CN104694397B - One plant of chaetomium globosum and its application - Google Patents
One plant of chaetomium globosum and its application Download PDFInfo
- Publication number
- CN104694397B CN104694397B CN201410796936.XA CN201410796936A CN104694397B CN 104694397 B CN104694397 B CN 104694397B CN 201410796936 A CN201410796936 A CN 201410796936A CN 104694397 B CN104694397 B CN 104694397B
- Authority
- CN
- China
- Prior art keywords
- fsr
- ginseng
- chaetomium globosum
- brown
- spore
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Environmental Sciences (AREA)
- Dentistry (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Agronomy & Crop Science (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention announces one plant of chaetomium globosum（Chaetomium globosum）FSR 74, depositary institution：China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date：On September 19th, 2014, its preserving number are CGMCC No.9690.The bacterial strain is in potato dextrose agar（PDA）Growth is slower during 25 DEG C of cultures of flat board, and bacterium colony is shallow brown, and edge often splits shape in irregular ripple.The ascocarp tables of FSR 74 are given birth to, and stromal surface is bonded to rhizoid；Basidixed hair is wavy, brown, has every surface has intensive wart point；There are 8 ascospores in ascus；Ascospore lemon shape, has single basidixed germ pore.Chaetomium globosum（Chaetomium globosum）FSR 74 is to causing the main pathogenic fungi of ginseng root rot, epidemic disease, sclerotiniose, rust rot, black spot, damping-off and gray mold to have the bacteriostasis of high-efficiency broad spectrum.The present invention also provides chaetomium globosum（Chaetomium globosum）Biocontrol Mechanisms and application of the FSR 74 in fungal diseases of plants is prevented and treated, and the application in the microorganism formulation for preparing preventing and treating fungal diseases of plants.
Description
Technical field
The present invention relates to one plant of chaetomium globosum and its application.
Background technology
Ginseng (Panax ginseng C.A. Mey) it is the negative dicotyledonous medicinal plant of Araliaceae Panax perennial root
Thing, it is the rare medicinal herbs in China, the good reputation for having " kings of hundred grass ".Ginseng has greatly in countries such as China, South Korea, Korea, Russia
Area is planted, wherein, special Jilin Province, Northeast China is the main producing region of ginseng, it has also become one of local mainstay industry.
Long-term artificial growth and the breed breeding difficulty of ginseng cause greatly ginseng germplasm degenerate, disease it is serious, it is of poor quality, yield poorly.Change
Learn to farm a large amount of uses of medicine, cause residues of pesticides and environmental pollution, reduce the security and commodity value of ginseng crude drug.Disease
Prevention and control problem turns into one of significant problem for restricting ginseng industry sustainable development.
Ginseng diseases there are about 20 ~ 40 kinds, wherein, below 7 class pathogens be cause ginseng Common Diseases and limit ginseng production
The main pathogenic fungi of industry development：By fusarium solani (Fusarium solani) caused by the general incidence of disease of ginseng root rot exist
30% or so, the death rate caused by 6 years strangers join root rot when serious up to 50% ~ 80%, main harm spring seedling root and
Rhizome portion (stem below earth's surface), rotten ginseng root are in dark brown web rot shape, the later stage rotten shape of grain, only deposit hollow root skin；Dislike epidemic disease
Mould (Phytophthora cactorum) caused by Ginseng Blight In China it is serious when the incidence of disease up to 70%, when its symptom is falls ill light
Irregular dark green color spot is produced on blade, severe one cauline leaf is withered, and butt rot, plant is withered in flakes, and the underproduction is serious；Ginseng core
Cup fungi (Sclerotinia schinseng) caused by ginseng sclerotiniose main harm 3 years it is raw more than ginseng root, site of pathological change is bud
Bud, root and rhizome, after ginseng root is killed, initial stage gives birth to a little white fluffy mycelium on surface, after, internal rapid corruption, softening,
Cell is all resolved the exocuticle for totally, leaving behind necrosis, the inside and outside sclerotium for forming many mouse excrement shapes of epidermis；Ginseng rod method
Bacterium (Alternaria panax) caused by the general incidence of disease 20%-30% of black fleck disease of ginseng, 100% is reached when serious, cause early stage
Fallen leaves, plant withers, shaky, ginseng root and the ginseng seed underproduction；Rhizoctonia solani Kuhn (Rhizoctonia solani) caused by ginseng
Damping-off is one of ginseng seedling stage Major Diseases, and under conditions of low temperature high humidity, developmenting spread is extremely rapid, the general incidence of disease
For 8 ~ 30%, for severe patient up to 40% or so, germ makes seedling be hung contracting, rotten in the stem of 3~5 centimetres of dry and wet soil interfaces in ground
It is rotten, conducting tissue is cut off, causes seedling to lodge；Destruction post spore bacterium (Cylindrocarpon destructans) caused by ginseng
The incidence of disease is up to more than 70% when rust rot is serious, and the disease betides each position of root, and scab is in rust, is diffused to by putting to face
Quan Gen, soil moisture is big, bad, humus thickness of breathing freely, morbidity weight；The pathogen of Botrytis cinerea（Botrytis cinerea Pers.）
There is brown spot on the brood cell of ginseng root in caused ginseng gray mold early stage, different from not seeing in appearance for ginseng root main root
Chang Xianxiang, but with hand pinch when, join root inside tissue softened.Both the morbidity later stage is above-mentioned to show as soft rotten symptom, and
Sick portion produces the mould layer of villiform of grey, can form the sclerotium of black in old complaint sometimes.
Ginseng diseases are prevented and treated by using Chemical control methods such as chemical pesticides and fall flat for a long time, and
And chemical pesticide is excessively used can not only destroy soil microenvironment, environmental pollution is aggravated, also makes noxious material in ginseng root
A large amount of accumulation, reduce the safety in utilization and commodity value of ginseng.Therefore, disease control emphasis progressively turns to biological control and agriculture
In industry prophylactico-therapeutic measures.Field is protected in crop plants, is had using the healthy tree rhizosphere soil screening of crop to pathogen notable
The edaphon of biocontrol effect, and it is one of important means of biological prevention and control research that microbial bacterial agent, which is made, and beneficial to micro-
The important channel that bio-resource exploitation utilizes.
Biological control is based on ecological principle, using the interaction between living species, with a kind of or a kind of raw
Thing suppresses another or another kind of biology.Biological control biggest advantage is free from environmental pollution, and without residues of pesticides, this is agricultural chemicals
It is incomparable Deng non-biological methods preventing and treating pest and disease damage.It is biological prevention using Biocontrol microorganism preventing and treating pathogenic microorganism
Important component.It avoid it is a large amount of using for the use of a series of plant protection, environment and the energy that chemical pesticide is brought the problem of,
Avoid harm of the residues of pesticides to people and animals, it is often more important that promote agricultural sustainable development.Chaetomium (Chaetomium
Sp.) fungi is distributed widely in soil and plant.The quasi-microorganism can produce the Multiple Classes of Antibiotics such as chaetocin, ball chaetocin,
Biological control agentses as phytopathogen are widely studied.The antagonism cupreum species studied at present is less, one plant of ball hair shell
Bacterium（Chaetomium globosum）Separation obtains and is used for controlling plant diseases out of plant, and utilizes ball hair shell
Bacterium preventing and treating ginseng fungal disease has no report.
