JP6269493B2 - Method for acquiring information on brain tumor, and marker and kit for acquiring information on brain tumor - Google Patents

Description

  The present invention relates to a method for acquiring information related to a brain tumor of a subject. The present invention also relates to markers and kits used in the method.

  A brain tumor is a general term for tumors that develop in the cranium, and is classified into a primary brain tumor that arises from the brain and surrounding tissues, and a metastatic brain tumor in which cancer of another organ has metastasized. There are various types of primary brain tumors, including malignant tumors and benign tumors. Among them, gliomas (also called gliomas), which are malignant tumors, have a high incidence of about 30% of all brain tumors. .

  In brain tumor testing, CT and MRI are used for image inspection. In addition, AFP (α-fetoprotein) and HCG (human chorionic gonadotropin) are also measured as a test for tumor markers in blood. However, these tumor marker tests are only applicable when the brain tumor is a germinoma. At present, no useful tumor marker has been found for brain tumors other than germinoma, and a simple test method for brain tumors has not been established.

  On the other hand, in recent years, methods based on genetic information have been studied as new cancer diagnosis methods. Examples of such a method include a method based on information on DNA methylation. In this method, a CpG site (5 ′-(CG) -3 ′) in the base sequence of a predetermined gene is used as a marker. Based on the analysis result of the methylation state of the marker, information such as the presence or absence of cancer cells is obtained, and cancer is diagnosed using this information as an index.

  Also in brain tumors, research and development of tumor determination methods using DNA methylation analysis are being conducted. For example, Bello MJ et al. Found that genes such as p16 (also called “CDKN2A”) are not methylated in normal brain samples, but are highly methylated in glioma biopsy samples. It is disclosed (see Non-Patent Document 1). Further, Gomori E. et al. Discloses that three genes, DNMT1, MGMT and EGFR, are highly methylated in glioma (see Non-Patent Document 2).

Bello M.J., et al., Cancer Therapy.vol. 2, p. 187-194 (2004) Gomori E. et al., Diagnostic Pathology.vol. 7: no. 8 (2012)

  As described above, several genes that exhibit abnormal methylation in brain tumors (particularly glioma) have been reported, but some of these genes are also methylated to some extent even in different types of tumors from brain tumors. It is included. However, when methylation analysis is performed using genes methylated in multiple types of tumors including brain tumors as markers, the information obtained from the analysis results includes not only information on brain tumors but also other types. Information about other tumors may also be included. For example, even if information that tumor cells are present in a sample is obtained based on the analysis results, it is difficult to determine whether the tumor cells are derived from brain tumors or other types of tumors. It is.

  Thus, in order to acquire information on brain tumors by methylation analysis of markers, the specificity of the markers to brain tumors is a very important factor. Therefore, it is desired to develop a novel marker specific to a brain tumor that makes it possible to specifically detect tumor cells derived from the brain tumor.

  Therefore, an object of the present invention is to provide a method for acquiring information related to a brain tumor by identifying such a novel marker and analyzing the methylation state of the marker. Moreover, an object of this invention is to provide the kit used suitably for the method.

  The present inventors have identified, as a novel marker, a gene region in which methylation is specifically observed in DNA obtained from a cancerous tissue of a brain tumor. Based on the results obtained by analyzing the methylation status of these markers, the present inventors differed from tumor cells derived from brain tumors and other cells (normal tissue cells and brain tumors). The present invention was completed by discovering that tumor cells derived from different types of tumors can be clearly distinguished.

That is, according to the present invention,
A step of preparing a DNA sample from a biological sample collected from a subject;
At least one gene selected from CREM (cAMP responsive element modulator), VRK2 (Vaccinia related kinase 2) and MYL12A (Myosin, light chain 12A, regulatory, non-sarcomeric) contained in the DNA sample obtained in the preparation process Analyzing the methylation status of the CpG site present in the promoter region;
A method for acquiring information related to a brain tumor is provided, including the step of acquiring information related to the brain tumor of the subject based on the analysis result obtained in the analysis step.

In addition, according to the present invention, there is provided a marker for obtaining information on brain tumors by methylation analysis, which is at least one selected from CpG sites present in the promoter region of each gene of CREM, VRK2 and MYL12A. The
Furthermore, according to the present invention, information on a brain tumor including a primer set for analyzing the state of at least one methylation selected from CpG sites present in the promoter region of each gene of CREM, VRK2 and MYL12A is obtained. Kits are provided for doing so.

  The present invention can provide a novel marker that enables acquisition of information related to a brain tumor. Moreover, this invention can provide the method and kit for acquiring the information regarding a test subject's brain tumor by analyzing the methylation state about such a marker.

It is a graph which shows the methylation positive rate of the promoter area | region of the CREM gene computed from the methylation data of the cancer part tissue of a brain tumor, and a normal brain tissue. It is a graph which shows the methylation positive rate of the promoter area | region of the VRK2 gene computed from the methylation data of the cancer part tissue of a brain tumor, and a normal brain tissue. It is a graph which shows the methylation positive rate of the promoter area | region of the promoter area | region of the MYL12A gene computed from the methylation data of the cancer part tissue of a brain tumor, and a normal brain tissue. It is a graph which shows the methylation positive rate of the promoter area | region of the CREM gene computed from the methylation data of various clinical specimens. It is a graph which shows the methylation positive rate of the promoter area | region of the VRK2 gene computed from the methylation data of various clinical specimens. It is a graph which shows the methylation positive rate of the promoter area | region of the MYL12A gene computed from the methylation data of various clinical specimens. It is a graph which shows the methylation positive rate of the promoter area | region of the known marker gene MGMT computed from the methylation data of various clinical specimens. It is a graph which shows the methylation positive rate of the promoter area | region of the known marker gene CDKN2A computed from the methylation data of various clinical specimens. It is a graph which shows the methylation score of the promoter area | region of the CREM gene in DNA extracted from the cancer part tissue of a normal brain tissue and a brain tumor. It is a graph which shows the methylation score of the promoter area | region of the VRK2 gene in DNA extracted from the normal brain tissue and the cancer part tissue of the brain tumor. It is a graph which shows the methylation score of the promoter area | region of the MYL12A gene in DNA extracted from the cancer part tissue of a normal brain tissue and a brain tumor. It is a photograph which shows the result of having amplified DNA extracted from the normal brain tissue and the cancer part tissue of the brain tumor by each methylation specific PCR (MSP) method using each primer set of CREM, VRK2, and MYL12A. It is a bar graph which shows the band intensity | strength of the amplification product obtained by amplifying DNA extracted from the peripheral blood of a brain tumor patient and a healthy person using the primer set (sequence number 12 and 13) of CREM by MSP method. It is a bar graph which shows the band intensity | strength of the amplification product obtained by amplifying DNA extracted from the peripheral blood of a brain tumor patient and a healthy person using the primer set (sequence number 14 and 15) of VRK2, and MSP method. It is a bar graph which shows the band intensity | strength of the amplification product obtained by amplifying DNA extracted from the peripheral blood of a brain tumor patient and a healthy person using the quality control primer set (sequence number 21 and 22) by MSP method. It is the schematic which showed an example of the determination apparatus for providing the information regarding a test subject's brain tumor. It is a block diagram which shows the function structure of the determination apparatus of FIG. It is a block diagram which shows the hardware constitutions of the determination apparatus shown by FIG. It is the flowchart of the determination for providing the information regarding a test subject's brain tumor using the determination apparatus shown by FIG.

