nutrient solution to 40 mL, it is previously prepared good containing 10 to join by the amount in 100 μ L/ holes
5in 96 well culture plates of individual feeder cell, put 37 DEG C, 5% CO
2cultivate in constant incubator, do not move in 5 days, within the 5th day, change liquid and under inverted microscope observation of cell form, see accompanying drawing 1.Get the aforementioned indirect elisa method of cell conditioned medium to detect, specific antibody positive cell is carried out enlarged culturing.
(4) screening of positive fused cell and amplification
Be positive clone after testing, blow afloat, mix, and be diluted to 1 cell/100 μ L with 1640 substratum containing 20% serum, mixing drops to 96 porocyte culture plates, is placed in 37 DEG C, 5%CO
2cultivate in constant incubator.Every hole only contains 1 cell, to form mono-clonal.Utilize aforementioned indirect ELISA method, detect subclone, the cell of continuous release positive antibody carries out enlarged culturing.After 2-3 subclone operation, filter out the antibody OD of 4B7 and 3H2 two strain cells and supernatant
450value progressively raises.Wherein, the OD of 4B7 tri-time cloning
450value is respectively 0.867,0.899,1.325; The OD of 3H2 tri-time cloning
450value is respectively 0.729,0.986,1.217, in table 2.
(5) preparation of high-titer monoclonal antibody
For 4B7 cell strain, adopt in regular growth extracorporeal culture-ing and body and induce ascites legal system for high-titer monoclonal antibody.
Viral dilution after concentrated and purified with PEG is carried out indirect ELISA detection by concentration bag by 96 hole enzyme plates to best bag, measures the antibody titer of the cells and supernatant after 3 time clonings and ascites, with the monoclonal antibody OD of parallel dilution
450value/contrast OD
450the most highly diluted multiple that value ratio is greater than 2 is tiring of monoclonal antibody.Hybridoma cell line 4B7 cells and supernatant is tired as 1:6400, and titer of ascites is 1:25600, in table 3.
(6) monoclonal antibody subgroup identification
Adopt the monoclonal antibody type identification test kit of Sigma company, operate to specifications and monoclonal antibody subclass is identified.Result shows, the monoclonal antibody secreted by hybridoma cell line 4B7 belongs to IgG
2asubclass, in table 4.
(7) monoclonal antibody specificity detects
Monoclonal antibody prepared by conventional indirect ELISA method detected result finds and pseudorabies virus, Porcine circovirus desease, pig parvoviral, Pestivirus suis, epidemic encephalitis b of swine virus etc. have no cross reaction.Show that this strain monoclonal antibody is the specific monoclonal antibody for PRRSV, table 5.
the preparation of embodiment 2 PRRS virus biotinylated polyclonal antibody
(1) cultivation of PRRSV and immunogenic preparation
The concentration of specific operation process and purified virus is with embodiment 1(1) described in.
(2) new zealand white rabbit immunity and serum titer detect
Select healthy new zealand white rabbit, female, body weight (2 ± 0.2) kg, carry out head with the Freund's complete adjuvant vaccine of above-mentioned preparation to exempt from, two to exempt from, three vaccines exempting from all to use Freund's incomplete adjuvant to prepare carry out immunization, be immune to Culling heart blood for the last time to carry out for first 3 days, concrete immune programme for children is in table 6.
Ear edge vein exploitating blood before each immunity, separation of serum also detects the immune antibody level of mouse with indirect ELISA method.Through groping, in indirect ELISA method, the anti-extent of dilution of sheep anti mouse Ig bis-that the antigen coated concentration of PRRSV is 17.5 μ g/mL, standard positive serum extent of dilution is 1:1600, confining liquid is 2%BSA, HRP mark is 1:20000, concrete operation step is by published conventional indirect elisa method operation, and the volume of often kind of reagent is 100 μ L/ holes.After 4th immunity, rabbit anteserum antibody titer is 1:25600, now carries out the purifying of antibody.
(3) purifying of polyclonal antibody
Adopt published conventional n-caprylic acid-ammonium sulfate precipitation method slightly to extract, then adopt protein purification instrument to combine affinity purification post protein G-protein purification column, illustratively operation is further purified.Antibody after purifying is through conventional 12% SDS-PAGE electrophoresis detection, and the antibody after result display purifying has two bands more clearly between 46KD-58KD, 17KD-25KD, and be respectively heavy chain, light chain specific band, IgG molecular weight is about 160KD, sees accompanying drawing 2.
