CN104673931A - Method for rapidly determining site-specific DNA methylation - Google Patents
Method for rapidly determining site-specific DNA methylation Download PDFInfo
- Publication number
- CN104673931A CN104673931A CN201510144040.8A CN201510144040A CN104673931A CN 104673931 A CN104673931 A CN 104673931A CN 201510144040 A CN201510144040 A CN 201510144040A CN 104673931 A CN104673931 A CN 104673931A
- Authority
- CN
- China
- Prior art keywords
- dna
- primer
- measured
- reaction
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for rapidly determining site-specific DNA methylation and particularly discloses a method for simply and rapidly determining the site-specific CpG methylation, namely a method for detecting specific CpG site methylation by using a single base extension primer end labeling fluorescein nucleotide combined with fluorimetric polarization. The method has the advantages of simplicity, rapidness, high flux and low cost and is free of separation and purification, and is suitable for massively detecting the methylation of the clinical precious low-concentration DNA samples.
Description
Technical field
The invention belongs to biochemical field, in particular to a kind of method of Fast Measurement specific site DNA methylation.
Technical background
Each cell in human body all carries the encoding gene forming whole compositions needed for the person, but wherein only has a little part to be in enliven expression status.The epigenetic modification of gene, as isogenic switch, assists controlling gene active, to guarantee the Time and place selective expression that gene is being determined.This specific gene activity status information can be stored and heredity.DNA methylation is as a kind of important epigenetic modification mode, in mammalian genes group, main manifestations is 5-methylcytosine (5mC, 5-methyl-cytosine), and mostly occur at two adjacent cytosine(Cyt) (Cytosine, C) and on the C of guanine (Guanine, G) dinucleotides (CpG).In mammalian genes group, the CpG of 60% ~ 90% is methylated, the composition CpG island of a lot of CpG clusters, and multidigit, in the core sequence of structure gene promotor and transcripting start point, by the change of methylation level, participates in the expression regulation of gene.Research in recent years finds that the exception of DNA methylation exists relevant to a lot such as major disease such as tumour, mental disorder, and the methylation height in some gene CpG sites may become the pathogenetic potential mark of these diseases.The methylation state in the CpG site of rapid detection these and disease related gene, for Timeliness coverage and these diseases for the treatment of extremely important.
Carry out based on sodium bisulfite conversion and pcr amplification basis for gene specific CpG site DNA methylation assay is most at present.Genomic dna is received through bisulfite after process, and methylated C remains unchanged, but not methylated C changes uridylic (Uracil, U) and become T after pcr amplification.Like this C position, incomplete methylated CpG site is just become to the mixing of C/T, to the methylation level that quantitatively just can reflect this CpG site of C.At present conventional quantivative approach majority extends based on the mononucleotide of methylation specific primer to mark (Ms-SnuPE) [people such as Gonzalgo ML, Nat Protoc.2007; 2 (8): 1931-6], and then according to different marks separation is carried out with quantitative.Such as classical mass spectrum or Manganic pyrophosphate complex initiation method [people such as Colyer HA, Methods Mol Biol.2012; 863:281-92], although can measure methylating of multiple site, complicated operation, need instrument and equipment costly, cost is also higher; [people such as Xiong Z, Nucleic Acids Res.1997 need be separated by DNA glue based on restriction enzyme enzyme method or based on isotope-labelling method; 25 (12): 2532-4], then carry out quantitatively, although advantage of lower cost, need complicated separation or transfer step, cause quantitative result deviation comparatively large, also or relate to radio-labeling; Based on the detection methods such as biotin labeling or fluorescent mark energy trasfer (FRET) [people such as Feng F, Nat Protoc.2010; 5 (7): 1255-64], although add sensitivity, need the steps such as mark, purification and separation, add the complicacy of operation; Based on Real-time quantitative PCR [people such as Dugast-Darzacq C1, the Methods Mol Biol.2009 of fluorescent probe; 507:281-303], although improve the sensitivity of detection, due to probe length with specificly require high, can not all sites be detected.The deficiency that existing method exists, limits it in clinical and widespread use that is scientific research field.