The content of the invention
It is an object of the invention to：Main fungal venereal disease in being produced for ginseng is done harm to, and especially ginseng soil-borne disease is sent out
Dough product expands day by day, and Agro-chemicals control is in addition to environmental pollution and residues of pesticides is easily caused, preventive effect also undesirable actual feelings
Condition, propose one plant separated from Soil of Ginseng Rhizomsphere obtain chaetomium globosum (Chaetomium globosum) FSR-74 bacterial strains
And its in the fusarium solani for causing ginseng root rot, rust rot, black spot, damping-off, epidemic disease, sclerotiniose and gray mold respectively
(F. solani), destroy post spore bacterium (C. destructans), ginseng alternaric bacteria (A. panax), Rhizoctonia solani Kuhn (Rh. solani), Phytophthora cactorum bacterium (Ph. cactorum), Sclerotinia ginseng (S. schinseng) and the pathogen of Botrytis cinerea (B. cinerea) application in 7 kinds of pathogen prevention and control.
Cause ginseng root rot, rust rot, black spot, damping-off, epidemic disease, sclerotiniose to above-mentioned the invention provides one kind
With 7 kinds of disease funguses of gray mold be respectively provided with good prevention and control effect chaetomium globosum (Chaetomium globosum) FSR-
74, the entitled ball hair shell FSR-74 of preservation of the bacterial strain, Classification And Nomenclature is ball hair shellChaetomium globosum, preservation list
Position is：China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date：On September 19th, 2014, preservation are compiled
Number：CGMCC No.9690, preservation address are：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Chinese Academy of Sciences microbe research
Institute.Chaetomium globosum FSR-74 bacterial strains identification proposed by the present invention is using traditional form identification technology and modern rDNA-ITS sequences point
Analysis technology.FSR-74 is in potato dextrose agar（PDA）Growth is slower during 25 DEG C of cultures on flat board, and bacterium colony is shallow brown,
Olive is brown or sepia, tool canescence or olive brown aerial hyphae, back side sepia are normal often with olive brown exudate, colony edge
Shape is split in irregular ripple.FSR-74 microstructure is false with brown in 10 × 50 optical microphotograph Microscopic observations, the life of ascocarp table
Root is bonded to stromal surface, is under reflected light olive green to olive brown, obovate to subsphaeroidal, 160 ~ 240 μm of diameter, high
About 220 ~ 300 μm；Ascocarp wall is made up of crineous textura intricata；Basidixed hair is a large amount of and intensive, meander-like, it is wavy or
Slightly crimp, brown, have every base portion barrier film is more apparent, not branch, and surface has intensive wart point, wide about 2.5 ~ 4 μ of base portion in the shape of a spiral
m；Side setation meander-like, separate obvious；Ascus club-like, 27 ~ 36 × 11 ~ 15 μm, inside there are 8 ascospores, ascus wall holds
Easily resolution；Ascospore lemon shape, two is flat-sided, and both ends respectively have an apicule, brown when ripe, 8.5 ~ 11 × 7 ~ 8.5 μm, tool
Single basidixed germ pore.Described potato dextrose agar（PDA）It is formulated and is：The g/L of potato 200, the g/ of glucose 10
L, the g/L of agar 15, the mL of distilled water 1000,2 μ g/mL penicillin, pH are 6.8 ~ 7.2.
The rDNA-ITS sequence lengths of chaetomium globosum FSR-74 bacterial strains proposed by the present invention are 604 bp, specific such as SEQ ID
No:Shown in l.Analyzed using softwares such as BLAST and DNAMAN, the ITS sequence of FSR-74 bacterial strains compared by BLAST,
The very high close strain sequence of homology can be found in GenBank.It is with bacterial strain FSR-74 similitude highestsChaetomium globosum, homology reaches 99%.Developed according to MEGA5.10Beta2 softwares with UPGMA methods constructing system
Tree find, FSR-74 withChaetomium globosumBelong to a hereditary branch together, affiliation is sufficiently close to, and pro-borne reaches
To 99%.Combining form credit class and molecular biology identification result, the bacterial strain FSR-74 that can confirm that the present invention is ball hair shell
Bacterium（Chaetomium globosum）.
The present invention relates to applications of the chaetomium globosum FSR-74 in fungal diseases of plants is prevented and treated, the plant is preferably people
Ginseng, the fungi be preferably cause ginseng root rot fusarium solani (F. solani), cause the destruction post of ginseng rust rot
Spore bacterium (C. destructans), cause black fleck disease of ginseng ginseng alternaric bacteria (A. panax), cause Ginseng Rhizoctonia Solani
Rhizoctonia solani Kuhn (R. solani), cause Ginseng Blight In China Phytophthora cactorum bacterium (P. cactorum), cause the people of ginseng sclerotiniose
Ginseng sclerotinite (S. schinseng) and cause ginseng gray mold the pathogen of Botrytis cinerea (B. cinerea) in this 7 kinds of pathogens
It is one or more.
The invention further relates to mechanisms of control wheat scab of the chaetomium globosum FSR-74 in fungal diseases of plants is prevented and treated, the plant are preferred
For ginseng, the fungi be preferably cause ginseng root rot fusarium solani (F. solani), cause ruining for ginseng rust rot
Go out post spore bacterium (C. destructans), cause black fleck disease of ginseng ginseng alternaric bacteria (A. panax), to cause ginseng to stand withered
Disease Rhizoctonia solani Kuhn (R. solani), cause Ginseng Blight In China Phytophthora cactorum bacterium (P. cactorum) and cause ginseng gray mold
The pathogen of Botrytis cinerea (B. cinerea).Chaetomium globosum FSR-74 seizes locus by Competition and nutriment is effective
Suppress ginseng pathogen mycelial growth；By hyperparasitism and discharge Substance and cause pathogen mycelia and mitogenetic spore
Sub- deformity, suppresses growth of pathogenic bacteria and spore germination.
The invention further relates to a kind of chaetomium globosum FSR-74 microorganism formulation, and it can be prepared by the following method to obtain：
（1）Chaetomium globosum FSR-74 test tube slants kind is activated, takes 25 mm pure culture biscuits involvng inoculations in bottled with 250 mL triangles
100mL potato glucoses（PDB）In fluid nutrient medium, 48 h are cultivated at 170 r/min, 25 DEG C, obtain seed liquor；
（2）By chaetomium globosum FSR-74 seed liquors with 10%（Volume ratio）It is inoculated in fermentation culture and cultivates, in 170 r/min, 25 DEG C
96 h of lower culture, obtain nutrient solution；（3）Nutrient solution is filtered through 2 layers of sterile gauze, filtrate counts through blood counting chamber, by spore
Sub- suspension is dispersed to 6 gL-1Sodium carboxymethylcellulose（CMC）In solution, spore suspension is obtained, spore content is 2 × 105
cfu·mL-1；（4）Chaetomium globosum FSR-74 nutrient solutions are centrifuged into 20 min, filtering in 8000 r/mim, supernatant is to ferment
Liquid.
The chaetomium globosum FSR-74 and its zymotic fluid of the present invention has field diseases prevention and somatotrophic effect to ginseng.
It is an advantage of the current invention that preserving number be CGMCC No.9690 chaetomium globosum FSR-74 to causing ginseng respectively
Root rot, rust rot, black spot, damping-off, epidemic disease, sclerotiniose and gray mold fusarium solani (F. solani), destroy post
Spore bacterium (C. destructans), ginseng alternaric bacteria (A. panax), Rhizoctonia solani Kuhn (R. solani), Phytophthora cactorum bacterium (P. cactorum), Sclerotinia ginseng (S. schinseng) and the pathogen of Botrytis cinerea (B. cinerea) etc. 7 kinds of pathogens have not
With the prevention effect of degree, to ginseng growth of pathogenic bacteria inhibiting rate up to 46.67% ~ 73.33% during opposite culture, during zymotic fluid culture
There is growth promoting function to ginseng to ginseng growth of pathogenic bacteria inhibiting rate up to 41.11% ~ 61.45%, FSR-74 zymotic fluid, it is nontoxic
No pathogenicity, it is free from environmental pollution to person poultry safety；Meanwhile biocontrol bacterial strain FSR-74 spore suspensions are applied directly in soil
Pouring root is carried out to plant or applies leaf processing can play its antibacterial, bactericidal action, Ginseng Rhizosphere microbiologic population can be significantly improved
Structure, a bio-diversity Soil of Ginseng Rhizomsphere micro-ecological environment is formed, so as to effectively enduringly control ginseng fungoid
The generation of disease.