(4) biotin labeling polyclonal antibody
1. biotin labeling reaction
Get 200 μ L Anti-TNF-αs liquid solution (concentration 50.58mg/mL), add 1mL PBS, add the biotin solution 136 μ L that concentration is 4.4mg/mL after mixing, room temperature reaction 1h.
2. horizontal checkout is marked
Reagent prepares: add 10mgAvidin and 100ul 10mM HABA in 100mM PBS, HABA/Avidin solution(1.94mL PBS).
In 96 orifice-plate microporosities, add 180 μ L HABA/Avidin, measure A
500, be recorded as A
500HABA/Avidin; Add 20 μ L biotinylated proteins, mixing, reading measures A after balancing 15 seconds
500, be recorded as A
500HABA/Avidin/biotin.
3. calculate
Concentration/the molecular weight of albumen of biotinylated protein substance withdrawl syndrome=biotinylated protein mixed solution
Absorbancy changing value △ A
500=A
500HABA/Avidin-A
500HABA/Avidin/biotin
Biotin concentration Mm/ml=△ A in biotin labeling sample
500/ 34000/0.5
Vitamin H mole number in the amount=sample of the amount/proteic substance of biotin substance/albumen mole number=△ A
500/ 34000/0.5/ biotinylated protein substance withdrawl syndrome.
Test result shows, A
500HABA/Avidin=0.5637, A
500HABA/Avidin/Biotin-sample=0.4314.Be that each how anti-molecule can mark 2.54 biotin molecules according to above-mentioned calculating publicity known vitamin H average marker level.
the foundation of embodiment 3 liquid-phase chip detection method
(1) coupling of monoclonal antibody and microballoon and the determination of best effort concentration
1. get microballoon room temperature and recover 30min, then with whirlpool oscillator concussion microsphere suspensions 20s, microballoon is mixed; Get microballoon stoste 50 μ L(1.25 × 10
3individual), transfer in 1.5ml centrifuge tube, the centrifugal 2min of 14000 × g, precipitation carboxyl microballoon, supernatant discarded.
2. add 80 μ L activation buffer (the biphosphate sodium salt of 100mmol/L, pH6.2) and clean microballoon twice, with the centrifugal 2min of whirlpool oscillator vibration 20s, 14000 × g, precipitation carboxyl microballoon; Supernatant discarded, then use the resuspended microballoon of 80 μ l activation buffer, whirlpool concussion 20s, ultrasonic cleaning 10min, until see equally distributed microballoon.
3. add 10 μ L, 50mg/mL NHS(activation buffer dilute), to vibrate lightly mixing with whirlpool oscillator; Add 10 μ L, 50mg/mL EDC(activation buffer dilute), vibrate gently with whirlpool oscillator; Room temperature lucifuge hatches 20min, gently shakes every 10min whirlpool oscillator, after continuous 3-5 time, and the centrifugal 2min of 14000 × g, the carboxyl microballoon of precipitation activation.
4. remove supernatant, add 500 μ L coupling buffer cleaning microballoons twice, the centrifugal 2min of whirlpool oscillator vibration 20s, 14000 × g; Supernatant discarded, resuspended microballoon, in 100 μ L coupling buffers, shakes 20s with oscillator, microballoon is mixed.
5. with coupling buffer, monoclonal antibody is diluted to the solution that concentration is respectively 25 μ g/mL, 50 μ g/mL, 100 μ g/mL, 150 μ g/mL, 200 μ g/mL and 250 μ g/mL; 500 μ L monoclonal antibody diluents are added, whirlpool concussion 20s mixing in the microballoon that above-mentioned activation is good; Room temperature lucifuge reaction 2h, gently shakes every 30min whirlpool oscillator, after continuous 3-5 time, and the centrifugal 2min of 14000 × g, supernatant discarded; Add 500 μ L washing lotion cleaning microballoons twice, the centrifugal 2min of whirlpool concussion 20s, 14000 × g, supernatant discarded; Make microballoon Eddy diffusion close in stop buffer in 125 μ L, whirlpool concussion mixing, namely obtains the couplet that virus catches monoclonal antibody and microballoon.