Summary of the invention
For the above-mentioned defect existed in prior art, the invention provides a kind of easy, methylated method of Fast Measurement specific site CpG.Adopt the methylated method in special CpG site that single-basic extension prime end mark fluorescent element Nucleotide combined with fluorescent polarization (Fluorescence polarization, FP) detects.
In detection target organism sample of the present invention, the flow process of the method for the methylation level of specific sequence DNA as shown in Figure 1.
First the present invention relates to a kind of method detecting the methylation level of specific sequence DNA in target organism sample, and the method comprises the following steps:
Step (1), obtains biological specimen, and extracts the DNA fragmentation to be measured in sample;
Step (2), with sodium bisulfite process DNA to be measured, makes that methylated cytosine deamination does not occur in DNA to be measured and is transformed into uridylic;
Step (3), the DNA fragmentation be disposed with step (2) is for template DNA, from template DNA both sides, pcr amplification is carried out to template DNA respectively with the first primer and the second primer, the template DNA fragment of described first primer and the second primer amplification should contain the CpG site of DNA fragmentation to be measured, and the first primer and the second primer should be greater than the length of three-primer apart from the distance in CpG site to be measured, the length of the first primer and the second primer is 20 ~ 30bp, GC content 55-60%;
Step (4), the PCR primer of alkaline phosphatase to step (3) carries out digestion process, removes the first unnecessary primer, the second primer and dNTPs, and purifying reclaims;
Step (5), gets the PCR primer of step (4) purifying of equivalent respectively, carries out the single-basic extension labeled reactant that methylation specific three-primer guides in independent reaction system:
Reaction one, uses fluorescein dCTP in order to detect methylating of target CpG site;
Reaction two, uses fluorescein dUTP in order to detect the demethylation in target CpG site;
The sequence of described mark three-primer is combined with the corresponding complementary sequence specific of target CpG site upstream 20 ~ 30bp sequence of DNA to be measured, and length, at 22-25bp, does not contain CpG site;
Step (6), by step (5) reaction one or reaction two gained product on FP detector, the fluorescein dCTP fluorescence polarization value of assaying reaction one product respectively, react the fluorescein dUTP fluorescence polarization value of two products, calculate DNA methylation level to be measured according to dCTP fluorescence polarization value and dUTP fluorescence polarization value.
Described fluorescein dCTP or dUTP, its fluorescein-labelled group can be 5-carboxyfluorescein (FAM), 2'7'dimethoxy-4'5'-dichloro-6-carbosyfjuores-cein (JOI), rhodamine, 6-carboxy-rhodamine (R6G), 5/6-carboxytetramethylrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'-dimethylaminophenylazo) benzoic acid (DABCYL), or 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS).
DNA to be measured described in step (1) can derive from blood sample, pathology sample, and other organ or tissue's cell samples, described pathology sample is preferably tumor tissues sample, and described tumor tissues sample is preferably lung cancer, cancer of the stomach, liver cancer tissue sample.
DNA to be measured described in step (1) also can derive from recombinant DNA or synthetic DNA.
The reaction parameter of the sodium bisulfite process DNA to be measured described in step (2) is preferably:
1 μ g DNA and 0.3M NaOH to be measured hatches 20 minutes at 42 DEG C together, then 95 DEG C hatch 3 minutes and 0 DEG C hatch 1 minute; Next to receive (final concentration 5.0M) with the bisulfite of pH 5.0 and Resorcinol (final concentration 0.5mM) hatches 16 hours at 55 DEG C, and keep lucifuge.After process, DNA Promega Wizard DNA Clean System carries out purifying, and is dissolved in the NaOH of 0.3M, 37 DEG C hatch 15 minutes after be neutralized to pH7.0 with the ammonium acetate of 3M; The alcohol settling neutralized reaction product of 75%, and be dissolved in 20 μ l TE, be kept at-20 DEG C.
PCR reaction parameter described in step (3) is preferably,
15 μ l reaction systems comprise: the DNA after 1-2 μ l processes to step of hanging oneself (1), the primer 1 of 75nM and primer 2, the dNTPs of 50nM, 1X PCR damping fluid, and the Taq archaeal dna polymerase of 1 unit; Mixture was placed in 95 DEG C of reactions after 1 minute, carried out following 30 circulations: 95 DEG C are heated 1 minute, and 60 DEG C are heated 1 minute, and 72 DEG C are heated 1 minute.
