CN104726555B - Japanese croaker microsatellite DNA mark - Google Patents

Abstract

The present invention relates to a kind of molecular marking technique, more particularly to a kind of Japanese croaker microsatellite DNA mark.A kind of Japanese croaker microsatellite DNA mark, described microsatellite, which is numbered, is：NJB01, NJB04, NJB06, NJB15, NJB35；Its nucleotide sequence is successively such as SEQ ID NO：Shown in 15.The invention provides the new microsatellite locus of 6 Japanese croakers and expand the primer sequence and amplification method of this 6 microsatellite locus, it can be applied to genetic diversity Journal of Sex Research and the research of paternity identification of Japanese croaker different groups, it is reproducible, it is a kind of reliable and effective molecular labeling.

Description

Japanese croaker microsatellite DNA mark

Technical field

The present invention relates to a kind of molecular marking technique, more particularly to a kind of Japanese croaker microsatellite DNA mark.

Background technology

It is polymorphic that microsatellite DNA is also known as STR typing (STR), simple repeated sequence (SSR), simple sequence length Property (SSLP), refers to the nucleotide sequence constituted in genome using 1-6 nucleotides as unit tandem sequence repeats；Wherein, it is most common Be dinucleotide repeat, such as ((AC/TG) n and (AG/TC) n.Different bions is due to repeating the number of repetition of motif not Show polymorphism together.Research shows, it may be possible to which " chain cunning " (strand slippage) phenomenon during DNA replication dna is made It is higher into Genetic Polymorphism of Microsatellite DNA information capacity (polymorphic information content, PIC).Microsatellite DNA High mutability, codominance expression and its generality in eukaryotic gene group, become population genetic diversity Analysis, the identification of affiliation, the superior molecular labeling of genomic mapping and genetic breeding, with allozyme, RAPD method phases Than also there is certain superiority.Because microsatellite has, quantity is more, be evenly distributed in genome, polymorphism information is abundant, easily It is used widely the advantages of detection as excellent genetic marker (genetic marker).According to repeat unit Constitute and be divided into three types with distribution, microsatellite DNA sequence：Single type (pure), compound (compound), discontinuous form (interrupted), for example：

Single type：CACACACACACACACACACA

It is compound：CACACACACACAGAGAGAGA

Discontinuous form：CACATTCACACATTCATTCA

Japanese croaker, is commonly called as black wool Chang, English name Giant croaker, latin name Nibea japonic, belongs to perch shape Mesh, Sciaenidae, Nibea is large-scale high-quality edible fishes, is distributed mainly on East China Sea, the South Sea and South Japan edge Sea.In recent years, failed due to reasons such as excessive amount of fishing, environmental pollution, habitat destructions, add the reasons such as fishing ground diminution so that Its current NATURAL DISTRIBUTION quantity is extremely limited, and to recover and increasing the wild fishery resources of Japanese croaker, Japan, South Korea etc. is distinguished Just carry out the enhancement releasing work of Japanese croaker from the eighties in last century and the nineties, China is then relatively later, from 2005 Break through the full people's nursery of Japanese croaker in year to start, continuously carry out the work of scale enhancement releasing, every year nearly million tail of the amount of releasing, And achieve certain effect.

With developing rapidly for Protocols in Molecular Biology and molecular genetics, molecular labeling is excellent as individual identification instrument Gesture gradually highlight (1999), release that effect is important and effective means as assessing Fishery Resources Enhancement One of.(2001) such as the Sekino of Japan cultivation Bastard halibut is marked using mitochondrial DNA and micro-satellite labeling technique, into The Bastard halibut individual released has been tracked work(.However, in terms of Japanese croaker genetic structure and Germplasm Identification, rarely seen bavin Army etc. (2007,2009,2013) was once utilized respectively RAPD marks, mitochondria Cyt b genes, 16S rRNA and COI gene pairs day This spotted maigre and catfish shape spotted maigre carry out Germplasm Identification, the preliminary assessment genetic diversity of Japanese croaker.But above-mentioned something lost Enough hereditary information can not be provided by passing mark.In order to further appreciate that Japanese croaker parent, recapture colony population structure With the information in terms of genetic diversity, it is necessary to develop new molecular genetic marker.