Brief description of the drawings
Fig. 1：The present invention chaetomium globosum FSR-74 bacterial strains to destroy post spore bacterium (Cylindrocarpon destructans) mycelia growth flat board inhibitory action.
Fig. 2：The present invention chaetomium globosum FSR-74 strains to fusarium solani (Fusarium solani) growth of mycelia puts down
Plate inhibitory action.
Fig. 3：The present invention chaetomium globosum FSR-74 bacterial strains to ginseng alternaric bacteria (Alternaria panax) mycelia
Grow flat board inhibitory action.
Fig. 4：The present invention chaetomium globosum FSR-74 bacterial strains to Sclerotinia ginseng (Sclerotinia schinseng) mycelia
Growth flat board inhibitory action.
Fig. 5：The present invention chaetomium globosum FSR-74 bacterial strains Rhizoctonia solani (Rhizoctonia solani) mycelia
Grow flat board inhibitory action.
Fig. 6：The present invention chaetomium globosum FSR-74 bacterial strains to Phytophthora cactorum bacterium (Phytophthora cactorum) mycelia
Grow flat board inhibitory action.
Fig. 7：The present invention chaetomium globosum FSR-74 bacterial strains to the pathogen of Botrytis cinerea (Botrytis cinerea) mycelia life
Long flat board inhibitory action.
Fig. 8：The present invention chaetomium globosum FSR-74 bacterial strains suppress fusarium solani (Fusarium solani) mycelial growth
Microexamination.
Fig. 9：The chaetomium globosum FSR-74 bacterial strains of the present invention suppress Phytophthora cactorum bacterium (Phytophthora cactorum) mycelia
The microexamination of growth.
Figure 10：The present invention chaetomium globosum FSR-74 bacterial strains suppress Rhizoctonia solani Kuhn (Rhizoctonia solani) mycelia
The microexamination of growth.
Figure 11：The chaetomium globosum FSR-74 bacterial strains of the present invention suppress to destroy post spore bacterium (Cylindrocarpon destructans) mycelial growth microexamination.
Figure 12：The chaetomium globosum FSR-74 bacterial strains of the present invention suppress ginseng alternaric bacteria (Alternaria panax) mycelia
The microexamination of growth.
Figure 13：The present invention chaetomium globosum FSR-74 bacterial strains suppress the pathogen of Botrytis cinerea (Botrytis cinerea) mycelia life
Long microexamination.
Figure 14：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors to fusarium solani (Fusarium solani) bacterium
The inhibitory action of silk growth.
Figure 15：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors to Phytophthora cactorum bacterium (Phytophthora cactorum) mycelial growth inhibitory action.
Figure 16：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors to ginseng alternaric bacteria (Alternaria panax)
The inhibitory action of mycelial growth.
Figure 17：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors to the pathogen of Botrytis cinerea (Botrytis cinerea) bacterium
The inhibitory action of silk growth.
Figure 18：The chaetomium globosum FSR-74 bacterial strain fermentation liquors of the present invention suppress to destroy post spore bacterium (Cylindrocarpon destructans) mycelial growth microexamination.
Figure 19：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors suppress fusarium solani (Fusarium solani)
The microexamination of mycelial growth.
Figure 20：The chaetomium globosum FSR-74 bacterial strain fermentation liquors of the present invention suppress ginseng alternaric bacteria (Alternaria panax) mycelial growth microexamination.
Figure 21：The chaetomium globosum FSR-74 bacterial strain fermentation liquors of the present invention suppress Phytophthora cactorum bacterium (Phytophthora cactorum) mycelial growth microexamination.
Figure 22：The present invention chaetomium globosum FSR-74 bacterial strain fermentation liquors to the pathogen of Botrytis cinerea (Botrytis cinerea) bacterium
The microexamination of silk growth.
Figure 23：The chaetomium globosum FSR-74 bacterial strain fermentation liquors of the present invention suppress ginseng alternaric bacteria (Alternaria panax) spore germination microexamination.
Figure 24：Growth promoting function of the chaetomium globosum FSR-74 bacterial strains of the present invention to ginseng（A：Blank solution culture medium, B：
Pour into a mould chaetomium globosum FSR-74 zymotic fluids）.
Figure 25：Prevention effect of the chaetomium globosum FSR-74 bacterial strains of the present invention to the destruction microbial ginseng rust rot of post spore
（A：Sterilized water pouring root, B：Chaetomium globosum FSR-74 spore suspension liquid irrigating roots）.
Figure 26：Preventing and treating effect of the chaetomium globosum FSR-74 bacterial strains of the present invention to black fleck disease of ginseng caused by ginseng alternaric bacteria
Fruit（A：Sterilized water smears blade, B：Chaetomium globosum FSR-74 spore suspensions smear blade）.
Embodiment
The chaetomium globosum of embodiment 1（Chaetomium globosum）The separation and preservation of FSR-74 bacterial strains
The rhizosphere soil of the bacterial strain perennial ginseng healthy tree isolated from Jilin Province's Fusong County elm culture of ginseng.Adopt
Collect above-mentioned pedotheque, 2 mm sieves are crossed after removing surface litter.Weigh the g of fresh soil samples 10, be put into equipped with bead and
In the triangular flask of 90 mL sterile salines, 30 min are fully vibrated, sample is well mixed with sterilized water, obtained soil hangs
Turbid.Aseptically take 1 mL to vibrate liquid, add 9 mL sterile salines, 10 are made successively by gradient-2、10-3、
10-4Dilution.100 each dilutions of μ L are drawn respectively is added to potato dextrose agar（PDA）On flat board, adopt
With plate dilution method even spread, 3 repetitions, 25 DEG C of d of incubator culture 7 are often handled.Picking individual colonies are transferred to potato
Glucose agar medium（PDA）After flat board culture grows bacterium colony, isolated and purified using single spore separation method, purifying bacterial strain in
4 DEG C of preservations.
Potato dextrose agar（PDA）It is formulated and is：The g/L of potato 200, the g/L of glucose 10, the g/ of agar 15
L, the mL of distilled water 1000,2 μ g/mL penicillin, pH are 6.8 ~ 7.2.
The bacterial strain is in potato dextrose agar（PDA）Growth is slower during 25 DEG C of cultures on flat board, and bacterium colony is shallow
Brown, olive is brown or sepia, has canescence or olive brown aerial hyphae, back side sepia, often with olive brown exudate, colony edge
Often shape is split in irregular ripple.The ascocarp table life of FSR-74 bacterial strains, is bonded to stromal surface, under reflected light with brown rhizoid
It is high about 220 ~ 300 μm for olive green to olive brown, obovate to subsphaeroidal, 160 ~ 240 μm of diameter；Ascocarp wall is by dun
Color textura intricata is formed；Basidixed hair is a large amount of and intensive, meander-like, wavy or slightly crimp in the shape of a spiral, brown, has every base
Portion's barrier film is more apparent, not branch, and surface has intensive wart point, and base portion is wide about 2.5 ~ 4 μm；Side setation meander-like, separate obvious；Son
Capsule club-like, 27 ~ 36 × 11 ~ 15 μm, inside there are 8 ascospores, ascus wall is easily cleared up；Ascospore lemon shape, both sides
Flat, both ends respectively have an apicule, brown when ripe, 8.5 ~ 11 × 7 ~ 8.5 μm, have single basidixed germ pore.