The reaction parameter that the PCR primer of alkaline phosphatase described in step (4) to step (3) carries out digestion process is preferably,
Digestion is carried out in system in 37.5 μ l: 1 × alkaline phosphatase enzyme reaction buffer solution, 3.4 unit alkaline phosphatases, 2.3 unit exonucleases and 13 μ l PCR primer;
Mixture is placed in 37 DEG C of reactions 45 minutes, then within 15 minutes, makes enzyme deactivation in 85 DEG C of heating.
Single-basic extension labeled reactant parameter described in step (5) is preferably,
Reaction cumulative volume 15 μ l, containing 1.5 μ l step (4) products, 0.75 units Taq polymerase, 1XPCR Buffer, 3.75 μMs of three-primers, 1.125 μMs of fluorescein dCTP or 0.5625 μM of fluorescein dUTP;
Reaction conditions: 95 DEG C of sex change, after 3 minutes, carry out following 30 circulations: 95 DEG C of incubations 30 seconds, 55 DEG C of incubations 30 seconds.
The invention still further relates to the application of method in detection target dna methylates of the methylation level of specific sequence DNA in described detection target organism sample.
The present invention adopts highly sensitive fluorescein-labeled dCTP or dUTP, and in conjunction with sodium sulfite treatment and PCR and elongation technology at prime end mark fluorescent element, the fluorescence polarization amount of observing marker understands the methylation state in the target CpG site of DNA to be measured.
DNA methylation detection method provided by the present invention adopts the fluorescence polarization amount measuring marker to determine the methylation state of target CpG, overcome in the such as electrophoretic analysis of existing DNA methylation detection technique and need separation, purifying, the deficiency of complicated operation, there is easy, quick, high-throughput, low cost, without the need to advantages such as separation and purification, be applicable to detecting methylating of the lower concentration DNA sample of clinical preciousness in a large number.
Accompanying drawing explanation
Fig. 1, detection DNA methylation schema.
Fig. 2, embodiment 1 detection used DNA target CpG sequence.
Fig. 3, with primer 3 for detecting methylating of CpG1 in different mass genomic dna.
Fig. 4, with primer 4 for detecting methylating of CpG2 in different mass genomic dna.
Fig. 5, with primer 5 for detecting methylating of CpG3 in different mass genomic dna.
Fig. 6, turn to the result of the difference amount plasmid DNA of 25% for detecting CpG1 methyl with primer 3.
Fig. 7, turn to the result of the plasmid DNA of 0%, 20%, 25%, 40%, 60%, 80%, 100% for detecting CpG1 methyl with primer 3.
Fig. 8, application enzyme are cut/electrophoretic separation (COBRA) method and are detected the result that CpG1 methyl turns to the plasmid DNA of 0%, 20%, 25%, 40%, 60%, 80%, 100%.
Fig. 9, primer 3 are for detecting the methylated result of DNA methylation inhibitor AZA inducing tumor cell low DNA.
Figure 10, primer 3 are for detecting the result of different tumor cell gene group DNA methylation.
Specific embodiment
Following embodiment is convenient to better understand the present invention, but is not limited to the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Be research object with the LINE1 element (, for X58075, concrete sequence is as shown in SEQ ID NO.1, and CpG structure is shown in Fig. 2 for NCBI sequence number) in human genome in following embodiment, methylating of part CpG site, its promoter region is detected.
The application that embodiment 1. detects at human peripheral blood genomic DNA methylation level
The extraction of step (1), peripheral blood DNA:
Traditionally phenol/chloroform method extracting peripheral blood genomic dna.
Step (2), sodium bisulfite process:
1 microgram human peripheral blood DNA is used sodium bisulfite process, makes unmethylated cytosine deamination in described DNA to be measured become uridylic, be placed on-20 DEG C of preservations.