6. 50 μ Lbiotin – sheep anti-mouse igg (1:15000) are added respectively in the centrifuge tube containing different concns monoclonal antibody and microballoon coupling, get 1 μ L(1 000) microballoon of different concns that coupling is good adds in centrifuge tube, whirlpool concussion 20s, 37 DEG C of lucifuge reaction 30min; Add 100 μ L wash liquid, the centrifugal 2min of whirlpool concussion 20s, 14000 × g, supernatant discarded; Add the SA-PE of 20 μ L, whirlpool concussion 20s, 37 DEG C of lucifuge reaction 30min; Add 100 μ L wash liquid, the centrifugal 2min of whirlpool concussion 20s, 14000 × g, abandons supernatant; Add 100 μ L washing lotions again, whirlpool concussion mixing, detects with Luminex-100.
Result shows, Mean Fluorescence (MFI) increases, when monoclonal antibody concentration is that 100 μ g/mL reach maximum along with the increase of monoclonal antibody concentration, MFI value tends to balance gradually, see accompanying drawing 3, illustrate that microsphere surface can reach capacity by binding site when monoclonal antibody concentration reaches 100 μ g/mL.
(2) biotinylated polyclonal antibody best effort concentration, SA-PE best effort concentration, and the determination of each component reaction top condition
According to each influence factor of reaction system, design orthogonal test, determines optimum reaction condition.
Overall operation process: get 1 μ L(about 1000) microballoon that coupling is good is placed in centrifuge tube, adds virus antigen liquid 50 μ L(about 280 μ g), whirlpool concussion 20s, 37 DEG C of lucifuges reaction different times; Add 100 μ LPBS to wash, the centrifugal 2min of whirlpool concussion 20s, 14000 × g, supernatant discarded; Biotin labeled polyclonal antibody PBS damping fluid is made into the solution of different concns, gets 50 μ L respectively as in centrifuge tube, whirlpool concussion 20s, 37 DEG C of lucifuge reaction different times; Repeat step washing, add the SA-PE 20 μ L of different concns, whirlpool concussion 20s, 37 DEG C of lucifuge reaction different times; Repeat step washing, abandon supernatant, then add 100 μ L PBS, whirlpool concussion mixing, detects with Luminex – 100.
The reaction system finally determined and condition are: the how anti-best effort concentration of biotin labeling is 0.75 μ g/ μ L, the best effort concentration of SA-PE is 10 μ g/mL, microballoon and antigen-reactive time are 1h, and anti-more than biotin labeled is 30min with the SA-PE reaction times.
the preparation of embodiment 4 examination criteria product
(1) recombinant antigen protein is as the design of examination criteria product
In conjunction with the restriction enzyme site on pET28a expression vector, and the gene order of PRRS virus main protection antigen albumen M and N, the arrangement mode of design 5 kinds of recombinant proteins: i.e. M, N, M-N, N-M-N, M-N-M.
(2) clone of PRRS virus M, N, MN gene
According to PRRS virus M, N protein gene order (AY262352.1) that GenBank logs in, designed, designed primer, is synthesized by the raw work in Shanghai.Primer sequence is as follows:
M gene primer
Upstream (PM1): 5'
aAGCTTaTGGGGTCGTCTCTAGA 3'(is containing Hind III restriction enzyme site)
Downstream (PM2): 5'
cTCGAGtTTGGCATATTTGACA 3'(is containing Xho I restriction enzyme site)
N gene primer
Upstream (PN1): 5'AAA
gGATCCaTGCCAAATAACAACGG 3'(is containing BamH I restriction enzyme site)
Downstream (PN2): 5'ACC
gAATTCtGCTGAGGGTGAT 3'(is containing EcoR I restriction enzyme site)
MN gene primer (1)
Upstream (PMN1-1): 5'CA
aAGCTTaTGGGGTCGTCTCTAGA 3'(is containing Hind III restriction enzyme site)
Downstream (PMN1-2): 5'
cTCGAGtGCTGAGGGTGATGCTGT 3'(is containing Xho I restriction enzyme site)
MN gene primer (2)
Upstream (PMN2-1): 5'
gGATCCaTGGGGTCGTCTCTAGA 3'(is containing BamH I restriction enzyme site)
Downstream (PMN2-2): 5'
gAATTCtGCTGAGGGTGATGCT 3'(is containing EcoR I restriction enzyme site)
Trizol method extracts PRRS virus total serum IgE, and reverse transcription becomes cDNA, as template, Standard PCR technology increases M gene, N gene, MN1, MN2 gene respectively, and link with pMD18T cloning vector, build pMD18T-M, pMD18T-N, pMD18T-MN1, pMD18T-MN2, transform
e.colithe laggard row filter qualification of JM109.