The bacterial strain was deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms on the 19th in September in 2014
The heart, preserving number are CGMCC No.9690, and preservation address is：The Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Chinese Academy of Sciences is micro-
Biological study institute.
We are named as FSR-74 to the bacterial strain, and Classification And Nomenclature is：Ball hair shellChaetomium globosum。
Inhibitory action of the chaetomium globosum FSR-74 bacterial strains of embodiment 2 to ginseng fungal disease growth of pathogenic bacteria
Stood facing each other using 3 cups and dishes, growth rate method determines suppression of the bacterial strain FSR-74 to 7 kinds of fungal disease pathogens of ginseng
Effect：The ginseng pathogen bacterium colony activated is made to the bacteria cake of corresponding size, aseptic inoculation to horse with diameter 5mm card punch
Bell potato glucose agar medium（PDA）Flat board（The mm of diameter 90）Centre, 3 sides at away from the cm of pathogen 2.5 respectively connect
Enter the bacteria cake of a bacterium to be measured, another 1 side is blank, and as treatment group, each processing is repeated 3 times；Separately only connect in one piece of PDA plate
Kind ginseng pathogen, as a control group, is placed in 25 DEG C of d of incubator culture 7, treats that control group pathogen bacterium colony covers with flat board,
Measurement processing group pathogen colony diameter（Unit: mm）, and calculate bacteriostasis rate according to equation below.Every kind of pathogen repeats 3
It is secondary, results averaged.Bacteriostasis rate (%)=（Compare the disease of pathogen bacterium colony extension radius-and biocontrol fungi opposite culture
Opportunistic pathogen bacterium colony extends radius）/ control pathogen bacterium colony extension radius × 100%
As a result as shown in table 1, bacterial strain FSR-74 to causing ginseng root rot, rust rot, black spot, damping-off, epidemic disease respectively
The fusarium solani of sick, sclerotiniose and gray mold (F. solani), destroy post spore bacterium (C. destructans), ginseng chain lattice
Spore bacterium (A. panax), Rhizoctonia solani Kuhn (R. solani), Phytophthora cactorum bacterium (P. cactorum), Sclerotinia ginseng (S. schinseng) and the pathogen of Botrytis cinerea (B. cinerea) 7 kinds of pathogens are respectively provided with obvious inhibitory action.Particularly to causing
The bacteriostasis rate of the fusarium solani of ginseng root rot reaches 67.48%, to causing the Rhizoctonia solani Kuhn of Ginseng Rhizoctonia Solani and causing people
The bacteriostasis rate for joining the Sclerotinia ginseng of sclerotiniose is 62% or so, destruction post spore bacterium and ginseng grey mold to causing ginseng rust rot
The bacteriostasis rate of the pathogen of Botrytis cinerea of disease is 50% ~ 53%, to causing the ginseng rod method of black spot and the Phytophthora cactorum bacterium of Ginseng Blight In China
Bacteriostasis rate reached 46.67%, reflect that bacterial strain FSR-74 has wide spectrum to the preventive and therapeutic effect of 7 kinds of main pathogen fungies of ginseng
Property（Table 1）.
Inhibitory action of the chaetomium globosum FSR-74 of table 1 to ginseng disease fungus（%）
The chaetomium globosum FSR-74 nutrient solutions of embodiment 3, the preparation of spore suspension and zymocyte liquid
Chaetomium globosum FSR-74 test tube slants kind is activated, takes 25 mm pure culture biscuits involvng inoculations in bottled with 250 mL triangles
100 mL potato dextrose broths（PDB）In, 48 h are cultivated at 170 r/min, 25 DEG C, obtain seed liquor；Will
Chaetomium globosum FSR-74 seed liquors are with 10%（Volume ratio）It is inoculated in fermentation culture and cultivates, is trained at 170 r/min, 25 DEG C
96 h are supported, obtain nutrient solution；Chaetomium globosum FSR-74 nutrient solutions are filtered through 2 layers of sterile gauze, filtrate is through blood counting chamber meter
Number, 6 gL are dispersed to by spore suspension-1Sodium carboxymethylcellulose（CMC）In solution, spore suspension, spore content are obtained
For 2 × 105 cfu·mL-1；Chaetomium globosum FSR-74 strain cultured solutions are centrifuged into 20 min in 8000 r/mim, supernatant is to send out
Zymotic fluid；Zymotic fluid obtains chaetomium globosum FSR-74 without fermented liquids through 0.45 μm of filtering with microporous membrane.
Potato dextrose broth（PDB）Preparation method：The g/L of potato 200, the g/L of glucose 10, distilled water
1000 mL, pH are 6.8 ~ 7.2.Loading amount is 300 mL nutrient solutions in 1000 mL triangular flasks, and triangular flask is sealed with double-deck sealed membrane
Mouthful, 121 DEG C of moist heat sterilization 30 min are standby after cooling.
Inhibitory action of the chaetomium globosum FSR-74 bacterial strain fermentation liquors of embodiment 4 to ginseng pathogen
Using toxic medium culture, growth rate method determines chaetomium globosum FSR-74 zymotic fluids to ginseng fungal disease germ
Inhibitory action：By embodiment 3 prepare chaetomium globosum FSR-74 bacterial strain without fermented liquids, by FSR-74 bacterial strains without fermented liquid with
Potato dextrose agar（PDA）By 1:4 ratios are well mixed, and are configured to pastille culture medium, then by ginseng cause of disease
Bacterium bacteria cake is placed in pastille culture medium center, is compared with mixing sterilized water, each 5 repetitions of processing, incubated at 25 DEG C, and 6
Colony radius are measured after d and calculate bacteriostasis rate.Computational methods are the same as embodiment 2.
As a result as shown in table 2, chaetomium globosum FSR-74 zymotic fluids to cause respectively ginseng root rot, rust rot, black spot,
Damping-off, epidemic disease and gray mold fusarium solani (F. solani), destroy post spore bacterium (C. destructans), ginseng chain
Lattice spore bacterium (A. panax), Rhizoctonia solani Kuhn (R. solani), Phytophthora cactorum bacterium (P. cactorum) and the pathogen of Botrytis cinerea (B. cinerea) 6 kinds of pathogens produce different degrees of inhibitory action.Wherein, the destruction post spore bacterium for causing ginseng rust rot is pressed down
Bacterium rate reaches 61.45%, and the bacteriostasis rate of Rhizoctonia solani and Phytophthora cactorum bacterium is 50% or so, to ginseng alternaric bacteria and grey grape
The inhibiting rate of spore bacterium is minimum, and about 41% ~ 44%, illustrate anti-tool of the chaetomium globosum FSR-74 zymotic fluids to 6 kinds of ginseng pathogens
There is broad spectrum activity（Table 2）.
Bacteriostasis of the chaetomium globosum FSR-74 zymotic fluids of table 2 to ginseng disease fungus（%）
The chaetomium globosum FSR-74 bacterial strains of embodiment 5 suppress the Biocontrol Mechanism of ginseng fungal disease growth of pathogenic bacteria
Using the Biocontrol Mechanism of the more chaetomium globosum FSR-74 preventing and treatings ginseng fungal disease pathogens of opposite culture method research：
Respectively in the cm potato dextrose agars of diameter 9（PDA）Flat board relative position respectively accesses 15 mm chaetomium globosum
FSR-74 bacteria cakes and ginseng pathogen bacteria cake, two vaccinations are individually inoculated at a distance of 3 cm with ginseng pathogen or biocontrol fungi
Potato dextrose agar（PDA）Compare, each 5 repetitions of processing, it is incubated at 25 DEG C, in opposite culture
During, when suppression occurs in ginseng pathogen mycelia front end, mycelia on antagonism band is cut, the depth of field three is surpassed using Keyemce
Tie up stereoscope（VHX-600）Observe hypha form and the situation that influences each other.