The reaction parameter of described sodium bisulfite process DNA to be measured is:
(1) 1 μ g DNA and 0.3M NaOH to be measured hatches 20 minutes at 42 DEG C together, then 95 DEG C hatch 3 minutes and 0 DEG C hatch 1 minute;
Next (2) to receive (final concentration 5.0M) with the bisulfite of pH 5.0 and Resorcinol (final concentration 0.5mM) hatches 16 hours at 55 DEG C, and keep lucifuge;
(3) after process, DNA Promega Wizard DNA Clean System carries out purifying, and is dissolved in the NaOH of 0.3M, 37 DEG C hatch 15 minutes after be neutralized to pH7.0 with the ammonium acetate of 3M;
The alcohol settling neutralized reaction product of (4) 75%, and be dissolved in 20 μ l TE, be kept at-20 DEG C.
Step (3), pcr amplification:
Primer 1 sequence: TTTTTTGAGTTAGGTGTGTGGG (SEQ ID NO.2)
Primer 2 sequence: CATCTCTAAAAAATACCAAACAA (SEQ ID NO.3)
PCR reaction conditions: 15 microlitre reaction systems comprise: the primer 1 of 75nM and primer 2, the dNTPs of 50nM, 1X PCR damping fluid, and the Taq archaeal dna polymerase of 1 unit; Mixture was placed in 95 DEG C of reactions after 1 minute, carried out following 30 circulations: 95 DEG C are heated 1 minute, and 60 DEG C are heated 1 minute, and 72 DEG C are heated 1 minute.
Step (4), carries out digestions process to remove unreacted primer and dNTPs to PCR primer.Enzyme is cut in system and is contained: 3.75 μ l 10 × alkaline phosphatase enzyme reaction buffer solution, 3.4 unit alkaline phosphatases, 2.3 unit exonucleases and 13 μ l PCR primer, mends to 37.5 μ l with deionized water.Mixture is placed in 37 DEG C of reactions 45 minutes, then within 15 minutes, makes enzyme deactivation in 85 DEG C of heating.
Step (5), the CpG1 site that single-basic extension labeled reactant detects in sequence methylates.Extend labeled reactant cumulative volume 15 μ l, containing the PCR primer of 1.5 μ l enzymic digestions, 0.75 units Taq polymerase, 1XPCR Buffer, 3.75 μMs of three-primers, 1.125 μMs of fluorescein dCTP or 0.5625 μM of fluorescein dUTP.Reaction conditions: 95 DEG C of sex change, after 3 minutes, carry out following 30 circulations: 95 DEG C of incubations 30 seconds, 55 DEG C of incubations 30 seconds.
Primer 3 sequence: GGTGGGAGTGATT
Step (6), fluorescence polarization flow measurement:
Product after extending mark is placed in direct its fluorescence polarization value of mensuration on FP detector, and excitation wavelength is 544nm, and emission wavelength is 595nm.
Interpretation of result:
Fig. 3 is from same sample, but uses the DNA of different concns when detecting.After the FP value of each DNA concentration point deducts zero-dose blank spot FP value, estimate site to be measured methylation level according to following formula:
Methylation level %=100 × FPdCTP/ (FPdCTP+FPdUTP)
As can be seen from Figure 3, within the scope of 20-100ng, the present invention utilizes the methylation level detected representation of three-primer to CpG1 to go out good stability, and its value is: 57.13 ± 0.26%
Fig. 4 is that use the 4th primer carries out single-basic extension (primer sequence is GAAAGGGAATTTTTTGATTTTTTG, SEQ ID NO.4) to the methylated detected result in CpG2 site, and this CpG site methylation level is: 67.06 ± 1.40%
Fig. 5 is that use the 5th primer carries out single-basic extension (primer sequence is TTTTTTAGGTGAGGTAATGTTT, SEQ ID NO.5) to the methylated detected result in CpG3 site, and this CpG site methylation level is: 84.11 ± 1.47%.
Embodiment 2, the methylated detection application of plasmid DNA
1, in the present embodiment, the synthetic method of plasmid used is as described below:
(1) PCR primer of case study on implementation 1 step (3) is connected on pMD-18T carrier by TA clone, by to the order-checking of transformant mono-clonal, the plasmid B (complete demethylation template) of the sequence filtering out CpG 1 to be the sequence of the plasmid A of C (exhaustive methylation template) and CpG1 be T.That is: the methylation level of CpG1 in plasmid A is 100%, and the methylation level in plasmid B is 0%.