The content of the invention

The present invention provides a kind of Japanese croaker microsatellite DNA mark, establishes the technology of Japanese croaker microsatellite DNA System simultaneously carries out Japanese croaker parent, the classification of recapture individual and the analysis of genetic diversity using these molecular labelings.

The technical solution adopted for the present invention to solve the technical problems is：

A kind of Japanese croaker microsatellite DNA mark, described microsatellite, which is numbered, is：NJB01, NJB04, NJB06, NJB15, NJB35；Its nucleotide sequence is successively such as SEQ ID NO：Shown in 1-5.The present invention include Japan microsatellite (CT) n, (AG) structure of n, (TG) n and (AC) n enriched libraries, the screening and sequencing of the positive colony containing microsatellite sequence obtain 496 Clone containing microsatellite repetitive sequence, it is determined that microsatellite marker NJB01, NJB04, the NJB06 of 6 rich polymorphisms, NJB15, NJB35；NJB01 is that 836 nucleotides, NJB04 are that 440 nucleotides, NJB06 are that 927 nucleotides, NJB15 are 310 nucleotides, NJB35 are 681 nucleotides.

Preferably, the primer sequence in described six sites of NJB01, NJB04, NJB06, NJB15, NJB35 is, its core Nucleotide sequence is successively such as SEQ ID NO：Shown in 6-17：

NJB01F：TTACATTCAGCAGGTATAGACAC

NJB01R：TTAACAGGTAGCCAATGCAAAGA

NJB04F：AAATTTGCTCCTGACCGACCAC

NJB04R：CGAGACCAAACCGTAAGAGTTGTA

NJB06F：CCCCTCCAACAAATCAACCCTT

NJB06R：TCTCGCCTATACTGACAATGTAAC

NJB15F：GTTACCCAGTGTGCAGTCTTG

NJB15R：AAGTCTGCTCCAGTTATTCGGTT

NJB35F1：AACCCTCTATCTCCTTCTGTGC

NJB35R1：TATTCACAAGATGATGCCTACTG

NJB35F2：AACCCTCTATCTCCTTCTGTGC

NJB35R2：CCTGGCCCATCTTCTATCTCAGC.

The beneficial effects of the invention are as follows：The invention provides the new microsatellite locus of 6 Japanese croakers and expand this 6 The primer sequence and amplification method of microsatellite locus, can be applied to Japanese croaker different groups genetic diversity Journal of Sex Research and The research of paternity identification, it is reproducible, it is a kind of reliable and effective molecular labeling.

Brief description of the drawings

Fig. 1：The primer in NJB01 sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

Fig. 2：The primer in NJB04 sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

Fig. 3：The primer in NJB06 sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

Fig. 4：The primer in NJB15 sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

Fig. 5：The primer in NJB35a sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

Fig. 6：The primer in NJB35b sites expands the STR parting figures of 60 tail Japanese croaker genomic DNAs；

In Fig. 1-Fig. 6,1-20 represents 20 tail Japanese croaker parent populations, and 21-40 represents first filial generation；41-60 represents recapture Individual.

Embodiment

Below by specific embodiment, technical scheme is described in further detail.It should be appreciated that this hair Bright implementation is not limited to the following examples, and any formal accommodation and/or change made to the present invention will all fall Enter the scope of the present invention.

In the present invention, if not refering in particular to, all part, percentage are unit of weight, equipment and raw material for being used etc. It is commercially available or commonly used in the art.Method in following embodiments, is the normal of this area unless otherwise instructed Rule method.

Embodiment：

1st, the structure of Japanese microsatellite DNA plasmid library：

The extraction of 1.1 genomes：With reference to (1997, Universal and rapid such as Aljanabi and Martinez salt-extraction of high quality genomic DNA for PCR-based techniques[J] .Nucleic Acids Research,25(22):4692-4693) method extracts Japanese croaker genomic DNA, DNA samples Product electrophoresis detection on 0.8% Ago-Gel.

1.25 '-anchor PCR is expanded

Following methods refer to Tang S J, Liu Z Z, Tang W Q, et al.A simple method for isolation of microsatellites from the mudskipper(Boleophthalmus pectinirostris)without constructing a genomic library[J].Conserv Genet,2009, 10:1957–1959.