As a result show, chaetomium globosum FSR-74 is inhibited to ginseng pathogen mycelial growth.In potato grape
Sugared agar medium（PDA）On culture medium, chaetomium globosum FSR-74 and fusarium solani, the pathogen of Botrytis cinerea and ginseng alternaric bacteria
The speed of growth is suitable；During opposite culture, chaetomium globosum FSR-74 is close to growth of pathogenic bacteria, and is formed in bacterium colony joint obvious short of money
Anti- band, the pathogen mycelia close to chaetomium globosum FSR-74 edges is thin and has intertwinement, and mycelium darkens with Huang
Color or the generation of yellowish-brown secretory substance, and the colony colour away from chaetomium globosum FSR-74 farther out is shallower, shows two bacterial strains to antibiosis
It is long, interact；Chaetomium globosum FSR-74 ratios cause the Rhizoctonia solani Kuhn of Ginseng Rhizoctonia Solani slow-growing, with the opposite culture time
Extend, the mycelium close to chaetomium globosum FSR-74 edges is thicker, darkens, opposite culture later stage Rhizoctonia solani Kuhn edge is several
Aerial hyphae is not produced, and obvious antagonism band is formed between chaetomium globosum FSR-74；Chaetomium globosum FSR-74 compares Phytophthora cactorum
Bacterium, Sclerotinia ginseng and destruction post spore bacteria growing speed are fast, produce obvious inhibiting effects to 3 kinds of pathogens, show pathogen
Edge is nearly free from aerial hyphae and produces brown secretion in bacterium colony junction, and opposite culture later stage pathogen bacterium colony is wrapped
Enclose, the gradual atrophy of bacterium colony, thus illustrate that bacterial strain FSR-74 has stronger competitive advantage（Fig. 1-7）.
Microexamination finds, the normal mycelial growth of ginseng disease fungus is very fast and even thickness, mycelia thickness and it is close
Collection, under chaetomium globosum FSR-74 effects, the ginseng pathogen mycelium branch around antagonism band increases, mycelia top and branch
Deformity is expanded at place, growth retardation, plasm cohesion, mycelia distortion, phenomenon of rupture occurs.In addition, picking opposite culture bacterium colony is handed over
Connect place's mycelia microscopy to find, with parallel, the mode such as winding ginseng pathogen mycelia produces it short of money chaetomium globosum FSR-74 mycelia
Anti- effect（Fig. 8-13）.
The chaetomium globosum FSR-74 bacterial strain fermentation liquors of embodiment 6 suppress the Biocontrol Mechanism of ginseng fungal disease growth of pathogenic bacteria
Using toxic medium culture, growth rate method measure chaetomium globosum FSR-74 zymotic fluids are fallen ill to ginseng fungoid disease
The influence of opportunistic pathogen growth：Chaetomium globosum FSR-74 zymotic fluids are obtained by the method for embodiment 3, zymotic fluid is through 0.45 μm of miillpore filter
Filtering, obtain chaetomium globosum FSR-74 without fermented liquids.By chaetomium globosum FSR-74 bacterial strains without fermented liquid and potato grape
Sugared agar medium（PDA）By 1:4 ratios are well mixed, and are configured to pastille culture medium, by the method culture ginseng cause of disease of embodiment 4
Bacterium, the super depth of field 3 D stereo microscope of Keyemce is used after 6 d（VHX-600）Observe hypha form.
As a result show, the speed of growth of the ginseng disease fungus mycelium in pastille culture medium is substantially less than potato grape
Sugared agar medium（PDA）Culture medium, subiculum is thin, and mycelium thickness is uneven with intertwinement, growth of pathogenic bacteria by
To suppression, ginseng alternaric bacteria and the pathogen of Botrytis cinerea discharge brown antagonistic substance in growth course.Chaetomium globosum FSR-74 is sent out
Active antibacterial material in zymotic fluid be present, strong influence can be produced on ginseng pathogen hypha form（Figure 14-17）.
Observe under the microscope, ginseng pathogen mycelia enlarges into beading, short and thick, is gathered into Cong Zhizhuan, some bacterium
Silk top or local deformity, rupture, intracellular organic matter leaks out after forming expansion bubble.Suppression in chaetomium globosum FSR-74 zymotic fluids
Bacterium active material can cause plasm in ginseng disease fungus mycelia to concentrate, mycelia deformity, while by destroying hyphal cell
Wall, intracellular organic matter is exosmosed, cause mycelia to be broken（Figure 18-22）.
Influence of the chaetomium globosum FSR-74 bacterial strain fermentation liquors of embodiment 7 to ginseng pathogen conidia germination
Influence of the method measure chaetomium globosum FSR-74 zymotic fluids to ginseng fungal disease pathogen spore is sprouted using carrier：
By ginseng alternaric bacteria (A. panax), destroy post spore bacterium (C. destructans), fusarium solani (F. solani), ash
Grape spore (B. cinerea) spore prepare spore suspension (the lower 100 spore/visuals field of 100 times of microscope) 0.1 mL in
Clean in 1.5 sterile mL centrifuge tubes, chaetomium globosum FSR-74 bacterial strain without fermented liquids are added with doubling dilution, to be added dropwise
0.1 mL potato dextrose broths（PDB）For control, 25 DEG C of cultures, conidiospore diameter is exceeded with germ tube length
Half as the standard sprouted, microscopy spore germination situation and sprouted handling 6 h, 12 h, 24 h and 48 h on slide
The orthodontic condition of spore germ tube is sent out, and calculates Germination suppression rate.
As a result as shown in table 3, chaetomium globosum FSR-74 without fermented liquids destroy post spore bacterium, Beancurd sheet to ginseng alternaric bacteria
The spore germination of Fusariumsp and the pathogen of Botrytis cinerea is respectively provided with different degrees of inhibitory action.25 DEG C of 6 h ginseng disease fungus spores of culture
Sub- germination rate is low, and fusarium solani spore germination rate only has 11%, and other pathogen spore germination rates are close to 0.With processing time
Extend, spore germination rate gradually increases, and FSR-74 zymotic fluids press down to destroying post spore bacterium and the pathogen of Botrytis cinerea spore germination during 48 h
Rate processed is maximum（55% or so）, it is 45% or so to ginseng alternaric bacteria and fusarium solani inhibition of germination.Can by Figure 23
Know, chaetomium globosum FSR-74 zymotic fluids can cause ginseng disease fungus spore germination to be obstructed, and spore deformity, germ tube front end expands
Show lopsided foaming material, the mycelia grown on germ tube can not stretch forward, so that spore loses invasive ability, chaetomium globosum
Substance may be contained in FSR-74 without fermented liquids.
Influence of the FSR-74 zymotic fluids of table 3 to common ginseng pathogen spore germination
The chaetomium globosum FSR-74 of embodiment 8 colonizes experiment
（1）Chaetomium globosum FSR-74 colonizing in soil
Using colonization amounts of the native inocalation method measure chaetomium globosum FSR-74 in soil is mixed, rifampin (300 μ g/ will be used
ML) labeled chaetomium globosum FSR-74 is inoculated in potato glucose（PDB）Nutrient solution, 25 DEG C, 170 r/min, shaking table shakes
6 d are swung, obtain chaetomium globosum FSR-74 mutant strain nutrient solutions, chaetomium globosum FSR-74 mutant strain spores are obtained by embodiment 3
Sub- suspension, and it is diluted to 1 × 105 Cfu/mL, 4 DEG C of refrigerators preserve, standby.Will be naturally native（The new timbered soil of ginseng is not planted,
Using impurity such as preceding Litter removals, new forest land soil is pressed 2 with vermiculite according to volume ratio:1 ratio mixes）Load a diameter of 20
Cm flowerpots, per basin, dress 1 kg of soil, the labeled chaetomium globosum FSR-74 mutant strain spore suspensions of 100 mL are injected into soil
Liquid mixes soil.Place at room temperature, the fungi in 1 soil is separated every 7 d（Soil first after gradient dilution, takes 10-2、10-3、10-4Soil dilution liquid carry out flat board coating）, calculate bacteria containing amount.