(2) plasmid A and plasmid B is mixed according to mass ratio, thus C/ (C+T) % obtaining CpG1 is respectively the mixture of 0%, 20%, 25%, 40%, 60%, 80%, 100%.
2, pcr amplification:
With embodiment 1 step (3).
3, single-basic extension labeled reactant:
With embodiment 1 step (5), three-primer is utilized to carry out single-basic extension labeled reactant.
4, fluorescence polarization flow measurement:
With embodiment 1 step (6).
5, interpretation of result:
To be right CpG1 site be Fig. 6 25% to methylate the result that plasmid DNA detects.The present invention illustrates good stability to the DNA methylation assay of CpG 1 in different concns plasmid DNA.
The methylation of Fig. 7 to CpG1 site be 20%, 40%, 60%, 80% plasmid DNA detected result be respectively 25.649 ± 4.521%, 39.83 ± 3.877%, 53.270 ± 4.823%, 75.747 ± 2.231%.Detected result and actually have very high dependency.
Embodiment 3, enzyme cuts/and DNA glue is separated (COBRA) and detects methylating of CpG1 site
Adopt TaqI enzyme to cut in the present embodiment, then DNA glue is separated, and EB dyes, and quantitative method of taking pictures detects the plasmid DNA that the CpG1 site methylation that case study on implementation two makes is 0%, 20%, 25%, 40%, 60%, 80%, 100%.
The fragment that DNA to be measured produces through primer 1 and primer 2 pcr amplification is 250bp.In fragment, the sequence of the site exhaustive methylation of target CpG1 to be measured is TCGA, produces two fragments (Fig. 8) of 163bp and 87bp after TaqI digestion; And the sequence of this complete demethylation in CpG1 site is TTGA, cannot be digested by TaqI.Quantitative to digestion product 163bp and 87bp, then can calculate the methylation in this CpG1 site.
2, pcr amplification:
With embodiment 1 step (3), 0%, 20%, 25%, 40%, 60%, 80%, 100% in the case study on implementation one that increase respectively methylates plasmid DNA.
3, TaqI enzyme is cut quantitatively:
According to Dalian precious company's T aqI enzyme working conditions, hatch 6 hours 60 DEG C of water-baths.By digestion products after the agarose gel of the EB dyeing of 2% carries out electrophoretic separation, take pictures and the fragment of 250bp, 163bp and 87bp is carried out quantitatively.
4, interpretation of result:
Enzyme cuts/electrophoretic separation quantitative result: in the plasmid DNA to 20%, 40%, 60%, 80%, CpG1 DNA methylation assay result is respectively 25.649 ± 4.521%, 39.83 ± 3.877%, 53.270 ± 4.823%, 75.747 ± 2.231%.
By the correlation analysis that this result is carried out with the result that the present invention detects, as shown in Figure 8, present the very high degree of correlation (R2=0.9581, P<0.0001) therebetween.
Embodiment 4, to the hypomethylation DNA detection application of DNA methylation inhibitor induction
1, the extraction of cell cultures and genomic dna:
Human embryonic kidney cells HEK293 is cultivated in containing the DMEM nutrient solution of 10% foetal calf serum in 37 DEG C of incubators of 5%CO2, then according to described in document, utilize the DNA methylation inhibitor AZA of different concns (being respectively: 0 μM, 0.25 μM, 0.5 μM) to process cell, then extract cell genomic dna.
2, sodium bisulfite process:
With embodiment 1 step (2).
3, pcr amplification:
With embodiment 1 step (3).
4, single-basic extension labeled reactant:
With embodiment 1 step (5).
5, fluorescence polarization flow measurement:
With embodiment 1 step (6).
Fig. 9 shows, and the present invention can reduce methylating of LINE1 promoter region CpG1 after can detecting the AZA process cell of 0.25 and 0.5 μM.
Embodiment 5, to the application that multiple tumor cell line DNA methylation detects
1, extracting genome DNA:
The genomic dna of U87, M059K, A172, U2OS, T98G and 293T six kinds of tumour cells is extracted according to method described in case study on implementation one.