With KKVRVRV (CT) 10, KKVRVRV (AG) 10, KKHBHBH (AG) 10, KKVRVRV (TG) 10, KKHRHRH (TG) 10th, GGCC (AC) 8, GCGC (AG) 8, GCGC (AC) 8 are primer, and performing PCR is entered using the genomic DNA of 1.1 processes extraction as template Amplification, 15 μ L reaction systems are as follows, including 1 × EX Taq buffer solutions, 0.2mM dNTPs, 0.2 μM of primer, 40ng DNA profilings, 1U Taq archaeal dna polymerases (are purchased from TaKaRa companies), and remaining uses sterilizing distilled water polishing.PCR response procedures are as follows：94 DEG C pre- Denaturation 5 minutes, then 94 DEG C 30 seconds, 53~55 DEG C are annealed 30 seconds, 72 DEG C 1 minute, carry out 35 circulations；Last 72 DEG C of extensions 10 Minute.With the clip size of 1.5% agar sugar detection pcr amplification product.Product (is purchased from Qiagen PCR QIAquick Gel Extraction Kits Qiagen companies) purifying to be to remove unnecessary dNTPs and other impurities.

1.3 microsatellite DNA fragments are cloned

By 300~1000bp PCR primers of purifying with pMD 19-T carriers (being purchased from TaKaRa companies) in 16 DEG C of connections 5h.Transformed clone is carried out with competence Escherichia coli TOP 10, Japanese croaker microsatellite plasmid library is obtained.2nd, containing microsatellite Screening, sequencing and the micro-satellite primers design of the positive colony of sequence

2.1 blue hickie screenings

Transformant with vector plasmid DNA is supported on base due to the activity with beta galactosidase in training agar plate Show blue colonies.Activity of the Escherichia coli containing recombinant plasmid transformed due to losing beta galactosidase, in fine jade White colony is showed on fat plating medium.Positive colony containing Insert Fragment is screened according to blue hickie.

2.2 colony PCR amplification

In the white colony of the LB cultured on solid medium containing ampicillin after picking conversion, 0.5~1mL is inoculated into The LB fluid nutrient mediums containing ampicillin in, under the conditions of 37 DEG C shake (150rpm) overnight incubation, take 100 μ L bacterium solutions in 12000rpm centrifuges 2min, and abandoning supernatant adds the 40 μ L 5%Triton X-100 aqueous solution into precipitation, boiled 5min, places 5min on ice, centrifuges (12000rpm, 5min), takes 2 μ L of supernatant liquid as template DNA, enters performing PCR reaction.PCR Reaction use pMD 19-T carrier upstream and downstream universal primer (5 '-CGCCAGGGTTTTCCCAGTCACGAC-3 ', 5 '- GAGCGGATAACAATTTCACACAGG-3 ') enter performing PCR amplification.Amplification condition is：95 DEG C of pre-degenerations enter circulation after 5 minutes System, 94 DEG C are denatured 1 minute, and 52 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 30 circulations, and last 72 DEG C extend 10 minutes, 4 DEG C preserve, 1.5% agarose gel electrophoresis detection.

2.3 positive colony sequencings and design of primers：

Positive colony send biotech firm to be sequenced, and 496 sequences containing microsatellite DNA are obtained.According to microsatellite DNA side Wing sequence, 20 pairs of micro-satellite primers are designed using software Primer premier5.And this 20 pairs of primers are entered with performing PCR amplification inspection Survey, wherein 6 pairs of final choice is capable of the primer of preferable amplification, and uses FAM and HEX respectively to the end of sense primer 5 ' of these primers Carry out fluorescence labeling.