  In the method for acquiring information related to brain tumor of the present invention (hereinafter also simply referred to as “method”), first, a DNA sample is prepared from a biological sample collected from a subject.

  The brain tumor targeted by the present invention is not particularly limited as long as it is a primary brain tumor, and examples thereof include glioma, meningioma, pituitary adenoma, and schwannoma. Among them, glioma is particularly suitable as the object of the method of the present invention. Glioma is classified into glioblastoma, astrocytoma, oligodendroglioma, ependymoma, medulloblastoma, etc., but is not particularly limited in the present invention.

  In the present embodiment, the biological sample is not particularly limited as long as it is a biological sample containing DNA of a subject, but is preferably a sample containing genomic DNA, for example, a clinical specimen. Examples of clinical specimens include body fluids, urine, tissues collected by surgery or biopsy, and the like. Examples of the body fluid include blood, serum, plasma, lymph, ascites, cerebrospinal fluid, bone marrow fluid, and nipple secretion. In addition, a culture obtained by culturing cells or tissues collected from a subject can also be used as a biological sample.

  Preparation of a DNA sample can be performed by extracting DNA from a biological sample. Methods for extracting DNA from biological samples are known in the art. For example, a biological sample and a treatment solution containing a surfactant (eg, sodium cholate, sodium dodecyl sulfate, etc.) that solubilizes cells or tissues are mixed, and physical treatment (stirring, homogenization, DNA can be extracted by performing ultrasonic crushing or the like to release DNA contained in the biological sample into the mixed solution. In this case, it is preferable to centrifuge the mixed solution to precipitate cell debris and use the supernatant containing the released DNA in the analysis step described later. The obtained supernatant may be purified by a method known in the art. The extraction and purification of DNA from a biological sample can also be performed using a commercially available kit.

The preparation step preferably further includes a step of fragmenting the extracted DNA. By fragmenting DNA into an appropriate length, the methylated DNA immunoprecipitation (MeDIP) method and the unmethylated cytosine conversion treatment described later can be performed efficiently.
DNA fragmentation can be performed by ultrasonic treatment, alkali treatment, restriction enzyme treatment, or the like. For example, when DNA is fragmented by alkali treatment, the DNA is fragmented by adding a sodium hydroxide solution to the DNA solution to a final concentration of 0.1 to 1.0 N and incubating at 10 to 40 ° C. for 5 to 15 minutes. It becomes. When DNA is fragmented by restriction enzyme treatment, the restriction enzyme to be used is appropriately selected based on the base sequence of the DNA, such as MseI or BamHI.

In the method of the present invention, the methylation state of the CpG site present in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A contained in the DNA obtained in the above preparation step is analyzed.
In the present specification, the “CpG site” means a site of a sequence in which cytosine (C) and guanine (G) in the base sequence are adjacent in this order in the 5 ′ to 3 ′ direction. . The letter “p” in CpG represents a phosphodiester bond between cytosine and guanine.
Further, in the present specification, “analyzing the methylation state” means analyzing the presence or absence of methylation of a CpG site present in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A, or It means analyzing the frequency of methylation of the promoter region.

  In this technique, the base sequences of promoter regions of CREM, VRK2 and MYL12A genes are known. These nucleotide sequences are publicly known, such as a database (http://www.ncbi.nlm.nih.gov/) provided by the National Center for Biotechnology Information (NCBI) of the US National Library of Medicine. You can know from the database. Various ID numbers of the above genes are shown in Table 1. In addition, the base sequence of the promoter region of each gene is shown as the sequence of SEQ ID NO: 1, 2 and 3, respectively (note that the base sequence of SEQ ID NO: 1 is a minus-strand sequence, and the base sequences of SEQ ID NO: 2 and 3 are Plus strand sequence).

  In the embodiment of the present invention, the analyzing step is a step of analyzing the presence or absence of methylation of at least one CpG site among CpG sites existing in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A. There may be. Here, “presence / absence of methylation” means whether cytosine at the CpG site present in the promoter region is methylated. In this embodiment, the number of CpG sites to be analyzed may be one, but it is preferable to analyze the presence or absence of methylation of a plurality of CpG sites. The plurality of CpG sites may be selected from a promoter region of one gene, or may be selected from each of the promoter regions of a plurality of genes.

In another embodiment of the present invention, the analyzing step may be a step of analyzing the frequency of methylation in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A. Here, the “frequency of methylation” means the ratio of the number of methylated CpG sites to the number of CpG sites present in the promoter region. In this embodiment, the analysis target may be the entire promoter region described above or a part including at least one CpG site. Note that the analysis target may include only one CpG site, but preferably includes a plurality of CpG sites. The analysis target may be determined from any one promoter region of the above genes, or may be determined from promoter regions of a plurality of genes.
Since the position and number of CpG sites existing in the promoter region of each gene of CREM, VRK2 and MYL12A are known, in the embodiment of the present invention, the number of methylated CpG sites in the promoter region itself is It can be used as the frequency of methylation.

  The methylation frequency may be a “methylation score” obtained by analyzing the methylation state of a CpG site in DNA by mass spectrometry such as MassARRAY (registered trademark) described later. In MassARRAY (registered trademark), a DNA fragment is measured, and a methylation score is calculated from an area ratio between a peak derived from a methylated DNA fragment and a peak derived from an unmethylated DNA fragment.

  In the embodiment of the present invention, there is no particular limitation on which CpG site (or a predetermined range including the CpG site) in the promoter region of each gene of CREM, VRK2 and MYL12A is to be analyzed. Can be determined as appropriate. Since the position and number of CpG sites existing in the promoter region of these genes are known, the CpG site or range to be analyzed can be determined by routine experiments using known analysis methods described below. it can.

  Various methods for analyzing the methylation state are known in the art. In the method of the present invention, which analysis method is used is not particularly limited, but preferably, a step of distinguishing methylated DNA from unmethylated DNA, a step of amplifying DNA, methylated DNA and / or Detecting unmethylated DNA.