2, sodium bisulfite process:
With embodiment 1 step (2).
3, pcr amplification:
With embodiment 1 step (3).
4, single-basic extension labeled reactant:
With embodiment 1 step (5).
5, fluorescence polarization flow measurement:
With embodiment 1 step (6).
Figure 10 shows, the present invention is respectively the DNA methylation assay result in target CpG1 site in six kinds of tumor cell line DNA: U87 is 48.7% ± 1.7%, M059K is 41.4% ± 2.8%, A172 is 39.3% ± 0.6%, U2OS is 33.7% ± 3.0%, T98G is 30.9% ± 1.6%, 293T is 37.20% ± 4.1%.
Claims (9)
1. detect a method for the methylation level of specific sequence DNA in target organism sample, the method comprises the following steps:
Step (1), obtains biological specimen, and extracts the DNA fragmentation to be measured in sample;
Step (2), with sodium bisulfite process DNA to be measured, makes that methylated cytosine deamination does not occur in DNA to be measured and is transformed into uridylic;
Step (3), the DNA fragmentation be disposed with step (2) is for template DNA, carry out pcr amplification from template DNA both sides to template DNA respectively with the first primer and the second primer, the template DNA fragment of described first primer and the second primer amplification should contain the CpG site of DNA fragmentation to be measured;
Step (4), the PCR primer of alkaline phosphatase to step (3) carries out digestion process, removes the first unnecessary primer, the second primer and dNTPs, and purifying reclaims;
Step (5), gets the PCR primer of step (4) purifying of equivalent respectively, carries out the single-basic extension labeled reactant that following methylation specific three-primer guides in two independent reaction systems respectively:
Reaction one, uses fluorescein dCTP in order to detect methylating of target CpG site;
Reaction two, uses fluorescein dUTP in order to detect the demethylation in target CpG site;
Step (6), calculates DNA methylation level to be measured according to step (5) reaction product dCTP fluorescence polarization value and dUTP fluorescence polarization value.
2. method according to claim 1, it is characterized in that, described first primer and the second primer should be greater than the length of three-primer apart from the distance in CpG site to be measured, the length of the first primer and the second primer is 20 ~ 30bp, GC content 55-60%, the sequence of described three-primer is combined with the corresponding complementary sequence specific of target CpG site upstream 20 ~ 30bp sequence of DNA to be measured, and length, at 22-25bp, does not contain CpG site.
3. according to the arbitrary described method of claim 1 or 2, it is characterized in that, described fluorescein dCTP or fluorescein dUTP, its fluorescein-labelled group is 5-carboxyfluorescein (FAM), 2'7'dimethoxy-4'5'-dichloro-6-carbosyfjuores-cein (JOI), rhodamine, 6-carboxy-rhodamine (R6G), 5/6-carboxytetramethylrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'-dimethylaminophenylazo) benzoic acid (DABCYL), or 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS).
4., according to the arbitrary described method of claim 1 or 2, it is characterized in that,
DNA to be measured described in step (1) can derive from blood sample, pathology sample, organ or tissue's cell sample, and recombinant DNA or synthetic DNA;
Described pathology sample is preferably tumor tissues sample, and described tumor tissues sample is preferably lung cancer, cancer of the stomach, liver cancer tissue sample.
5., according to the arbitrary described method of claim 1 or 2, it is characterized in that, the reactions steps of the sodium bisulfite process DNA to be measured described in step (2) is:
Step (a) 1 μ g DNA and 0.3M NaOH to be measured hatches 20 minutes at 42 DEG C together, then 95 DEG C hatch 3 minutes and 0 DEG C hatch 1 minute;
Step (b) receives (final concentration 5.0M) with the bisulfite of pH 5.0 and Resorcinol (final concentration 0.5mM) hatches 16 hours at 55 DEG C, and keeps lucifuge;
After step (c) process, DNA Promega Wizard DNA Clean System carries out purifying, and is dissolved in the NaOH of 0.3M, 37 DEG C hatch 15 minutes after be neutralized to pH7.0 with the ammonium acetate of 3M;
The alcohol settling neutralized reaction product of step (d) 75%, and be dissolved in 20 μ l TE, be kept at-20 DEG C.