3rd, the screening and interpretation of result of Japanese croaker polymorphic micro-satellite site primer

3.1 screenings have the primer of polymorphism：

With the tail Japanese croakers of high salt method 60 provided of Aljanabi and Martinez etc. (1997) in 1.1 processes Genomic DNA.With 6 pairs of primer amplification gene groups obtained by 2.3 process step designs.Response procedures：95 DEG C of pre-degenerations 5 minutes, then 35 circulations (94 DEG C are denatured 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 45 seconds), last 72 DEG C extend 7 minutes, 4 DEG C of preservations.With The detection of 1.5% agarose gel electrophoresis, preservation of taking pictures.PCR primer is through ABI PRISM3730 genetic analyzers (Applied Biosystem companies) Genotyping (Genotyping) is carried out, use Genemarker1.6 softwares (Applied Biosystem companies) interpretation allele fragment concrete numerical value.6 microsatellite markers with polymorphism are obtained (to be shown in Table 1)：NJB01, NJB04, NJB06, NJB15, NJB35；NJB01 is that 836 nucleotides, NJB04 are 440 nucleotides, NJB06 It is that 310 nucleotides, NJB35 are 681 nucleotides for 927 nucleotides, NJB15.

3.2 interpretation of result：

Calculated using the softwares of Cervus 3.0 and expect heterozygosity and observation heterozygosity.Calculated and breathed out using Genepop4.0 softwares Generation-Weinberg and the value of linkage disequilibrium, the feature in 6 Japanese croaker microsatellite DNA polymorphism sites is described with this.

It can be seen that by Fig. 1-6, the length of 6 microsatellite sequences of the invention all goes out in the 60 tail Japanese croakers for examination Show diversity, it can be seen that, the colony that this 6 microsatellite markers of the invention can be used to study Japanese croaker divides and lost Pass relationship analysis.

The invention provides the new microsatellite locus of 6 Japanese croakers and expand the primers of this 6 microsatellite locus Sequence and amplification method, the genetic diversity Journal of Sex Research and genetic map that can be applied to Japanese croaker different groups are drawn, weight Renaturation is good, is a kind of reliable and effective molecular labeling.

The primer property list of table 1

Embodiment described above is a kind of preferably scheme of the present invention, not makees any formal to the present invention Limitation, also has other variants and remodeling on the premise of without departing from the technical scheme described in claim.

Claims (2)

1. a kind of Japanese croaker microsatellite DNA mark, it is characterised in that：Using microsatellite numbering as：NJB01, NJB04, 6 pairs of primers are designed based on NJB06, NJB15, NJB35 5 Japanese croaker microsatellite locus, are then expanded with 6 pairs of primers Japanese croaker complete genome DNA obtains Japanese croaker microsatellite DNA mark；NJB01, NJB04, NJB06, NJB15, NJB35 5 Japanese croaker microsatellite locus its nucleotide sequences are successively such as SEQ ID NO：Shown in 1-5,6 pairs of primer sequences It is as follows：

NJB01F： TTACATTCAGCAGGTATAGACAC

NJB01R：TTAACAGGTAGCCAATGCAAAGA

NJB04F：AAATTTGCTCCTGACCGACCAC

NJB04R：CGAGACCAAACCGTAAGAGTTGTA

NJB06F：CCCCTCCAACAAATCAACCCTT

NJB06R：TCTCGCCTATACTGACAATGTAAC

NJB15F：GTTACCCAGTGTGCAGTCTTG

NJB15R：AAGTCTGCTCCAGTTATTCGGTT

NJB35F1： AACCCTCTATCTCCTTCTGTGC

NJB35R1：TATTCACAAGATGATGCCTACTG

NJB35F2：AACCCTCTATCTCCTTCTGTGC

NJB35R2：CCTGGCCCATCTTCTATCTCAGC.

2. a kind of primer for preparing Japanese croaker microsatellite DNA mark, it is characterised in that：The primer sequence is：

NJB01F： TTACATTCAGCAGGTATAGACAC

NJB01R：TTAACAGGTAGCCAATGCAAAGA

NJB04F：AAATTTGCTCCTGACCGACCAC

NJB04R：CGAGACCAAACCGTAAGAGTTGTA

NJB06F：CCCCTCCAACAAATCAACCCTT

NJB06R：TCTCGCCTATACTGACAATGTAAC

NJB15F：GTTACCCAGTGTGCAGTCTTG

NJB15R：AAGTCTGCTCCAGTTATTCGGTT

NJB35F1： AACCCTCTATCTCCTTCTGTGC

NJB35R1：TATTCACAAGATGATGCCTACTG

NJB35F2：AACCCTCTATCTCCTTCTGTGC

NJB35R2：CCTGGCCCATCTTCTATCTCAGC.