As a result show, chaetomium globosum FSR-74 colonization amount can reach every gram of soil 2.73 × 10 in soil naturally after 35 d4
More than cfu/g.This explanation chaetomium globosum FSR-74 has stronger colonization ability in soil.
（2）Chaetomium globosum FSR-74 colonizes ginseng cauline leaf
Using pouring root inocalation method, the spore suspension of chaetomium globosum FSR-74 mutant strains is prepared with embodiment 3.By nature
Soil（The new timbered soil of ginseng is not planted, and using impurity such as preceding Litter removals, new forest land soil is pressed 2 with vermiculite according to volume ratio:
1 ratio mixes）Load a diameter of 20 cm flowerpots, dress 1 kg of soil per basin, select in the same size and well-grown annual ginseng
Seedling is transplanted, and per 4 plants of basin, each processing repeats 6 basins.After transplanting 30 d, along the basal part of stem of ginseng-leaf to its root soil
Inject the spore suspension of mutant strain（Every plant of 25 mL）, field management is the same as conventional production.Whole strain ginseng is gathered after being inoculated with 7 d,
The root, stem, leaf of ginseng are subjected to surface sterilization（With the min of 50% ethanol immersion treatment 5）, it is placed in afterwards in 75% ethanol solution
10 min, place into 1% liquor natrii hypochloritis and soak 5 min, then with aseptic water washing 5 times（Material is rinsed by last 1 time
Whether the μ L of sterilized water 100 of material are applied to detection surface sterilization on PDA plate thorough）；Sterilizable material is after sterile blotting paper blots
Take 1 g sterilizable materials to be placed in sterile mortar, add 10 mL sterilized waters to be ground；30 min are stood after being ground into homogenate, on
Clear liquid is standby as leachate, and its concentration is 0.1 g/mL.100 μ L of supernatant liquid are taken to be coated on containing 300 μ g/mL rifampins
On PDA plate, often processing is repeated 3 times；Flat board is inverted in 25 DEG C of insulating boxs and cultivates 7 d, detects whether the life of bacterium to be measured
It is long.
As a result show, can be recycled to chaetomium globosum FSR-74 in ginseng root during 28 d.This explanation chaetomium globosum FSR-74
Can in ginseng body the long period exist, have certain endogenous, application potential is preferable.
Growth-promoting functions of the chaetomium globosum FSR-74 bacterial strains of embodiment 9 to ginseng
Growth promoting function of the chaetomium globosum FSR-74 bacterial strains to ginseng is determined using pot experiment method：By the method for embodiment 4
Obtain chaetomium globosum FSR-74 nutrient solutions.Will be naturally native（The new timbered soil of ginseng is not planted, it is miscellaneous using preceding Litter removal etc.
Matter, new forest land soil is pressed 2 with vermiculite according to volume ratio:1 ratio mixes）Load a diameter of 20 cm flowerpots, 1 kg of dress soil per basin.
In the same size and well-grown annual ginseng seedling is selected to be transplanted, per 4 plants of basin.Test group chaetomium globosum FSR-74
(bacteria containing amount is about 2 × 10 to zymotic fluid5 cfu·mL-1) 50 times of sterile mL pouring roots of water diluent 30, the sterile Ma Ling of control group
Potato glucose（PDB）50 times of sterile mL pouring roots of water diluent 30 of nutrient solution, often handle 6 basins, random alignment, and field management is same
Conventional production.After ginseng-leaf length to 30 d, treatment group and each 5 plants of control group ginseng-leaf are randomly selected respectively, carefully will be complete
Plant is dug out, and washes away root soil, measures its plant height, root long, whole strain fresh weight and root fresh weight index.Then 108 DEG C are dried to perseverance
Weight, surveys whole plant dry weight and root dry weight.
Results from pot experiment test shows (table 4), plants ginseng after inoculation chaetomium globosum FSR-74, its plant plant height, whole strain are fresh
Weight, root fresh weight, root long, whole plant dry weight and root dry weight have different degrees of increase compared with control group, wherein, chaetomium globosum FSR-74
Ginseng aerial stem of plant leaf portion divides dry weight and fresh weight of plant seedlings relatively to compare increase by 7% ~ 16% after processing, and the dry weight and fresh weight of plant seedlings of ginseng significantly increases compared with control treatment
33% ~ 38%, it was demonstrated that chaetomium globosum FSR-74 has significant facilitation to ginseng root growth（Figure 24）.Meanwhile also illustrate ball
Cupreum FSR-74 is safe to ginseng.
Facilitations of the chaetomium globosum FSR-74 of table 4 to Ginseng Growth
Field controling test of the chaetomium globosum FSR-74 bacterial strains of embodiment 10 to ginseng fungal disease
Destruction post spore bacterium to causing ginseng rust rot（Cylindrocarpon destructans）Controlling experiment in
It is arranged within 2014 Jilin Agriculture University's medicinal garden ginseng experimental field and carries out pot experiment.Will be naturally native（The new of ginseng is not planted
Timbered soil, using impurity such as preceding Litter removals, new forest land soil is pressed 2 with vermiculite according to volume ratio:1 ratio mixes）Dress
Enter a diameter of 20 cm flowerpots, 1 kg of dress soil per basin.Ginseng was transplanted April 17, was selected in the same size and well-grown 1 year
Stranger joins seedling and transplanted, per 4 plants of basin.After transplanting 30 d, post spore bacterium and ball hair are destroyed using hindering root perfusion while being inoculated with
Shell bacterium FSR-74 spore suspensions, amount containing spore are 2 × 105 cfu·mL-1, spore suspension liquid and preparation method thereof is with embodiment 3, respectively
Bacterial strain is 15 mL per each strain inoculum concentration of basin.Using 500 times of sterile water diluents of 50% carbendazol wettable powder as medicament pair
According to using sterilized water as blank control.6 basins are often handled, random alignment, irrigation and fertilization measurement management is the same as conventional production.United after being inoculated with 35 d
Occurring degree is counted, investigates disease index, investigation result such as table 5.
Ginseng alternaric bacteria to causing black fleck disease of ginseng（Alternaria panax）Controlling experiment in 2014 pacify
Jilin Agriculture University's medicinal garden ginseng experimental field is come to carry out.Will be naturally native（The new timbered soil of ginseng is not planted, is gone before use
Except impurity such as dry branches and fallen leaves, new forest land soil is pressed 2 with vermiculite according to volume ratio:1 ratio mixes）Load a diameter of 20 cm flowerpots,
1 kg of dress soil per basin.Ginseng was transplanted April 17, selected in the same size and well-grown annual ginseng seedling to be moved
Plant, per 4 plants of basin.After transplanting 30 d, ginseng alternaric bacteria and chaetomium globosum FSR-74 spores are inoculated with using acupuncture semar technique simultaneously
Suspension, amount containing spore are 2 × 105 cfu·mL-1, with embodiment 3, each bacterial strain connects spore suspension liquid and preparation method thereof per each strain of basin
Kind amount is 15 mL.Compareed by medicament of 500 times of sterile water diluents of 50% carbendazol wettable powder, using sterilized water as sky
White control.6 basins are often handled, random alignment, irrigation and fertilization measurement management is the same as conventional production.Occurring degree is counted after being inoculated with 35 d, is investigated
Disease index, investigation result such as table 5.