Examples of the step of distinguishing methylated DNA from unmethylated DNA include a step of performing methylation sensitive restriction enzyme treatment, MeDIP method, unmethylated cytosine conversion treatment, and the like.
Examples of the step of amplifying DNA include a step of performing PCR method, quantitative PCR method, IVT (in vitro transcription) amplification method, SPIA (trademark) amplification method and the like.
Examples of the process for detecting methylated DNA and / or unmethylated DNA include a process for performing electrophoresis, sequence analysis, microarray analysis, mass spectrometry, Southern hybridization, and the like.

  The MeDIP method is a method of concentrating methylated DNA contained in a biological sample by immunoprecipitation using an anti-methylated cytosine antibody, an anti-methylated cytidine antibody, or an antibody that specifically recognizes a methylated DNA-binding protein. . In the embodiment of the present invention, the analysis step may be a step of concentrating methylated DNA contained in the DNA obtained in the extraction step by the MeDIP method and analyzing the methylation state of the obtained methylated DNA. . In addition, methylated DNA concentrated by the MeDIP method can be amplified by the IVT amplification method or the like, and the methylated state of the obtained amplification product can be analyzed using a microarray. Such an analysis method is called the MeDIP on chip method.

Unmethylated cytosine conversion treatment is a reaction between a DNA extracted from a biological sample and an unmethylated cytosine converting agent to convert the unmethylated cytosine in the DNA to another base (uracil, thymine, adenine or guanine). It is processing to convert to. Here, the unmethylated cytosine converting agent is a substance that can react with DNA to convert unmethylated cytosine in the DNA into another base (uracil, thymine, adenine or guanine). As such an unmethylated cytosine converting agent, for example, a bisulfite such as sodium sulfite, potassium salt, calcium salt, magnesium salt of bisulfite is preferably used.
In the treatment using bisulfite, unmethylated cytosine in DNA is converted to uracil by deamination reaction, but such base conversion does not occur in methylated cytosine.
Therefore, the difference in the methylation state of the CpG site in DNA is converted into a difference in base sequence (C and U) by unmethylated cytosine conversion treatment using bisulfite. In addition, the unmethylated cytosine conversion process by bisulfite is called a bisulfite process.

  When bisulfite treatment is performed, the addition amount (concentration) of bisulfite is not particularly limited as long as it can sufficiently convert unmethylated cytosine in DNA. For example, the final concentration in a solution containing DNA is 1M. As mentioned above, Preferably it is 1-15M, More preferably, it is 3-10M. The incubation conditions (temperature and time) after the addition of bisulfite can be appropriately set according to the amount of bisulfite added. For example, when bisulfite is added at a final concentration of 6 M, the incubation conditions are 50 to 80 ° C. Incubate for 10-90 minutes.

  The methylation state of the CpG site contained in DNA can be analyzed by sequencing the bisulfite-treated DNA and detecting the difference from the original base sequence. This method is called the bisulfite sequence method.

  Further, the methylation state of the CpG site can be analyzed by mass spectrometry. Specifically, using a bisulfite-treated DNA as a template, PCR amplification was performed using a primer set specific for the base sequence to be analyzed, and then the resulting PCR product was further IVT amplified to obtain methylated cytosine. And uracil become guanine (G) and adenine (A), respectively. The obtained IVT amplification product is cleaved with RNase A, and the mass difference (16 Da) between G and A between the obtained nucleic acid fragments is determined as a MALDI-TOF (Matrix Assisted Laser Desorption / Ionization-Time of Flight) mass spectrometer By detecting using the DNA, the methylation state of DNA can be analyzed. This method is called MassARRAY® analysis.

  It is known that the site cleaved by RNase A in the IVT product is between any base and uracil (U) or thymine (T) adjacent to the base. Therefore, the base sequence and mass of the IVT product cleaved by RNase A can be predicted from the base sequence of DNA used as a template. Therefore, for each peak obtained by MassARRAY (registered trademark), it can be identified from which part of the base sequence of DNA used as a template. For example, when one CpG site in the DNA fragment is methylated, the peak obtained with MassARRAY (registered trademark) shifts by 16 Da toward the high mass side. In the analysis of a DNA fragment having a plurality of CpG sites, for example, if the CpG site in the DNA fragment is methylated at 2 sites, it is shifted by 32 Da, and if it is methylated at 3 sites, it is shifted by 48 Da.

  In mass spectrometry such as MassARRAY (registered trademark), the methylation score of the measured DNA fragment can be calculated. For example, for a DNA fragment of a predetermined sequence, when the area ratio of the peak of the unmethylated DNA fragment to the peak of the methylated DNA fragment in the chart obtained by analysis is 1: 3, methylation of this DNA fragment The score is 0.75 from 3 / (1 + 3) = 0.75. Theoretically, the methylation score is 1 when all the CpG sites of the DNA fragment are methylated, and 0 when all the CpG sites are not methylated.

The methylation state of the CpG site can be analyzed by a methylation specific PCR (MSP) method. The MSP method is a method of analyzing the methylation status (presence / absence of methylation) of the CpG site by performing PCR amplification on the bisulfite-treated DNA using the primer set described below and confirming the presence or absence of the PCR product. It is.
In the MSP method, a base sequence in which the CpG site to be analyzed is methylated (ie, cytosine is not converted to uracil) can be amplified, but the CpG site is not methylated (ie, the cytosine is converted to uracil). Use a primer set that cannot amplify the converted base sequence. In the MSP method using such a primer set, it can be seen that the CpG site to be analyzed is methylated when a PCR product is present.
In addition, the MSP method cannot be used to amplify a base sequence in which cytosine at the CpG site to be analyzed is not converted to uracil, but a primer set that can amplify a base sequence in which cytosine at the CpG site is converted to uracil should be used You can also. In this case, it can be seen that the CpG site to be analyzed is methylated when no PCR product is present.

  Each primer included in the primer set used in the MSP method can be appropriately designed by those skilled in the art according to the base sequence including the CpG site to be analyzed, but the CpG site to be analyzed is located at or near the 3 ′ end of the primer. It is preferably designed to include cytosine.

  The methylation state of the CpG site can also be analyzed using a microarray. In this case, the analysis microarray can be prepared by immobilizing on the substrate a nucleic acid probe complementary to the nucleotide sequence of the promoter region of each gene of CREM, VRK2 and MYL12A. Such a microarray can be produced by a method known in the art.

  In analysis using a microarray, DNA extracted from a biological sample is preferably labeled with a labeling substance known in the art. Therefore, it is preferable that the determination method of the present invention further includes a step of labeling the extracted DNA. Since this labeling step can label all DNA in the biological sample, it is advantageous to be performed after the DNA amplification step. Examples of labeling substances include fluorescent substances, haptens such as biotin, radioactive substances, and the like. Examples of the fluorescent substance include Cy3, Cy5, FITC, Alexa Fluor (trademark) and the like. By labeling the DNA in this way, the signal from the probe on the microarray can be easily measured. A method for labeling DNA with these labeling substances is known in the art.