6., according to the arbitrary described method of claim 1 or 2, it is characterized in that, the PCR reaction parameter described in step (3) is preferably,
15 μ l reaction systems comprise: the DNA after 1-2 μ l processes to step of hanging oneself (1), the primer 1 of 75nM and primer 2, the dNTPs of 50nM, 1X PCR damping fluid, and the Taq archaeal dna polymerase of 1 unit;
Mixture was placed in 95 DEG C of reactions after 1 minute, carried out following 30 circulations: 95 DEG C are heated 1 minute, and 60 DEG C are heated 1 minute, and 72 DEG C are heated 1 minute.
7. according to the arbitrary described method of claim 1 or 2, it is characterized in that, the reaction parameter that the PCR primer of the alkaline phosphatase described in step (4) to step (3) carries out digestion process is preferably,
Digestion is carried out in system in 37.5 μ l: 1 × alkaline phosphatase enzyme reaction buffer solution, 3.4 unit alkaline phosphatases, 2.3 unit exonucleases and 13 μ l PCR primer;
Mixture is placed in 37 DEG C of reactions 45 minutes, then within 15 minutes, makes enzyme deactivation in 85 DEG C of heating.
8. according to the arbitrary described method of claim 1 or 2, it is characterized in that, single-basic extension labeled reactant parameter described in step (5) is preferably, reaction cumulative volume 15 μ l, containing 1.5 μ l step (4) products, 0.75 units Taq polymerase, 1XPCR Buffer, 3.75 μMs of three-primers, 1.125 μMs of fluorescein dCTP or 0.5625 μM of fluorescein dUTP;
Reaction conditions: 95 DEG C of sex change, after 3 minutes, carry out following 30 circulations: 95 DEG C of incubations 30 seconds, 55
dEG Cincubation 30 seconds.
9. in the arbitrary described detection target organism sample of claim 1-8 the methylation level of specific sequence DNA method detect target dna methylate in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510144040.8A CN104673931A (en) | 2015-03-30 | 2015-03-30 | Method for rapidly determining site-specific DNA methylation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510144040.8A CN104673931A (en) | 2015-03-30 | 2015-03-30 | Method for rapidly determining site-specific DNA methylation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104673931A true CN104673931A (en) | 2015-06-03 |
Family
ID=53309513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510144040.8A Pending CN104673931A (en) | 2015-03-30 | 2015-03-30 | Method for rapidly determining site-specific DNA methylation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673931A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017147946A1 (en) * | 2016-03-02 | 2017-09-08 | 上海易毕恩基因科技有限公司 | High-throughput sequencing method for methylated cpg island in trace dna |
| WO2020001416A1 (en) * | 2018-06-26 | 2020-01-02 | 深圳市圣必智科技开发有限公司 | Method for determining dna methylation level at specific site in biological sample and application thereof |
| CN112014446A (en) * | 2020-08-28 | 2020-12-01 | 武汉大学 | Electrochemical sensor for detecting gene methylation level based on terminal labeling strategy, and preparation method and detection method thereof |
| CN112725425A (en) * | 2021-02-02 | 2021-04-30 | 博淼生物科技（北京）有限公司 | Flight time mass spectrum multiple target DNA methylation site quantitative detection method |
| CN114182005A (en) * | 2021-10-29 | 2022-03-15 | 上海普然生物科技有限公司 | Detection kit for LINE-1 methylation detection and detection method and application thereof |
| WO2023077722A1 (en) * | 2021-11-03 | 2023-05-11 | 翌圣生物科技(上海)股份有限公司 | Nucleic acid-methylated cytosine conversion method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7611869B2 (en) * | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| CN103882114A (en) * | 2014-01-09 | 2014-06-25 | 华晶基因技术有限公司 | Method for detecting single nucleotide polymorphism or point mutation |
-
2015
- 2015-03-30 CN CN201510144040.8A patent/CN104673931A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7611869B2 (en) * | 2000-02-07 | 2009-11-03 | Illumina, Inc. | Multiplexed methylation detection methods |
| CN103882114A (en) * | 2014-01-09 | 2014-06-25 | 华晶基因技术有限公司 | Method for detecting single nucleotide polymorphism or point mutation |
Non-Patent Citations (2)
| Title |
|---|
| FUDE FENG ET AL.: "Fluorescent conjugated polymer-based FRET technique for detection of DNA methylation of cancer cells", 《NATURE PROTOCOLS》 * |
| GONZALGO ML ET AL.: "Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE)", 《NUCLEIC ACIDS RES》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017147946A1 (en) * | 2016-03-02 | 2017-09-08 | 上海易毕恩基因科技有限公司 | High-throughput sequencing method for methylated cpg island in trace dna |
| WO2020001416A1 (en) * | 2018-06-26 | 2020-01-02 | 深圳市圣必智科技开发有限公司 | Method for determining dna methylation level at specific site in biological sample and application thereof |
| CN112014446A (en) * | 2020-08-28 | 2020-12-01 | 武汉大学 | Electrochemical sensor for detecting gene methylation level based on terminal labeling strategy, and preparation method and detection method thereof |
| CN112725425A (en) * | 2021-02-02 | 2021-04-30 | 博淼生物科技（北京）有限公司 | Flight time mass spectrum multiple target DNA methylation site quantitative detection method |
| CN114182005A (en) * | 2021-10-29 | 2022-03-15 | 上海普然生物科技有限公司 | Detection kit for LINE-1 methylation detection and detection method and application thereof |
| WO2023077722A1 (en) * | 2021-11-03 | 2023-05-11 | 翌圣生物科技(上海)股份有限公司 | Nucleic acid-methylated cytosine conversion method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673931A (en) | Method for rapidly determining site-specific DNA methylation | |
| AU2007275140B2 (en) | Method for the detection of EGFR mutations in blood samples | |
| Jakupciak et al. | Mitochondrial DNA as a cancer biomarker | |
| JP2004524837A (en) | Detection of diagnostic methylated CpG rich sequences for malignant cells | |
| US9845495B2 (en) | Method and kit for detecting target nucleic acid | |
| US20150322515A1 (en) | Methods and compositions for detecting target snp | |
| US20140248611A1 (en) | Nucleic acid probe for assaying nucleic acids | |
| CN108251510A (en) | A kind of kit, detection method and its application of folic acid metabolism ability Genotyping | |
| CN101805790A (en) | Method for simultaneously detecting polymorphism of 32 SNP loci on 24 sports-related genes | |
| Huang et al. | High-throughput gender identification of three Columbidae species using melting curve analysis | |
| RU2760573C1 (en) | Set of oligonucleotide primers and fluorescently labelled probes for identifying the epigenetic markers of cervical cancer | |
| KR20110130638A (en) | Methods and kits for analyzing methylation of gene using pna mediated real-time pcr clamping | |
| EP1390529B1 (en) | Method of analysing dna methylation using fluorescence polarisation | |
| ES2564674T3 (en) | New complex mutations in the kinase domain of the epidermal growth factor receptor | |
| US20040161763A1 (en) | Fluroscence polarisation | |
| US20040248120A1 (en) | Detection of specific dinucleotides in dna-samples by fluorescence resonance energy transfer (fret) | |
| CN101210268B (en) | Kit for detecting mercaptopurine methyltransferase genetype and method thereof | |
| US9416423B2 (en) | Primer group for detecting CPG island methylation of P16 gene using methylation-specific fluorescence technique | |
| Liu et al. | One-step determination of deletion mutation based on loop-mediated isothermal amplification | |
| JP6269493B2 (en) | Method for acquiring information on brain tumor, and marker and kit for acquiring information on brain tumor | |
| WO2012070788A9 (en) | Method and kit for the quantification of nucleic acids | |
| WO2006121277A1 (en) | Fret probes for fluorescent detection of the epsps gene | |
| CN108342473A (en) | It is a kind of to be used to detect the kit that blood lipid metabolism related gene ABCG1 methylates | |
| CN110643702A (en) | Method for determining methylation level of DNA of specific site in biological sample and application thereof | |
| CN101983245B (en) | Kit and method for determining whether or not unmethylated cytosine conversion treatment is appropriately performed and method for analyzing methylated DNA using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150603 |