(2) the construction and expression product purification of pET28a-M, pET28a-N, pET28a-MN, pET28a-NMN, pET28a-MNM expression vector
In view of four restriction enzyme sites above-mentioned in pET28a expression vector are followed successively by the 3 ' order of holding by 5 ' end: BamH I, EcoR I, Hind III, Xho I.Therefore, constituted NMN type recombinant protein by N gene and MN1 gene, constituted MNM type recombinant protein by MN2 gene and M gene.
The structure of pET28a-M, pET28a-N, pET28a-MN expression vector: pMD18T-M, pMD18T-N, pMD18T-MN(pMD18T-MN1 or pMD18T-MN2 by above-mentioned structure) to coli expression carrier pET28a respectively with after corresponding restriction enzymes double zyme cutting, test kit reclaims goal gene M, N, MN and pET28a carrier large fragment, adopt T4DNA ligase enzyme to connect, obtain recombinant expression vector pET28a-M, pET28a-N, pET28a-MN(pET28a-MN1 or pET28a-MN2 respectively).
The structure of pET28a-NMN expression vector.PET28a-N and the pMD18T-MN1 of above-mentioned structure is used respectively Hind III and Xho I restriction enzymes double zyme cutting, test kit reclaims MN1 gene and pET28a-N carrier large fragment, adopt T4DNA ligase enzyme to connect, obtain recombinant expression vector pET28a-NMN.
The structure of pET28a-MNM expression vector.PET28a-MN2 and the pMD18T-M of above-mentioned structure is used respectively Hind III and Xho I restriction enzymes double zyme cutting, test kit reclaims M gene and pET28a-MN2 carrier large fragment, adopt T4DNA ligase enzyme to connect, obtain recombinant expression vector pET28a-MNM.
PET28a-M, pET28a-N, pET28a-MN, pET28a-NMN, pET28a-MNM of above-mentioned structure are transformed respectively
e.colibL21, after amoxicillin screening positive strain, adopt conventional SDS-PAGE and Western-blot to detect, result shows, have successfully been obtained Recombinant Swine reproductive and respiratory syndrome virus surface protein M, N, MN, NMN, MNM.Its base sequence is followed successively by sequence table SEQ ID NO.1,2,3,4,5.
Due to pET28a carrier containing 6X His label, conventional affinity purification technology is therefore adopted to carry out purifying to recombinant protein M, N, MN, NMN, MNM.Namely recombinant protein after purifying can be used as in test kit the standard substance detecting PRRS virus.
the composition of embodiment 5 standard substance and the determination of working concentration
The recombinant M protein of purifying, recombinant N protein, restructuring MN albumen, restructuring NMN albumen, restructuring MNM albumen are diluted the working fluid (0.5 μ g/mL, 1 μ g/mL, 2 μ g/mL, 2.5 μ g/mL, 3.0 μ g/mL, 3.5 μ g/mL, 4.0 μ g/mL, 4.5 μ g/mL, 5.0 μ g/mL) of different concns gradient with PBS, with 10
1tCID
50virus liquid does positive control, according to the reaction system described in embodiment 3 and reaction conditions, adopts Luminex – 100 to detect.Result shows, working concentration is the restructuring MNM albumen and 10 of 2 μ g/mL
1tCID
50the fluorescent value (MFI) of virus liquid is without significant difference, and the recombinant M protein of same concentrations, recombinant N protein, restructuring MN albumen, restructuring NMN albumen have no obvious MFI.Illustrate that the restructuring MNM albumen of 2 μ g/mL can be used as the standard substance of this test kit, for the positive control that reality detects.
embodiment 6 test kit Performance Detection
(1) sensitivity technique
It is 10 that pure viral solution PBS damping fluid is made into concentration
8tCID
50, 10
7tCID
50, 10
6tCID
50, 10
5tCID
50, 10
4tCID
50, 10
3tCID
50, 10
2tCID
50, 10
1tCID
50get 50 μ L respectively and be placed in centrifuge tube; According to the reaction system described in embodiment 3 and reaction conditions, show after Luminex – 100 detects, fluorescent value (MFI) reduces, when the concentration of virus reaches 10 along with the reduction of virus liquid concentration
1tCID
50in time, still can be detected, and sees accompanying drawing 4, illustrates that the sensitivity of present method is higher.
(2) specific detection
By the liquid-phase chip detection method set up, specific cross test is carried out to known PRRS virus, epidemic encephalitis b of swine virus, pig parvoviral, Pestivirus suis, porcine circovirus 2 type, porcine encephalomyocarditis virus, PRV (Pseudorabies virus), porcine enteroviruses etc., establish the positive, blank simultaneously.Detected result shows, PRRS virus detected result is positive, and other Viral diagnosis results are all feminine gender, see accompanying drawing 5, illustrate that present method has good specificity to PRRS virus, with other viral no cross reaction.
(3) repeatability detects
By set up liquid-phase chip detection method, to 10
5tCID
50, 10
4tCID
50, 10
3tCID
50the PRRS virus solution of 3 concentration detects, and 3 repetitions established by each sample, and 1d, 7d, 15d respectively at test carry out duplicate detection, and detected result fluctuates without significant difference, sees accompanying drawing 6, present method repeatability is described better.
<110> Jilin bureau of Emigration and Ingression Examination and Quaratine
<120> is for detecting the liquid-phase chip detection kit of PRRS virus
<160> 1
<210> 1
<211> 522
<212> DNA
<213> is artificial
<400> 1
M gene order:
atggggtcgt ctctagacga cttttgccat gatagcacgg ctccacaaaa ggtgcttttg 60
gcgttttcca ttacctatac gccagtgatg atatatgctc taaaggtaag tcgcggccga 120
ctgctagggc ttctgcacct tttgatcttc ctgaactgtg cttttacctt cgggtacatg 180
acattcgtgc actttcagag cacaaatagg gtcgcgctca ctatgggggc agtagttgca 240
cttctctggg gggtgtactc agccatagaa acctggaaat tcatcacctc cagatgccgt 300
ttgtgcttgc taggccgcaa gtacattctg gcccctgccc accacgtcga aagtgccgcg 360
ggctttcatc cgattgcggc aaatgataac cacgcatttg tcgtccggcg tcccggctcc 420
actacggtta acggcatatt ggtgcccggg ttgaaaagcc tcgtgttggg tggcagaaaa 480
gctgttaaac agggagtggt aaaccttgtc aaatatgcca aa 522
<210> 2
<211> 369
<212> DNA
<213> is artificial
<400> 2
N gene order:
atgccaaata acaacggcaa gcagcaaaag agaaagaagg gggacggcca gccagtcaat 60
cagctgtgcc agatgttggg taagatcatc gcccaacaaa accagtccag aggcaaggga 120
ccggggaaga aaaataataa gagaagcccg gagaagcccc attttcctct agcgactgaa 180
gaagatgtca ggcaccactt cacccctagt gagcggcaat tgtgtctgtc gtcgatccag 240
actgccttta accagggcgc cgggacatgt tccctgtcag attcagggag gataagttac 300
gctgtggagt ttagtttgcc gacgcatcat actgtgcgcc tgatccgcgt cacagcatca 360
ccctcagca 369
<210> 3
<211> 883
<212> DNA
<213> is artificial
<400> 3
MN gene order:
atggggtcgt ctctagacga cttttgccat gatagcacgg ctccacaaaa ggtgcttttg 60
gcgttttcca ttacctatac gccagtgatg atatatgctc taaaggtaag tcgcggccga 120
ctgctagggc ttctgcacct tttgatcttc ctgaactgtg cttttacctt cgggtacatg 180
acattcgtgc actttcagag cacaaatagg gtcgcgctca ctatgggggc agtagttgca 240
cttctctggg gggtgtactc agccatagaa acctggaaat tcatcacctc cagatgccgt 300
ttgtgcttgc taggccgcaa gtacattctg gcccctgccc accacgtcga aagtgccgcg 360
ggctttcatc cgattgcggc aaatgataac cacgcatttg tcgtccggcg tcccggctcc 420
actacggtta acggcatatt ggtgcccggg ttgaaaagcc tcgtgttggg tggcagaaaa 480
gctgttaaac agggagtggt aaaccttgtc aaatatgcca aataacaacg gcaagcagca 540
aaagagaaag aagggggacg gccagccagt caatcagctg tgccagatgt tgggtaagat 600
catcgcccaa caaaaccagt ccagaggcaa gggaccgggg aagaaaaata ataagagaag 660
cccggagaag ccccattttc ctctagcgac tgaagaagat gtcaggcacc acttcacccc 720
tagtgagcgg caattgtgtc tgtcgtcgat ccagactgcc tttaaccagg gcgccgggac 780
atgttccctg tcagattcag ggaggataag ttacgctgtg gagtttagtt tgccgacgca 840
tcatactgtg cgcctgatcc gcgtcacagc atcaccctca gca 883
<210> 4
<211> 1276
<212> DNA
<213> is artificial
<400> 4
atgccaaata acaacggcaa gcagcaaaag agaaagaagg gggacggcca gccagtcaat 60
cagctgtgcc agatgttggg taagatcatc gcccaacaaa accagtccag aggcaaggga 120
ccggggaaga aaaataataa gagaagcccg gagaagcccc attttcctct agcgactgaa 180
gaagatgtca ggcaccactt cacccctagt gagcggcaat tgtgtctgtc gtcgatccag 240
actgccttta accagggcgc cgggacatgt tccctgtcag attcagggag gataagttac 300
gctgtggagt ttagtttgcc gacgcatcat actgtgcgcc tgatccgcgt cacagcatca 360
ccctcagcag aattcgagct cgtcgacaag cctatggggt cgtctctaga cgacttttgc 420
catgatagca cggctccaca aaaggtgctt ttggcgtttt ccattaccta tacgccagtg 480
atgatatatg ctctaaaggt aagtcgcggc cgactgctag ggcttctgca ccttttgatc 540
ttcctgaact gtgcttttac cttcgggtac atgacattcg tgcactttca gagcacaaat 600
agggtcgcgc tcactatggg ggcagtagtt gcacttctct ggggggtgta ctcagccata 660
gaaacctgga aattcatcac ctccagatgc cgtttgtgct tgctaggccg caagtacatt 720
ctggcccctg cccaccacgt cgaaagtgcc gcgggctttc atccgattgc ggcaaatgat 780
aaccacgcat ttgtcgtccg gcgtcccggc tccactacgg ttaacggcat attggtgccc 840
gggttgaaaa gcctcgtgtt gggtggcaga aaagctgtta aacagggagt ggtaaacctt 900
gtcaaatatg ccaaataaca acggcaagca gcaaaagaga aagaaggggg acggccagcc 960
agtcaatcag ctgtgccaga tgttgggtaa gatcatcgcc caacaaaacc agtccagagg 1020
caagggaccg gggaagaaaa ataataagag aagcccggag aagccccatt ttcctctagc 1080
gactgaagaa gatgtcaggc accacttcac ccctagtgag cggcaattgt gtctgtcgtc 1140
gatccagact gcctttaacc agggcgccgg gacatgttcc ctgtcagatt cagggaggat 1200
aagttacgct gtggagttta gtttgccgac gcatcatact gtgcgcctga tccgcgtcac 1260
agcatcaccc tcagca 1276
<210> 5
<211> 1276
<212> DNA
<213> is artificial
<400> 5
atggggtcgt ctctagacga cttttgccat gatagcacgg ctccacaaaa ggtgcttttg 60
gcgttttcca ttacctatac gccagtgatg atatatgctc taaaggtaag tcgcggccga 120
ctgctagggc ttctgcacct tttgatcttc ctgaactgtg cttttacctt cgggtacatg 180
acattcgtgc actttcagag cacaaatagg gtcgcgctca ctatgggggc agtagttgca 240
cttctctggg gggtgtactc agccatagaa acctggaaat tcatcacctc cagatgccgt 300
ttgtgcttgc taggccgcaa gtacattctg gcccctgccc accacgtcga aagtgccgcg 360
ggctttcatc cgattgcggc aaatgataac cacgcatttg tcgtccggcg tcccggctcc 420
actacggtta acggcatatt ggtgcccggg ttgaaaagcc tcgtgttggg tggcagaaaa 480
gctgttaaac agggagtggt aaaccttgtc aaatatgcca aataacaacg gcaagcagca 540
aaagagaaag aagggggacg gccagccagt caatcagctg tgccagatgt tgggtaagat 600
catcgcccaa caaaaccagt ccagaggcaa gggaccgggg aagaaaaata ataagagaag660
cccggagaag ccccattttc ctctagcgac tgaagaagat gtcaggcacc acttcacccc 720
tagtgagcgg caattgtgtc tgtcgtcgat ccagactgcc tttaaccagg gcgccgggac 780
atgttccctg tcagattcag ggaggataag ttacgctgtg gagtttagtt tgccgacgca 840
tcatactgtg cgcctgatcc gcgtcacagc atcaccctca gcagaattcg agctcgtcga 900
caagcctatg gggtcgtctc tagacgactt ttgccatgat agcacggctc cacaaaaggt 960
gcttttggcg ttttccatta cctatacgcc agtgatgata tatgctctaa aggtaagtcg 1020
cggccgactg ctagggcttc tgcacctttt gatcttcctg aactgtgctt ttaccttcgg 1080
gtacatgaca ttcgtgcact ttcagagcac aaatagggtc gcgctcacta tgggggcagt 1140
agttgcactt ctctgggggg tgtactcagc catagaaacc tggaaattca tcacctccag 1200
atgccgtttg tgcttgctag gccgcaagta cattctggcc cctgcccacc acgtcgaaag 1260
tgccgcgggc tttcatccga ttgcggcaaa tgataaccac gcatttgtcg tccggcgtcc 1320
cggctccact acggttaacg gcatattggt gcccgggttg aaaagcctcg tgttgggtgg 1380
cagaaaagct gttaaacagg gagtggtaaa ccttgtcaaa tatgccaaa 1429
Claims (6)
1. a recombinant protein gene, its nucleotide sequence is as shown in sequence table SEQ ID NO.5.
2. a recombinant protein, it is the albumen of the genetic expression shown in sequence table SEQ ID NO.5.
3. express a recombinant protein plasmid, it is the total serum IgE with PRRSV, and the cDNA that reverse transcription becomes is template;
1) with primer:
PM1:5'
aAGCTTaTGGGGTCGTCTCTAGA 3'(is containing Hind III restriction enzyme site)
PM2:5'
cTCGAGtTTGGCATATTTGACA 3'(is containing Xho I restriction enzyme site)
Amplification, inserts in pMD18T;
2) with primer:
PMN2-1:5'
gGATCCaTGGGGTCGTCTCTAGA 3'(is containing BamH I restriction enzyme site)
PMN2-2:5'
gAATTCtGCTGAGGGTGATGCT 3'(is containing EcoR I restriction enzyme site)
Amplification, product inserts in pET28a;
3) by 1), 2) plasmid that obtains, cut with Hind III and Xho I enzyme respectively, adopt T4DNA ligase enzyme to connect.
4. the application of recombinant protein in preparation detection PRRS virus detection kit.
5. for detecting the liquid-phase chip detection kit of PRRS virus, the albumen that its antigen standard is the genetic expression shown in sequence table SEQ ID NO.5.
6. the liquid-phase chip detection kit for detecting PRRS virus according to claim 5, is characterized in that: the working concentration of described antigen standard is 2 μ g/mL.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510140002.5A CN104744573B (en) | 2015-03-27 | 2015-03-27 | Liquid chip detection kit for detecting porcine reproductive and respiratory syndrome virus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510140002.5A CN104744573B (en) | 2015-03-27 | 2015-03-27 | Liquid chip detection kit for detecting porcine reproductive and respiratory syndrome virus |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104744573A true CN104744573A (en) | 2015-07-01 |
CN104744573B CN104744573B (en) | 2020-05-29 |
Family
ID=53584895
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510140002.5A Expired - Fee Related CN104744573B (en) | 2015-03-27 | 2015-03-27 | Liquid chip detection kit for detecting porcine reproductive and respiratory syndrome virus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104744573B (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102373181A (en) * | 2010-08-09 | 2012-03-14 | 中山大学 | Swine influenza virus-porcine reproductive and respiratory syndrome virus mixed virus-like particle, and its preparation method and use |
CN204008662U (en) * | 2014-04-24 | 2014-12-10 | 北京维德维康生物技术有限公司 | Detect the ELISA kit of PRRS virus antibody |
CN104330572A (en) * | 2014-10-27 | 2015-02-04 | 苏州市吴江区畜牧兽医站 | Kit for indirect ELISA (Enzyme-Linked Immunosorbent Assay) detection of IgG or IgA antibodies of PRRSV (Porcine reproductive and respiratory syndrome virus) of pigs |
-
2015
- 2015-03-27 CN CN201510140002.5A patent/CN104744573B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102373181A (en) * | 2010-08-09 | 2012-03-14 | 中山大学 | Swine influenza virus-porcine reproductive and respiratory syndrome virus mixed virus-like particle, and its preparation method and use |
CN204008662U (en) * | 2014-04-24 | 2014-12-10 | 北京维德维康生物技术有限公司 | Detect the ELISA kit of PRRS virus antibody |
CN104330572A (en) * | 2014-10-27 | 2015-02-04 | 苏州市吴江区畜牧兽医站 | Kit for indirect ELISA (Enzyme-Linked Immunosorbent Assay) detection of IgG or IgA antibodies of PRRSV (Porcine reproductive and respiratory syndrome virus) of pigs |
Non-Patent Citations (2)
Title |
---|
GAO,Z.Q.等: "PRRSV HB2(sh)/2002, complete genome", 《GENBANK》 * |
马蓉 等: "大肠杆菌多基因共表达策略", 《中国生物工程杂志》 * |
Also Published As
Publication number | Publication date |
---|---|
CN104744573B (en) | 2020-05-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110964102B (en) | Monoclonal antibody capable of simultaneously combining with canine, feline and mink parvoviruses, variable region sequence thereof, hybridoma cell strain and application | |
Fan et al. | Development of a novel double antibody sandwich quantitative enzyme-linked immunosorbent assay for detection of porcine epidemic diarrhea virus antigen | |
CN112979789B (en) | Blocking ELISA kit for detecting neutralizing antibody of infectious bovine rhinotracheitis virus and application thereof | |
CN107037212B (en) | Porcine circovirus 2 type antigen immue quantitative detection reagent box | |
CN104725490A (en) | Porcine circovirus 2 type ELISA antibody detection kit | |
CN103308688A (en) | ELISA (Enzyme-Linked Immunosorbent Assay) detection kit for porcine circovirus type 2 IgM antibody and preparation method of ELISA detection kit | |
CN112899239A (en) | Hybridoma cell strain of monoclonal antibody for resisting swine delta coronavirus N protein epitope, antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
CN107312088B (en) | Porcine epidemic diarrhea virus specificity SIgA ELISA detection kit and application thereof | |
CN114230660B (en) | Monoclonal antibody for resisting micropterus salmoides iridovirus LMBV and application thereof | |
CN113461808B (en) | Competitive ELISA antibody detection kit for infectious bovine rhinotracheitis virus and application thereof | |
CN108918869B (en) | Application of fiber2 protein and recombinant protein thereof in detecting serum type 4 avian adenovirus antibody | |
CN109182248A (en) | A kind of antibody against swine fever virus detection ELISA diagnostic kit | |
CN110484510B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
CN104745604B (en) | Pig parvoviral liquid-phase chip detection kit | |
CN105543177A (en) | Hybridoma cell strain secreting citrus yellow vein clearing virus-resistant monoclonal antibodies and monoclonal antibody application thereof | |
CN104744573A (en) | Liquid-phase-chip detection kit for detecting blue-eared pig disease virus | |
CN109799342A (en) | A kind of O-shaped antibodies against foot-and-mouth disease virus competitive ELISA detection kit | |
CN106198974A (en) | The ELISA detection kit of IHNV antibody in a kind of quick detection rainbow trout serum | |
CN110607282B (en) | Bovine parvovirus monoclonal antibody and application thereof in detecting bovine parvovirus infection | |
CN110484511B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
CN109212205B (en) | Pseudorabies virus gC protein antibody, kit containing antibody and application | |
CN111289751A (en) | Goose astrovirus Capsid protein antigen ELISA detection kit, detection method and application | |
CN117025545B (en) | Hybridoma cell strain secreting highly pathogenic porcine reproductive and respiratory syndrome virus specific monoclonal antibody and application thereof | |
CN117169499B (en) | Double-antibody sandwich ELISA detection kit for Gatavirus and application thereof | |
CN114921418B (en) | Hybridoma cell strain 1D3 of O-type foot-and-mouth disease virus particle monoclonal antibody, kit and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200529 Termination date: 20210327 |