Note：Efficiency test computational methods：Disease index=[∑ (sick level strain number × typical value)/(total strain number × highest disease level
Typical value)] × 100, relative control effect (%)=(control disease index-processing disease index)/control disease index × 100
As shown in table 5, chaetomium globosum FSR-74 is to by the microbial ginseng rust rot of destruction post spore and by ginseng rod method
Microbial black fleck disease of ginseng has preferable preventive effect, and prevention effect is equal to or slightly better with the primary comparison medicament of above-mentioned disease（Figure 25,
26）.
Potted plant controlling experiments of the chaetomium globosum FSR-74 of table 5 to above-mentioned ginseng fungal disease
The Molecular Identification of the FSR-74 bacterial strains of embodiment 11
Using TaKaRa Universal Genomic DNA Extraction Kit Ver.3.0 kits（Precious biology
Engineering（Dalian）Co., Ltd, TaKaRa Code：DV811A）Carry out the extraction of ginseng biocontrol fungi genomic DNA.Voluntarily close
ITS universal primer sequences into fungi rDNA are ITS4：5'-TCCTCCGCTTATTGATATGC-3', ITS5：5'-
GGAAGTAAAAGTCGTA ACAAGG-3', using FSR-74 phage gene group DNA as template, carry out rDNA-ITS-PCR amplifications.
Reaction system（20 μL）It is as follows：2 × PCR Mix 10 μ L, ddH27.8 μ L, DNA Template of O 1 μ L, ITS4
0.6 0.6 μ L of μ L, ITS5.PCR amplification programs：94 DEG C of denaturation 3 min, 94 DEG C of denaturation 30 s, 56 DEG C of renaturation 30 s, 72
DEG C extension 30 s, 30 circulation, 72 DEG C extension 10 min.Pcr amplification product detects through 1% agarose gel electrophoresis, obtains one
The bp of bar 750 or so specific fragment, determines the fragment sequence（Using TIANGEN gel reclaims kits in raw work biology work
Journey（Shanghai）Limited company is sequenced）.As a result show, the DNA of FSR-74 bacterial strains is 604 bp, specific such as SEQ ID No:1
It is shown.The ITS sequence application BLAST softwares and DNAMAN softwares and Clustal-X that measure splicing software are analyzed, sent out
It is with FSR-74 bacterial strain similitude highests nowChaetomium globosum, homology reaches 99%.Utilize
MEGA5.10Beta2 softwares calculate bootstrap value with 1000 random samplings of UPGMA methods phylogenetic tree construction
(Bootstrap), according to MEGA5.10Beta2 softwares with UPGMA methods phylogenetic tree construction find, FSR-74 withChaetomium globosumBelong to a hereditary branch together, affiliation is sufficiently close to, and pro-borne has reached 99%.With reference to tradition
Morphological classification and modern molecular biology qualification result, the bacterial strain FSR-74 that can confirm that the present invention is chaetomium globosum
（Chaetomium globosum）.
Each case study on implementation is not the concrete restriction to the present invention above, as long as the scope limited according to claim, at this
Under the enlightenment of patent, with reference to the basic general knowledge of this area, the bacterial strain is used in the preventing and treating of ginseng fungal disease, belonged to
Protection scope of the present invention.
SEQ ID No:l
TTGTAAGTAAAATGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTC
CCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGG
CCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAA
GTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT
TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAG
CGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGG
CTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTT
AACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAACCCGGAGGAA
Claims (12)
1. one plant of chaetomium globosum (Chaetomium globosum) FSR-74, it is characterised in that its preserving number is CGMCC
No.9690。
2. chaetomium globosum FSR-74 as claimed in claim 1, it is characterised in that in potato dextrose agar flat board
Growth is slower during upper 25 DEG C of cultures, and bacterium colony is shallow brown, and olive is brown or sepia, tool canescence or olive brown aerial hyphae, the back side are brown
Color, often with olive brown exudate, colony edge often splits shape in irregular ripple；FSR-74 microstructure shows in 10 × 50 optics
Micro- Microscopic observation, ascocarp table life, is bonded to stromal surface with brown rhizoid, is under reflected light olive green to olive brown, falls
Avette to subsphaeroidal, 160~240 μm of diameter is high 220~300 μm；Ascocarp wall is made up of crineous textura intricata；Basidixed
Hair is a large amount of and intensive, meander-like, wavy or slightly crimp in the shape of a spiral, brown, has every base portion barrier film is more apparent, not branch, table
The intensive wart point of mask, base portion are wide 2.5~4 μm；Side setation meander-like, separate obvious；Ascus club-like, 27~36 × 11~15 μ
M, inside there is 8 ascospores, and ascus wall is easily cleared up；Ascospore lemon shape, two is flat-sided, and both ends respectively have an apicule, when ripe
Brown, 8.5~11 × 7~8.5 μm, has single basidixed germ pore；Potato dextrose agar formula is：Potato 200g/
L, glucose 10g/L, agar 15g/L, distilled water 1000mL, 2 μ g/mL penicillin, pH are 6.8~7.2.
3. applications of the chaetomium globosum FSR-74 as claimed in claim 1 or 2 in fungal diseases of plants is prevented and treated, its feature exist
In the plant is ginseng.
4. application as claimed in claim 3, it is characterised in that the fungi be fusarium solani (Fusarium solani),
Destroy post spore bacterium (Cylindrocarpon destructans), ginseng alternaric bacteria (Alternaria panax), found withered silk
Pyrenomycetes (Rhizoctonia solani), Phytophthora cactorum bacterium (Phytophthora cactorum), the pathogen of Botrytis cinerea (Botrytis
Cinerea Pers.) and 7 kinds of pathogens of Sclerotinia ginseng (Sclerotinia schinseng) in one or more.
5. the application as described in claim 3 or 4, it is characterised in that chaetomium globosum FSR-74 passes through competition, hyperparasite, generation
Antibacterial substance and to ginseng produce disease prevention growth-promoting effect reach antibacterial purpose.
6. a kind of microorganism formulation, it is characterised in that contain the complete of the chaetomium globosum FSR-74 spores described in claim 1 or 2
Nutrient solution and culture.
7. microorganism formulation as claimed in claim 6, it is characterised in that it is prepared by following preparation method：
(1) chaetomium globosum FSR-74 test tube slants kind is activated, takes 2 5mm pure culture biscuits involvng inoculations in bottled with 250mL triangles
In 100mL potato dextrose broths, 48h is cultivated at 170r/min, 25 DEG C, obtains seed liquor；
(2) chaetomium globosum FSR-74 seed liquors are inoculated in fermentation culture with 10% volume ratio and cultivated, in 170r/min, 25
96h is cultivated at DEG C, obtains nutrient solution；
(3) nutrient solution is filtered through 2 layers of sterile gauze, filtrate is counted through blood counting chamber, and spore suspension is dispersed into 6gL-1In carboxymethylcellulose sodium solution, spore suspension is obtained, spore content is 2 × 105cfu·mL-1；
(4) chaetomium globosum FSR-74 nutrient solutions are centrifuged into 20min in 8000r/mim, filtering, obtains zymotic fluid.
8. microorganism formulation as claimed in claim 7, it is characterised in that described potato dextrose broth is matched somebody with somebody
Fang Wei：Potato 200g/L, glucose 10g/L, distilled water 1000mL, pH are 6.8~7.2,121 DEG C of moist heat sterilization 30min, cooling
It is standby afterwards.