  The signal may be an appropriate signal depending on the type of microarray. For example, the signal may be an electrical signal generated when a DNA fragment hybridized with each probe of the microarray is present, or when the DNA to be analyzed is labeled as described above, a labeling substance Signals such as fluorescence and luminescence generated from The signal can be detected by a scanner provided in a normal microarray measurement apparatus. Examples of the scanner include GeneChip (registered trademark) Scanner 3000 7G (Affymetrix) and Illumina (registered trademark) BeadArray Reader (Illumina).

  In the method of the present invention, information relating to the brain tumor of the subject is acquired based on the analysis result obtained in the above analysis step. Here, the information regarding the brain tumor is not particularly limited as long as it is information that can serve as an index for diagnosis of the brain tumor, but is preferably information indicating the occurrence and / or state of the brain tumor in the subject. Such information includes, for example, the presence or absence of brain tumor-derived tumor cells in a biological sample collected from a subject, the possibility that a brain tumor has occurred in the subject, and the risk that a brain tumor will occur in the subject. In addition, when a brain tumor has occurred in the subject, information on the brain tumor includes the prognosis of the subject, the degree of progression of the tumor (stage), and the like. In addition, the information regarding the brain tumor acquired based on the analysis result obtained by said analysis process does not contain the information regarding the kind of tumor different from a brain tumor substantially. This is because the promoter region of the above gene used as a marker in the method of the present invention is specifically methylated in tumor cells derived from a brain tumor.

In an embodiment of the present invention, in the analysis step, when an analysis result indicating that there is a methylated CpG site is obtained, information indicating that a brain tumor has occurred, or the state of the brain tumor is poor (or , Bad) information can be acquired.
In another embodiment of the present invention, when the methylation frequency obtained in the analysis step is higher than a predetermined threshold or the same result as the threshold is obtained, such information may be acquired. it can.
More specifically, information that tumor cells derived from brain tumors are present in the biological sample can be acquired. Alternatively, information that the subject has a high risk of developing a brain tumor or information that a brain tumor has already occurred can be acquired. Further, if a brain tumor has occurred in the subject, information that the prognosis of the subject is poor (or bad), or information that the tumor state is a more advanced stage can be acquired.

  On the other hand, in the analysis process, when the result that there is no methylated CpG site is obtained, information indicating that no brain tumor has occurred or information indicating that the brain tumor is in good condition can be obtained. . Alternatively, such information can be acquired when a result that the frequency of methylation obtained in the analysis step is lower than a predetermined threshold is obtained. More specifically, information that tumor cells derived from brain tumors are not present in the biological sample can be acquired. Alternatively, information that the subject has a low risk of developing a brain tumor or information that a brain tumor has not yet occurred can be acquired. Further, if a brain tumor has occurred in the subject, information that the prognosis of the subject is good or information that the tumor state is not so advanced can be acquired.

  The predetermined threshold value is not particularly limited, and can be set empirically by accumulating data on various biological samples. Alternatively, a predetermined threshold value may be set as follows. First, for DNA extracted from each of biological samples (normal brain tissue or normal brain cells) that have been confirmed in advance not to contain tumor cells derived from brain tumors, and biological samples containing tumor cells derived from brain tumors, Analyze methylation frequency. Next, based on the obtained analysis result, a threshold value is set from a range that is higher than the methylation frequency of the biological sample that does not include tumor cells and lower than the methylation frequency of the biological sample that includes tumor cells. Preferably, a threshold value is set as a value capable of accurately distinguishing between a biological sample not containing tumor cells and a biological sample containing tumor cells.

The scope of the present invention includes a marker (hereinafter, also simply referred to as “marker”) for acquiring information related to a brain tumor by methylation analysis. The marker of the present invention is at least one selected from CpG sites present in the promoter region of each gene of CREM, VRK2 and MYL12A.
In the embodiment of the present invention, the methylation state of a marker in a DNA sample prepared from a biological sample collected from a subject can be analyzed, and information related to the brain tumor of the subject can be acquired based on the obtained analysis result. The analysis of methylation status and the acquisition of brain tumor information are the same as described above.

  The scope of the present invention also includes a kit for acquiring information related to brain tumor (hereinafter also simply referred to as “kit”). The kit of the present invention comprises a primer set for analyzing the state of at least one methylation selected from CpG sites present in the promoter region of each gene of CREM, VRK2 and MYL12A.

  In the embodiment of the present invention, the primer set included in the kit is used to determine the methylation state of the CpG site by an analysis method involving PCR amplification such as mass spectrometry such as MassARRAY (registered trademark), MSP method, bisulfite sequencing method, etc. A primer set for analysis may be used, but a primer set used in mass spectrometry such as MassARRAY (registered trademark) or MSP method is preferable. The base sequence of each primer included in the primer set can be appropriately set by those skilled in the art according to the base sequence of the promoter region. For example, a primer set that is the base sequence of SEQ ID NO: 4 and SEQ ID NO: 5, a primer set that is the base sequence of SEQ ID NO: 6 and SEQ ID NO: 7, a primer set that is the base sequence of SEQ ID NO: 8 and SEQ ID NO: 9, and SEQ ID NO: 12 And a primer set that is the base sequence of SEQ ID NO: 13, a primer set that is the base sequence of SEQ ID NO: 14 and SEQ ID NO: 15, and a primer set that is the base sequence of SEQ ID NO: 16 and SEQ ID NO: 17.

  The present invention also includes a system suitable for providing information regarding brain tumors in a subject. Such a system is, for example, as follows.

A computer comprising a processor and memory under control of the processor;
The memory has the following steps:
Obtaining an analysis result of the methylation state of the CpG site present in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A contained in the subject-derived DNA sample;
Based on the obtained analysis results, a computer program for causing the computer to execute the step of providing information on the brain tumor of the subject is recorded.
A system suitable for providing information about brain tumors in subjects.

  The present invention also includes a computer program product for causing a computer to provide information on brain tumors in a subject. Such a computer program product is, for example, as follows.

A computer-readable medium,
The medium includes the following steps:
Obtaining an analysis result of the methylation state of the CpG site present in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A contained in the subject-derived DNA sample;
Based on the obtained analysis results, a computer program for causing the computer to execute the step of providing information on the brain tumor of the subject is recorded.
A computer program product that causes a computer to provide information about brain tumors in a subject.

  Hereinafter, an embodiment of an apparatus suitable for carrying out the method of the present invention will be described with reference to the drawings. However, the present invention is not limited only to this embodiment. FIG. 7 is a schematic diagram illustrating an example of a determination device for providing information related to a brain tumor of a subject. The determination apparatus 1 shown in FIG. 7 includes a measurement apparatus 2 and a computer system 3 connected to the measurement apparatus 2.

  In the present embodiment, the measuring device 2 is a MALDI-TOF mass spectrometer. This measuring device 2 acquires mass spectrometry information such as the flight time and mass-to-charge ratio (m / z value) of the test substance. When a measurement sample prepared from a DNA sample derived from a subject is set in the measurement device 2, the measurement device 2 acquires mass spectrometry information of the nucleic acid contained in the measurement sample, and the obtained mass spectrometry information is stored in the computer system 3. Send to.

  When analyzing the methylation state by the MSP method, the measuring device 2 may be a gel imaging device such as a fluorescence image scanner. In this case, when the reaction solution subjected to nucleic acid amplification by the MSP method is subjected to gel electrophoresis and the gel after electrophoresis is set in the measuring device 2, the measuring device 2 detects the amplification product. Then, the measuring device 2 acquires the band intensity data of the amplification product and transmits the obtained data to the computer system 3.

  The computer system 3 includes a computer main body 3a, an input device 3b, and a display unit 3c that displays sample information, determination results, and the like. The computer system 3 receives mass spectrometry information from the measuring device 2. Then, the processor of the computer system 3 executes a program that provides information related to the brain tumor in the subject based on the mass spectrometry information.

  FIG. 8 is a block diagram showing a functional configuration of the determination apparatus shown in FIG. As illustrated in FIG. 8, the computer system 3 includes an acquisition unit 301, a storage unit 302, a calculation unit 303, a determination unit 304, and an output unit 305. The acquisition unit 301 is connected to the measurement apparatus 2 via a network so that communication is possible. The calculation unit 303 and the determination unit 304 constitute a control unit 306.

  The acquisition unit 301 acquires information transmitted from the measurement device 2. The storage unit 302 stores a threshold and a formula for calculating a methylation score necessary for determination. The calculation unit 303 calculates the methylation score according to the formula stored in the storage unit 302 using the information acquired by the acquisition unit 301. The determination unit 304 determines whether the methylation score calculated by the calculation unit 303 is lower than the threshold value stored in the storage unit 302. The output unit 305 outputs the determination result by the determination unit 304 as information on the brain tumor of the subject (for example, the presence or absence of cancer cells derived from the brain tumor in the biological sample collected from the subject).

  FIG. 9 is a block diagram showing a hardware configuration of the determination apparatus shown in FIG. As shown in FIG. 9, the computer main body 3a includes a CPU (Central Processing Unit) 30, a ROM (Read Only Memory) 121, a ROM 32, a hard disk 33, an input / output interface 34, a reading device 35, and a communication. An interface 36 and an image output interface 37 are provided. A CPU 30, a ROM 31, a RAM (Random Access Memory) 32, a hard disk 33, an input / output interface 34, a reading device 35, a communication interface 36 and an image output interface 37 are connected by a bus 38 so that data communication is possible.

  The CPU 30 can execute computer programs stored in the ROM 31 and computer programs loaded in the ROM 32. Each functional block described above is realized by the CPU 30 executing the application program. Thereby, a computer system functions as a terminal as a determination apparatus for providing the information regarding a test subject's brain tumor.

  The ROM 31 is configured by a mask ROM, PROM, EPROM, EEPROM, or the like. The ROM 31 stores a computer program executed by the CPU 30 and data used therefor.

  The ROM 32 is configured by SRAM, DRAM, or the like. The ROM 32 is used for reading computer programs recorded in the ROM 31 and the hard disk 33. The ROM 32 is also used as a work area for the CPU 30 when executing these computer programs.

  The hard disk 33 is installed with an operating system to be executed by the CPU 30, a computer program such as an application program (a computer program for providing information related to a subject's brain tumor), and data used for executing the computer program.

  The reading device 35 includes a flexible disk drive, a CD-ROM drive, a DVD-ROM drive, and the like. The reading device 35 can read the computer program or data recorded on the portable recording medium 40.

  The input / output interface 34 includes, for example, a serial interface such as USB, IEEE1394, RS-232C, a parallel interface such as SCSI, IDE, IEEE1284, and an analog interface including a D / A converter, an A / D converter, and the like. It is configured. An input device 3 b such as a keyboard and a mouse is connected to the input / output interface 34. The operator can input data to the computer main body 3a by using the input device 3b.

  The communication interface 36 is, for example, an Ethernet (registered trademark) interface. The computer system 3 can transmit print data to the printer via the communication interface 36.

  The image output interface 37 is connected to a display unit 3c configured with an LCD, a CRT, or the like. Thereby, the display part 3c can output the video signal according to the image data given from CPU30. The display unit 3c displays an image (screen) according to the input video signal.

  Next, a processing procedure for providing information related to the brain tumor of the subject by the determination apparatus 1 will be described. FIG. 10 is a flowchart for providing information related to a brain tumor using the determination apparatus shown in FIG. Here, the peak area is calculated from the mass spectrometry information of the nucleic acid contained in the measurement sample prepared from the subject-derived DNA sample, the methylation score is calculated from the obtained peak area, and the obtained methylation score is the threshold value. The case where it is determined whether it is lower than the above will be described as an example. However, the present invention is not limited only to this embodiment.

  First, in step S <b> 1-1, the acquisition unit 301 of the determination device 1 acquires mass spectrometry information from the measurement device 2. Next, in step S <b> 1-2, the calculation unit 303 calculates a peak area from the mass spectrometry information acquired by the acquisition unit 301 and transmits the peak area to the storage unit 302. In step S <b> 1-3, the calculation unit 303 calculates a methylation score based on the peak area stored in the storage unit 302 according to the formula stored in the storage unit 302.

  Thereafter, in step S <b> 1-4, the determination unit 304 determines whether or not the methylation score calculated by the calculation unit 303 is lower than the threshold value stored in the storage unit 302. Here, when the methylation score is lower than the threshold value, the process proceeds to step S1-5, and the determination unit 304 displays a determination result indicating that the biological sample collected from the subject has no brain tumor-derived cancer cells. The data is transmitted to the output unit 305. In addition, when the methylation score is not lower than the threshold value (that is, when the methylation score is equal to or higher than the threshold value), the output unit 305 outputs a determination result indicating that the biological sample collected from the subject has brain tumor-derived cancer cells. Send to.

  In step S1-7, the output unit 305 outputs the determination result as information on the brain tumor of the subject, and displays it on the display unit 3c or prints it on a printer. Thereby, it is possible to provide a doctor or the like with information that assists in determining whether the subject has a brain tumor or not.

  EXAMPLES Hereinafter, the present invention will be described in detail by examples, but the present invention is not limited to these examples.

Reference Example 1: Identification of a new marker using methylation data of cancerous tissue and normal brain tissue of brain tumor (1) Acquisition of methylation data In this reference example, cancerous tissue (283 samples) of brain tumor and normal brain tissue (2 specimens) Infinium HumanMethylation27 BeadChip (Illumina) methylation data published on TCGA (The Cancer Genome Atlas: http://tcga-data.nci.nih.gov/tcga/tcgaHome2.jsp) I got it.

(2) Identification of new markers
The Infinium HumanMethylation27 BeadChip is provided with a methylation probe and an unmethylation probe for each of 27,578 CpG sites in the CpG site on the human genome. In this reference example, the signal intensity (signal M) of the methylation probe at the CpG site and the signal intensity (signal U) of the non-methylation probe are detected by the BeadArray Reader, and the CpG region of each gene is calculated using the following formula: The methylation rate (mCpG) was calculated.
(MCpG) = (Signal M) / (Signal M) + (Signal U)

For the methylation rate (mCpG) value of each gene obtained, set the threshold value to “0.4” and select a sample with a methylation rate value equal to or higher than this threshold value as “methylation positive sample. " Based on the number of methylation positive specimens, gene methylation positive rates (%) in various tissues were calculated by the following formula.
Methylation positive rate (%) = (number of methylation positive samples / total number of samples) x 100

For example, in the case of cancer tissue samples, the gene methylation positive rate is calculated by “(number of methylation positive samples / total number of cancer tissue samples among cancer tissue samples) × 100”. When a statistically significant difference was observed between the cancer tissue sample and the normal brain tissue sample, the gene was used as a marker for methylation observed in the cancer tissue.
As a result of data mining using Infinium HumanMethylation27 BeadChip (Illumina), the promoter region of each gene of CREM, VRK2 and MYL12A was identified as a marker with high methylation observed in the cancerous tissue of brain tumor (FIGS. 1A to 1). C). Hereinafter, these markers are also called markers of the present invention.

Reference Example 2: Comparison of methylation data in multiple types of cancer / tumor-derived cancer / tumor tissue samples, non-cancerous tissue samples and normal tissue samples (1) Acquisition of methylation data In this reference example, reference example 1 In addition to the indicated cancerous tissue (283 samples) and normal brain tissue (2 samples) of the brain tumor, methylation of 9 types of cancer / tumor tissue samples, 7 types of non-cancerous tissue samples and 12 types of normal tissue samples The data were compared. The number of specimens in each tissue is shown in the following table.

Among the above specimens, cancer tissue specimens derived from gastric cancer, cancer tissue specimens derived from hepatocellular carcinoma, non-cancerous tissue specimens derived from hepatocellular carcinoma, normal tissue specimens derived from normal liver, 11 types of normal tissue specimens, In the same manner as in Reference Example 1, methylation data measured by Infinium Methylation Assay using Infinium HumanMethylation27 BeadChip (Illumina) was obtained. For other specimens, see TCGA (The Cancer Genome Atlas: http://tcga-data.nci.nih.gov/tcga/tcgaHome2.jsp), or lung cancer, prostate cancer, and 93 healthy human peripheral blood specimens below. The methylation data of Infinium HumanMethylation27 BeadChip (Illumina) published in the above literature was obtained. The methylation data referred to here is the methylation rate (mCpG) of the CpG region of CREM, VRK2 and MYL12A obtained as described in (2) of Reference Example 1 above.
・ Lung cancer: Selamat SA et al., Genome-scale analysis of DNA methylation in lung adenocarcinoma and integration with mRNA expression. Genome Res. Jul; 22 (7): 1197-211 (2012).
・ Prostate cancer: Kobayashi Y et al., DNA methylation profiling reveals novel biomarkers and important roles for DNA methyltransferases in prostate cancer. Genome Res. Jul 21 (7): 1017-27 (2011)
・ Data of healthy human peripheral blood 93 donation: Salhia B et al., DNA methylation analysis determines the high frequency of genic hypomethylation and low frequency of hypermethylation events in plasma cell tumors. Cancer Res. Sep 1; 70 (17): 6934-44 ( 2010).

(2) Comparison of methylation positive rate in multiple types of cancer / tumor-derived cancer / tumor tissue specimens, non-cancerous tissue specimens and normal tissue specimens For the methylation rate (mCpG) value of each gene, A sample having a methylation rate value equal to or higher than this threshold value was defined as a “methylation positive sample”. Based on the number of methylation positive specimens, the methylation positive rate (%) of the marker of the present invention in various tissues was calculated by the above formula. The results are shown in FIGS. In FIG. 2, “normal tissue” refers to normal tissue excluding 93 healthy human peripheral blood samples (Salhia B et al.) Among the tissues shown in Table 4, and “normal blood” refers to normal human peripheral blood. Represents 93 blood samples (Salhia B et al.).

  2A to C, all of the markers of the present invention showed no high methylation in other types of cancer, and normal human tissues and normal human blood (healthy human peripheral blood, Salhia B et al.). It was found to be specifically and highly methylated.

Comparative Example 1: Comparison of methylation positive rates in multiple types of cancer / tumor-derived cancer / tumor tissue samples, non-cancerous tissue samples, and normal tissue samples It is already known that the tumor cells derived from brain tumors are methylated For each of the MGMT and CDKN2A genes (hereinafter referred to as “known markers”), the methylation positive rate in each tissue was calculated in the same manner as in Reference Example 2. The results are shown in FIGS. 3A and B.

  From FIGS. 3A and B, both MGMT and CDKN2A have a high positive rate of cases in brain tumors, but methylation is detected in other types of cancer and other non-cancerous tissues. Low. Therefore, the known marker has high sensitivity as a brain tumor marker, but has low specificity. Therefore, known markers have many problems in performance as diagnostic markers for brain tumors. That is, it was shown that it is necessary to conduct a marker search in consideration of specificity in other types of cancer and other non-cancerous tissues.

Example 1: Comparison of methylation data (MassARRAY) in normal brain and brain tumor (1) Biological sample In this example, normal brain tissue (1 sample) and cancerous tissue of brain tumor (8 samples) are used as the biological sample. It was.

(2) Preparation of measurement sample and control sample (i) Extraction of genomic DNA Genomic DNA was extracted from each of the above tissues using the QIAamp DNA Mini Kit (QIAGEN). Genomic DNA contained in the obtained DNA solution was fragmented with Bioruptor (COSMO BIO). Further, in order to prepare a calibration curve in mass spectrometry, human peripheral blood lymphocyte genomic DNA was used as a control genomic DNA. The genomic DNA of this human peripheral blood lymphocyte was amplified using GenomiPhi v2DNA amplification kit (GE Healthcare Life Science). The obtained amplification product consists of unmethylated DNA. Subsequently, the amplified product was fragmented by Bioruptor (manufactured by COSMO BIO) to obtain a solution of an unmethylated DNA fragment (0% methylated DNA). A portion of the solution of this unmethylated DNA fragment is taken and reacted with SssI methylase (New England Biolab) to methylate all cytosines in the CG sequence to obtain a methylated DNA fragment (100% methyl). Solution). Then, a 0% methylated DNA solution and a 100% methylated DNA solution were mixed at a predetermined ratio to obtain 25%, 50% and 75% methylated DNA solutions.
(Ii) Bisulfite treatment Each DNA fragment (500 ng) obtained above was bisulfite treated using EZ DNA Methylation Kit (Zymo Research), and the treated genomic DNA was sterilized distilled water (80 μl). Eluted.
(Iii) Amplification by PCR and IVT Methylated cytosine and uracil contained in each bisulfite-treated DNA fragment were converted to guanine and adenine, respectively, by the PCR method and the IVT amplification method.
It has been confirmed by MassARRAY (registered trademark) analysis using a control sample described later that the primer set used in the PCR method can amplify both methylated DNA and unmethylated DNA without bias. Table 5 shows the primer set sequences for the markers of the present invention. In addition, regarding the promoter regions of the CREM, VRK2 and MYL12A genes, the base sequences of the regions analyzed by the primer sets shown in Table 5 are shown in SEQ ID NOs: 18 to 20, respectively (the base sequence of SEQ ID NO: 18 is a minus strand) And the base sequences of SEQ ID NOs: 19 and 20 are positive strand sequences).

The following tag sequence and T7 promoter sequence are added to the 5 ′ ends of the forward primer and reverse primer of the above primer set, respectively, for the IVT reaction.
Tag array: AGGAAGAGAG (SEQ ID NO: 10)
-T7 promoter sequence: CAGTAATACGACTCACTATAGGGAGAAGGCT (SEQ ID NO: 11)

A PCR reaction solution was prepared by mixing the following reagents.
10x Hot Star buffer (QIAGEN) 0.5μL
25 mM dNTP mix 0.04 μL
Hot Star Taq (5U / μl) (QIAGEN) 0.04μL
Primer mix 2.0μL
DNA solution 1.0 μL
Water 1.42μL
Total 5μL

About said reaction liquid, PCR reaction was performed on condition of the following.
1 cycle at 94 ° C for 15 minutes,
45 cycles of 94 ° C for 20 seconds, 52 ° C for 30 seconds and 72 ° C for 1 minute,
3 minutes at 72 ° C.

Each obtained PCR product was dephosphorylated using SAP (Shrimp Alkaline Phosphatase) contained in the MassCLEAVE ™ Reagent kit (SEQUENOM). Subsequently, the following reaction liquid prepared using said kit was added to these.
5x T7 R & DNA polymerase buffer 0.89μL
T Cleavage mix 0.24μL
100 mM DTT 0.22 μL
T7 R & DNA polymerase 0.44μL
RNase A 0.06μL
RNase-free water 3.15 μL
Total 5μL

  The resulting mixture was incubated at 37 ° C. for 3 hours to perform IVT reaction and uracil or thymine specific cleavage reaction. Each reaction product obtained was purified by Clean Resin (SEQUENOM) to obtain a sample for mass spectrometry. About these samples, the sample derived from the genomic DNA extracted from the above-mentioned clinical specimen was used as a measurement sample, and the sample derived from the control genomic DNA was used as a control sample for mass spectrometry described later.

(3) Analysis of methylation state by mass spectrometry using MassARRAY (registered trademark) (i) Preparation of calibration curve Mass spectrometry of the control sample obtained above was carried out independently twice. From the obtained analysis results, a calibration curve for each primer set was created, and a correlation coefficient was calculated. Thereby, it was confirmed that the used primer set can be amplified to both methylated DNA and unmethylated DNA without bias.
(Ii) Analysis of measurement sample Mass analysis of the measurement sample obtained above was performed to obtain a peak of a DNA fragment contained in the measurement sample. Next, it was identified which part of the base sequences of CREM, VRK2 and MYL12A each peak obtained. For the fragments derived from the same base sequence, the methylation score was calculated from the area ratio of the peak of the fragment containing the methylated CpG site and the peak of the fragment not containing the methylated CpG site. The results are shown in FIGS.

  4A to 4C, it was confirmed that the methylation scores of CREM, VRK2 and MYL12A were low in normal brain tissue and remarkably high in brain tumors. Similar to the result of the Infinium method of Reference Example 1, it was shown that the methylation score of the marker of the present invention correlates with the brain tumor. Further, FIG. 4 shows that in the analysis of the methylation frequency using the marker of the present invention, it is possible to set a threshold value capable of distinguishing between a brain tumor specimen and a normal brain tissue specimen.

Example 2: Comparison of methylation data (MSP) in normal brain and brain tumor (1) Biological sample In this example, as a biological sample, the same normal brain tissue (one specimen) and brain tumor cancer as in Example 1 above. Tissue (8 specimens) was used.

(2) Preparation of measurement sample and control sample (i) Extraction of genomic DNA Genomic DNA was extracted from each of the above tissues using the QIAamp DNA Mini Kit (QIAGEN). Genomic DNA contained in the obtained DNA solution was fragmented with Bioruptor (COSMO BIO).
Further, human peripheral blood lymphocyte genomic DNA was used as a control genomic DNA. The genomic DNA of this human peripheral blood lymphocyte was amplified using GenomiPhi v2DNA amplification kit (GE Healthcare Life Science). The obtained amplification product consists of unmethylated DNA. Subsequently, the amplified product was fragmented by Bioruptor (manufactured by COSMO BIO) to obtain a solution of an unmethylated DNA fragment (0% methylated DNA). A portion of the solution of this unmethylated DNA fragment is taken and reacted with SssI methylase (New England Biolab) to methylate all cytosines in the CG sequence to obtain a methylated DNA fragment (100% methyl). Solution).
(Ii) Bisulfite treatment Each DNA fragment (500 ng) obtained above was subjected to bisulfite treatment using EZ DNA Methylation Kit (Zymo Research), and the treated genomic DNA was sterilized distilled water (80 μl) Eluted.

(3) Methylation specific PCR (MSP)
MSP was performed using the measurement sample and control sample (DNA after bisulfite treatment) obtained in (2) above. The PCR reagent composition, primer set and PCR reaction conditions used in MSP are shown below.
<PCR reagents>
DDW (sterile water) 16.8μL
10 × PCR buffer with MgCl ₂ (Roche) 2.5μL
2mM dNTP mix 2.5μL
10 μM sense primer 1.0 μL
10 μM antisense primer 1.0 μL
Faststart Taq polymerase (Roche) 0.2μL
Sample for measurement or control sample 1.0 μL
Total 25μL

<Primer set>
Table 6 shows primer sets used in the above MSP. These are primer sets that can obtain an amplification product when the DNA of the region to be amplified is methylated. In addition, a primer set for determining whether or not the bisulfite treatment was appropriately performed was also used as a quality control primer set (see Table 7). Regarding the promoter regions of the CREM, VRK2 and MYL12A genes, the nucleotide sequences of the regions analyzed with the primer sets shown in Table 6 are shown as SEQ ID NOs: 23 to 25, respectively (the nucleotide sequence of SEQ ID NO: 23 is a minus strand) And the base sequences of SEQ ID NOs: 24 and 25 are positive strand sequences).

<PCR reaction conditions>
6 minutes at 95 ° C
Y cycle for 30 seconds at 95 ℃, 30 seconds at X ℃, 30 seconds at 72 ℃,
7 minutes at 72 ° C
Leave at 16 ° C.
In the above reaction conditions, “X” and “Y” represent the annealing temperature and the number of cycles shown in Tables 6 and 7, respectively.

(4) Result analysis of methylation specific PCR (MSP) The amplification product obtained by the above-mentioned MSP was confirmed by 2% agarose gel electrophoresis. The results are shown in FIG. In the figure, “0” and “100” shown as “control” represent a 0% methylated control sample and a 100% methylated control sample, respectively.

  As shown in FIG. 5, bands appeared in all lanes by PCR using the quality control primer set. This shows that the bisulfite treatment of the sample was performed appropriately. PCR for the markers of the present invention did not detect bands derived from methylated CpG in normal brain tissue. On the other hand, in the brain tumor tissue, CREM, VRK2 and MYL12A detected bands in 8 out of 8 cases, 7 out of 8 cases, and 7 out of 8 cases, respectively. As described above, the methylation analysis of the marker of the present invention by the MSP method showed that the methylation of the marker of the present invention and the brain tumor correlated with the results of the Infinium method of Reference Example 1. That is, it was suggested that CREM, VRK2 and MYL12A are highly specific markers that are highly methylated in brain tumors but not detected in other normal tissues.

Example 3 Methylation Analysis by MSP Method Using Blood Sample In this example, methylation analysis was performed on CpG sites in CREM and VRK2 promoter regions by MSP using peripheral blood as a biological sample.
(1) Biological Sample In this example, peripheral blood (8 samples) collected from a brain tumor patient was used as the biological sample. Moreover, healthy human peripheral blood (3 samples) was used as a control sample.

(2) Preparation of measurement sample (i) Extraction of genomic DNA Plasma was obtained from each of the above peripheral blood (2 ml) by a conventional method. Genomic DNA was extracted from each plasma obtained using QIAamp Circulating Nucleic Acid Kit (QIAGEN).
(Ii) Bisulfite treatment Each DNA fragment (500 ng) obtained above was subjected to bisulfite treatment using EZ DNA Methylation Kit (Zymo Research), and the treated genomic DNA was sterilized distilled water (80 μl) Eluted.

(3) MSP
Qualitative MSP was performed using the measurement sample obtained in (2) above. The composition of PCR reagents used and the PCR conditions are shown below. The base sequences of the primer sets (CREM, VRK2, and accuracy control) used in this example are shown in Table 6 and Table 7.
<PCR reagents>
DW (sterile water) 10.88μL
10 × PCR buffer with MgCl ₂ (Roche) 1.5μL
10mM dNTP mix 0.3μL
10μM sense primer 0.6μL
10μM antisense primer 0.6μL
Faststart Taq polymerase (Roche) 0.12μL
Sample for measurement 1.0μL
Total 15μL

<PCR reaction conditions>
6 minutes at 95 ° C
Y cycle for 30 seconds at 95 ℃, 30 seconds at X ℃, 30 seconds at 72 ℃,
7 minutes at 72 ° C
Leave at 16 ° C.
In the above reaction conditions, “X” and “Y” represent the annealing temperature and the number of cycles shown in Table 8, respectively.

(4) Result analysis of MSP The amplification product obtained by the above-mentioned MSP was confirmed by 2% agarose gel electrophoresis. The band intensity of each amplification product was represented by a graph (see FIGS. 6A to 6C). In FIGS. 6A and B, the bar graph displayed as the peripheral blood of a healthy person corresponds to the background and indicates that no band is detected. 6A and 6B, as a result of PCR for CREM and VRK2, it was found that no band was detected in the peripheral blood of healthy individuals, and a band could be detected in 7 out of 8 cases in the peripheral blood of brain tumor patients. . In addition, by combining CREM and VRK2, bands were detected in all 8 cases, and the high performance of the marker of the present invention was shown. FIG. 6C shows that bands were detected in all samples by PCR using the primer set for quality control. This indicates that the bisulfite treatment of the sample was properly performed. Thus, it was found that the marker of the present invention showed a high methylation tendency in brain tumor patients even when peripheral blood was used as a biological sample, and methylation was not detected in healthy individuals. Therefore, it was suggested that the marker of the present invention is a marker highly specific for brain tumors, and is useful for determining the presence or absence of cancer cells derived from brain tumors in blood samples.

DESCRIPTION OF SYMBOLS 1 Determination apparatus 2 Measuring apparatus 3 Computer system 3a Computer main body 3b Input device 3c Display part

Claims (7)

Preparing a DNA sample from a blood sample collected from the subject;
Analyzing the methylation state of the CpG site present in the promoter region of at least one gene selected from CREM, VRK2 and MYL12A contained in the DNA sample obtained in the preparation step;
A method of acquiring information related to a brain tumor, comprising: acquiring information related to a brain tumor of the subject based on an analysis result obtained in the analysis step.   The method according to claim 1, wherein the brain tumor is glioma.   The analysis step is a step of analyzing a methylation state of a CpG site existing in a promoter region represented by at least one base sequence of SEQ ID NOs: 18, 19, 20, 23, 24 and 25. The method described in 1.   The method according to any one of claims 1 to 3, wherein the analysis step is a step of analyzing the presence or absence of methylation of at least one CpG site. Information regarding the brain tumor of the subject is the presence or absence of tumor cells derived from the brain tumor in a blood sample collected from the subject,
The method according to claim 4, wherein the information acquisition step is a step of acquiring information that a tumor cell derived from a brain tumor is present in a blood sample when an analysis result indicating that a methylated CpG site is present is obtained. .   The method according to any one of claims 1 to 3, wherein the analyzing step is a step of analyzing the frequency of methylation. Information regarding the brain tumor of the subject is the presence or absence of tumor cells derived from the brain tumor in a blood sample collected from the subject,
The information acquisition step is a step of acquiring information that a tumor cell derived from a brain tumor is present in the blood sample when the methylation frequency obtained in the analysis step is higher than a predetermined threshold.
The method of claim 6.