9. microorganism formulation as claimed in claim 7 or 8, it is characterised in that described potato dextrose broth
So prepare：It is put into after weighing 200g potato strippings and slicings in 1000mL water, boils to potato block and soften, filter to get filtrate, is filtered
Add 10g glucose in liquid fully to mix, constant volume, loading amount is 300mL nutrient solutions in 1000mL triangular flasks, is sealed with double-deck sealed membrane
Good triangle bottleneck, 121 DEG C of moist heat sterilization 30min, it is used to be inoculated with after cooling.
10. application of the microorganism formulation in ginseng fungal disease is prevented and treated as any one of claim 6-9.
11. application as claimed in claim 10, it is characterised in that the fungi is destruction post spore bacterium (Cylindrocarpon
) and the one or more in ginseng alternaric bacteria (Alternaria panax) destructans.
12. application as claimed in claim 11, it is characterised in that in ginseng fungal disease early stage, by the microorganism
The dilution of preparation is evenly applied in soil or is sprayed on axis leaf portion, microorganism formulation spore content in the dilution
For 2 × 105cfu·mL-1。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410796936.XA CN104694397B (en) | 2014-12-22 | 2014-12-22 | One plant of chaetomium globosum and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410796936.XA CN104694397B (en) | 2014-12-22 | 2014-12-22 | One plant of chaetomium globosum and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104694397A CN104694397A (en) | 2015-06-10 |
| CN104694397B true CN104694397B (en) | 2017-12-01 |
Family
ID=53341957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410796936.XA Active CN104694397B (en) | 2014-12-22 | 2014-12-22 | One plant of chaetomium globosum and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104694397B (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524841A (en) * | 2015-11-09 | 2016-04-27 | 潍坊学院 | Broad-spectrum chaetomium strain applied to biological control of plant diseases and applications of broad-spectrum chaetomium strain |
| CN106754396B (en) * | 2016-11-16 | 2019-08-16 | 河南省农业科学院 | A kind of Chinese toon endogenetic fungus TS8 and its secondary metabolite, preparation method and application |
| CN107318891A (en) * | 2017-01-18 | 2017-11-07 | 东北林业大学 | A kind of wettable powder for preventing and treating root rot |
| CN106962115A (en) * | 2017-04-05 | 2017-07-21 | 周兴虎 | A kind of method for improving willow resistance against diseases |
| CN107475123B (en) * | 2017-08-16 | 2020-02-11 | 中国人民解放军第二军医大学 | Anoectochilus roxburghii endophytic fungus and application thereof |
| CN110257262A (en) * | 2019-07-11 | 2019-09-20 | 江苏中科亚农生物工程有限公司 | A method of preparing microbe fertilizer microbial inoculum |
| CN110551637B (en) * | 2019-09-03 | 2020-11-27 | 黑龙江省农业科学院植物保护研究所 | Echinospora echinocandii from radix astragali root for efficiently inhibiting botrytis cinerea and application thereof |
| CN111096222B (en) * | 2019-12-26 | 2022-05-17 | 天津大学 | Method for improving content of ginsenoside in adventitious roots of ginseng by using immobilized chaetomium globosum spores |
| CN111944699B (en) * | 2020-07-27 | 2022-11-01 | 中国科学院成都生物研究所 | Chaetomium cupreum microbial inoculum and preparation method thereof |
| CN111869682B (en) * | 2020-08-18 | 2021-12-21 | 河南省农业科学院植物保护研究所 | Application of chaetomium globosum in preventing and treating wheat take-all |
| CN113234602B (en) * | 2021-04-01 | 2022-10-18 | 慕恩（广州）生物科技有限公司 | Chaetomium globosum, microbial inoculum, seed soaking liquid and application |
| CN113913300B (en) * | 2021-11-11 | 2023-09-22 | 河南省农业科学院植物保护研究所 | Method for producing chaetomium globosum spore liquid by straw fermentation and application |
| CN116240113B (en) * | 2023-02-08 | 2023-08-25 | 江苏农林职业技术学院 | Biocontrol bacterium JSNL-B47 for inhibiting strawberry anthracnose and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102311925A (en) * | 2011-08-03 | 2012-01-11 | 山东农业大学 | Endophytic fungi chaetomium globosum strain, microbial agent and application thereof |
| CN102742605A (en) * | 2012-06-06 | 2012-10-24 | 吉林大学 | Application of gingko endogeny Chaetomium globosum in prevention and control of plant pathogenic fungi |
-
2014
- 2014-12-22 CN CN201410796936.XA patent/CN104694397B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102311925A (en) * | 2011-08-03 | 2012-01-11 | 山东农业大学 | Endophytic fungi chaetomium globosum strain, microbial agent and application thereof |
| CN102742605A (en) * | 2012-06-06 | 2012-10-24 | 吉林大学 | Application of gingko endogeny Chaetomium globosum in prevention and control of plant pathogenic fungi |
Non-Patent Citations (3)
| Title |
|---|
| 两种毛壳茵对几种植物病原菌的生防效果分析;岳会敏等;《哈尔滨商业大学学报(自然科学版)》;20091031;593-596，特别是摘要，第1.1、2.3、2.4小节 * |
| 人参主要病原茵生防真菌的筛选及鉴定;肖春萍等;《西北农林科技大学学报(自然科学版)》;20160731;全文 * |
| 人参内生球毛壳菌株ＲSQMK-9 的化学成分研究;梁炜薇等;《天然产物研究与开发》;20140831;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104694397A (en) | 2015-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104694397B (en) | One plant of chaetomium globosum and its application | |
| CN104630071B (en) | Spore trichoderma and its application more than one plant | |
| CN105296381B (en) | One bacillus subtilis CYY-25 and its application | |
| CN105018366B (en) | Methylotrophic bacillus and its application | |
| CN108265012A (en) | A kind of Bei Laisi Bacillus strains and its microbial inoculum and application | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| CN113249242B (en) | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases | |
| CN102367421B (en) | Penicilliumgriseofulvum XJ-EP-058 strain as well as microbial preparation resisting banana vascular wilt and application thereof | |
| JP6560527B2 (en) | A novel microorganism with excellent antibacterial and plant growth promoting effects | |
| CN103952329A (en) | Bacillus vallismortis and application thereof | |
| CN106942301B (en) | A kind of botanical pesticide preparation of prevention and control rice blast and preparation method thereof | |
| CN106119136B (en) | Epicoccum nigrum and its application | |
| CN108148793A (en) | A kind of the bacillus polymyxa DYr4.4 and preparation method and application of broad-spectrum antibacterial activity | |
| CN102839131A (en) | Trichoderma viride and application thereof | |
| CN103184161B (en) | Biocontrol strain HTC for preventing pepper phytophthora blight and application thereof | |
| CN105132296B (en) | A kind of hook-shaped trichoderma strain and its application | |
| CN113913302A (en) | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria | |
| CN105154339A (en) | Trichoderma viride strain and application thereof | |
| CN105462850B (en) | Application of the sophora tonkinensis Gapnep endogenetic fungus SDTE-P in prevention and treatment notoginseng root rot | |
| CN107502570B (en) | One plant of Biocontrol Bacillus subtilis BJ-1 and its application | |
| CN109762752A (en) | One plant is killed streptomyces nodocus bacterial strain and its application | |
| CN105462854B (en) | Application of the sophora tonkinensis Gapnep endogenetic fungus SDTE-P in prevention and treatment Radix Notoginseng anthracnose | |
| CN105462893B (en) | Application of the sophora tonkinensis Gapnep endogenetic bacteria B29 in prevention and treatment notoginseng root rot | |
| CN104962501B (en) | A kind of preparation and application of the bacterial strain, antagonist of anti-vegetable and fruit gray mold | |
| CN113913303B (en) | Trichoderma pseudokoningii, root soaking solution and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |