CN104673705B - One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application - Google Patents
One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application Download PDFInfo
- Publication number
- CN104673705B CN104673705B CN201410778424.0A CN201410778424A CN104673705B CN 104673705 B CN104673705 B CN 104673705B CN 201410778424 A CN201410778424 A CN 201410778424A CN 104673705 B CN104673705 B CN 104673705B
- Authority
- CN
- China
- Prior art keywords
- bacillus amyloliquefaciens
- wheat
- wheat scab
- plant
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/07—Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
Abstract
The invention belongs to plant disease technical field, it is related to one plant and prevents and treats the Bacillus amyloliquefaciens strain of wheat scab and its application.The bacillus amyloliquefaciens S76 3 that the present invention is separated, preserving number is CCTCC NO：M2014315；Its 16S rDNA nucleotides such as SEQ ID NO：Shown in 1.Disclose separation, identification, the broad-spectrum antibacterial effect of the bacterial strain, spore production fermentation optimization and prevent and treat the Field information of wheat scab.The liquid bacterial agent of the bacillus amyloliquefaciens fermentation dilution of the present invention can effectively suppress the generation and harm of wheat head blight, reduce the generation of toxin in the wheat head.The strong stress resistance of the bacterial strain, microbial inoculum is few to environmental hazard, can make efficient biocontrol agent, and bacillus amyloliquefaciens antimicrobial spectrum of the invention is wide, can suppress the growth of 10 kinds of plant pathogenic fungis including Fusarium graminearum, with good development and application prospect.
Description
Technical field
The invention belongs to plant disease technical field, and in particular to one plant prevent and treat wheat scab solution starch gemma
Bacillus and its application, the present invention relates to one plant of screening for preventing and treating wheat scab bacillus amyloliquefaciens S76-3, identification, fermentation
Test and its prevent and treat the Field information of wheat scab.
Background technology
Wheat is the cereal crops of cultivated area maximum in the world, and its total output is the second in the world, is only second to corn.At me
State, wheat is only second to paddy rice as main cereal crops, its sown area.By Fusarium graminearum (Fusarium
Graminearum wheat scab caused by) infecting is a kind of destructive disease on wheat, and wheat scab is called reddish tone
Wheat, the generation and propagation of disease are conducive in the environmental condition of warm moist.Head blight reported first in 1884 in England,
To early in the twentieth century, in the area such as Asia, Europe, North America, South America, also report occurs in succession.In the 1990s, Wheat And Barley is red
Mildew is up to 3,000,000,000 dollars in yield caused by the U.S. and mass loss.It is that the southern area of wheat is especially long in Wheat in China head blight
The serious plant disease of river In The Middle And Lower Reaches.In recent years, repeatedly occur in the Huang-Huai-Hai plain area of wheat, the northwest area of wheat and Northeasten Spring Wheat Area of China red
Being very popular for mildew, causes huge economic loss, drastically influence the grain security and food security of domestic wheat main producing region.
The generation of head blight not only reduces the yield of wheat, and a variety of mycotoxins are produced while pathogen infection wheat seed, wraps
Trichothecene (trichothecenes) and zearalenone (zearelanone) etc. are included, people and animals cause a variety of after eating by mistake
Adverse reaction, such as nauseous, vomiting, diarrhoea etc., death can be caused when serious.
The preventing and treating of wheat scab relies primarily on chemical prevention.Due to the long-term recycling of chemical agent, it result in tight
The environmental pollution and ecological disruption of weight, also result in and gradually increase with drug-fast pathogen.Compared with wild-type strain, many bacterium
The lethal dose of 50 (EC50) of clever resistant strain is the former as many as 10 times, while the Toxin producing C of resistant strain is significantly more than non-anti-
Property bacterial strain.The decrease of prevention effect causes the preventing and treating of head blight more and more difficult, how effective on the premise of environmental protection
It is the matter of utmost importance studied at present to prevent and treat head blight.
The biological pesticide kind that China registers at present is used for the medicine of biological control plant disease close to kind more than 140
Product negligible amounts, and be used for preventing and treating plant rhizosphere disease.Gained bacillus amyloliquefaciens are extensive in nature in this research
In the presence of its gemma produced has strong stress resistance, reproduction speed fast, to heat, ultraviolet, electromagnetic radiation and some chemicals etc.
It is nontoxic to people and animals with stronger resistance, it is free from environmental pollution.Available for wheat florescence disease caused by preventing and treating Fusarium graminearum
Evil.Also there is obvious inhibiting effect to other 9 kinds of plant pathogenic fungis simultaneously, the later stage can carry out field as biological and ecological methods to prevent plant disease, pests, and erosion fungicide
Using.
The content of the invention
It is an object of the invention to for the difficult problem of wheat scab florescence disease control, utilize micro-biological process
Develop the bacillus amyloliquefaciens S76-3 that plant height effect prevents and treats wheat scab.One kind is made using the bacillus amyloliquefaciens
Wheat scab microbial bacterial agent (biocontrol agent) is prevented and treated, to overcome the problem of disease control of wheat scab florescence is difficult.
The purpose of the present invention also includes verifying efficient suppression of the bacillus amyloliquefaciens to Fusarium graminearum mycelia and spore
Make and use.
Further relate to the fermentation medium of the high yield gemma suitable for bacillus amyloliquefaciens S76-3 fermenting and producings.
In the last of the present invention, application of the microbial bacterial agent of the invention prepared in wheat scab is prevented and treated is further related to,
Including the Field information of wheat scab florescence disease.
Realize that technical scheme is as described below：
Applicant is by micro-biological process, from Chinese Wuhan City, Hubei Province Assessment In Shizishan Region Hua Zhong Agriculture University head blight
The lighter wheat wheat head of collection morbidity in the serious experimental plot of morbidity, therefrom isolated one plant has good anti-to wheat scab
Control the bacillus amyloliquefaciens of effect.Applicant is named as bacillus amyloliquefaciens S76-3, Bacillus
Amyloliquefaciens S76-3, Chinese Wuhan Wuhan Universitys Chinese Typical Representative is delivered on July 3rd, 2014 by the bacterial strain
Organism Depositary (CCTCC) preservation, its preserving number is CCTCC NO：M 2014315.
Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain S76-3 mycology feature：
S76-3 bacterial strain Gram's staining is positive, thalline rod-short, and size is the μ of 0.5 μm~1.0 μ m 2.0 μm~5.0
M, peritrichous.Gelatin liquefaction, milk are peptonized, Starch Hydrolysis, Tween80 hydrolysis, cellulose utilization, citrate production alkali test
It is the positive, produces H2S experiment for feminine gender, can using glucose, fructose, sucrose, lactose, xylose, arabinose, mannose,
Maltose, inositol, sorbierite production acid, it is impossible to produce acid using rhamnose, there is tolerance to 5%-7% (w/v) NaCl, it is right
10% (w/v) NaCl does not have can not grow at tolerance, 51 DEG C.
Our the 16S rDNA to S76-3 bacterial strain bacterial strains are identified, its nucleotide sequence such as sequence table SEQ ID
NO:Shown in 1.
We devise a kind of special culture of fermentation tested and compare the bacteria fermentation production suitable for S76-3 bacterial strains
Base, culture medium composition is as follows：Brown sugar 23.3g/L, bean powder 11.1g/L, CaCO34.9g/L, KNO38g/L, KH2PO40.5g/L,
K2HPO41.2g/L, MgSO4·7H2O 5g/L, NaCl 3g/L, adjust pH to 7.2.Using the fermentation special culture media of the present invention,
It is that 30 DEG C of cultures cultivate S76-3 bacterial strains 48 hours, gemma number is up to 1010More than cfu/ml, zymotic fluid is after dilution or passes through
Formulation technique (being conventional process), such as be that can be made into wettable powder by the conventional carrier of addition, either using liquid
Body preparation or solid pharmaceutical preparation are used equally for the field control of wheat scab.
The beneficial effects of the invention are as follows：
(1) the bacillus amyloliquefaciens S76-3 that the present invention is separated is wheat endophyte, good with environmental safety, to people
With animal non-hazardous, it can be used as green bactericide.
(2) the bacillus amyloliquefaciens S76-3 that the present invention is separated there is obvious suppression to make sickle-like bacteria mycelia and spore
With while the bacterial strain has broad-spectrum antibacterial effect, the growth of various plants disease fungus can be suppressed, before potential application
Scape.
More detailed description is shown in《Embodiment》.
Brief description of the drawings：
Sequence table SEQ ID NO：1 is the 16S rDNA for the bacillus amyloliquefaciens S76-3 that the present invention is separated sequence.
Fig. 1：The colonial morphology after 24h is cultivated on NA culture mediums for bacillus amyloliquefaciens S76-3.
Fig. 2：For inhibitory action results of the bacillus amyloliquefaciens S76-3 to the mycelial growth of Fusarium graminearum 5035.In Fig. 2
A be Fusarium graminearum control；B in Fig. 2 is the co-cultivation of Fusarium graminearum and bacterial strain S76-3.
Fig. 3：For bacillus amyloliquefaciens S76-3 scanning electron microscope (SEM) photograph.
Fig. 4：For bacillus amyloliquefaciens S76-3 transmission electron microscope picture.
Fig. 5：Developed for the 16s rDNA sequential systems of bacillus amyloliquefaciens S76-3 bacterial strains and other sibling species bacterial strains
Tree.
Fig. 6：Sterile supernatant (suction filtration sterilizing) is fermented to the spore germination of sickle-like bacteria 5035 for bacillus amyloliquefaciens S76-3
Inhibitory action." CK " in Fig. 6 is the " S76- in sprouting state of the spore of Fusarium graminearum 5035 in YPG culture mediums, Fig. 6
3 " be S76-3 fermentation sterile supernatant YPG culture mediums dilute 2 successively, 3,4,5,10,20,50 times of (volume ratio) post processing spores
The sprouting state of son.
Fig. 7：Dilute and the suppression of the mycelia of sickle-like bacteria 5035 is made for bacillus amyloliquefaciens S76-3 fermentation supernatants after 50 times
With.A in Fig. 7 is sickle-like bacteria mycelia ultimate swelling, Fig. 7 after thalline in YPG culture mediums is handled through S76-3 fermented supernatant fluids
In B be sickle-like bacteria mycelia normal growth without the processing of S76-3 fermented supernatant fluids in YPG culture mediums.Scale on figure is 50 μ
m。
Fig. 8：The field plot trial design sketch of wheat scab is prevented and treated for bacillus amyloliquefaciens S76-3 zymotic fluids.Fig. 8
In " S76-3 microbial inoculums " be wheat incidence after wheat (peace agriculture 8455) early flowering season sprinkling S76-3 fermentation dilutions, Fig. 8
In " water control " be wheat after early flowering season sprinkling running water onset state, " carbendazim " in Fig. 8 is early flowering season sprinkling business
The wheat onset state of the carbendazol wettable powder (being used by 750g/ hectares of consumption) of product.
Embodiment
The separation and screening of the antagonistic strain of embodiment 1
Picked up from the present invention relates to Antagonistic Fungi separation material in Assessment In Shizishan Region Hua Zhong Agriculture University of Wuhan City of Hubei China province
The wheatland of wheat is continuously planted for many years, and the wheat wheat head for the falling ill lighter progress chosen in the serious wheat paddock of head blight morbidity is short of money
The separation of antibacterial.Collect fresh wheat head running water to rinse 2-4 times, be cut into 3-5mm fragments with the scissors sterilized afterwards and be placed in and grind
In alms bowl, added according to each wheat head and homogenate is ground to form after 10ml sterilized waters, draw 1ml homogenate, using 10 times of volume ratios successively
It is diluted to 10-4、10-5、10-6.Dilution containing bacterium is obtained, 10 are taken-6100 μ l dilutions containing bacterium of diluted concentration are coated on PDA plate
On, each three repetitions of processing, 28 DEG C are cultivated after 24h, and the single bacterium colony line of picking phenotypic difference is incubated at NA culture mediums.Pass through
Analysis, bacillus is initially identified as by the bacterial strain of the separation.
Antagonistic Fungi S76-3 screening uses plate opposite culture.Fusarium graminearum (is isolated from Wuhan head blight morbidity wheat
Fringe) it is inoculated in PDA culture medium (culture medium prescription is shown in Table 3) surface.28 DEG C of cultures prepare fresh mycelia in 3 days.Use 5mm card punch
Fresh Fusarium graminearum mycelia block is taken, PDA plate center is inoculated in.3 points equidistant at its surrounding 3cm are inoculated with respectively simultaneously
24h bacterium single bacterium colony is cultivated, is handled using the PDA plate for being only inoculated with Fusarium graminearum mycelia block as control, each in triplicate.
It is all to handle in being cultivated 5 days at 28 DEG C, detect the bacteriostasis rate of strains tested.By above-mentioned screening, one plant is obtained to cereal reaping hook
Bacterium has a bacterial strain S76-3 (Fig. 2) of obvious antagonism, and its bacteriostasis rate is up to 62%, and inhibition zone is clear and neat in edge, antibacterial effect
Fruit is substantially.
The antagonistic strain S76-3 of embodiment 2 mycology identification
(1) Morphological Identification of S76-3 bacterial strains
By S76-3 bacterial strains in after NA medium cultures 48h, it is seen that bacterium colony is milky on NA culture mediums, edge is not advise
Then shape, bacterium colony rough surface is opaque, and bacterium colony is sticky and in accordion projection (see Fig. 1).Gram's staining is the positive, there is interior
Sprout spore.SEM observation shows that thalline is in rod-short (see Fig. 3), and transmission electron microscope observation shows, the bacterium
Strain flagellum Zhousheng (see Fig. 4).
(2) S76-3 molecular biology identification
By S76-3 bacterial strains in after NB medium cultures 48h, using 10mM tris-HCl (purchased from the production of Amresco companies
Product) and 1mM EDTA (be purchased from Mdbio Products) extracting method (de Silva et al.1998) extract genomic DNA,
Phenol chloroform-isoamyl alcohol (25 is used after extraction:24:1) extracting and TER dissolvings.Using primer amplified 16s rDNA and send
Hua Da company is sequenced.Sequencing sequence length is 1447bp, and sequence number is SEQ ID NO.1.
The DNA sequence dna of sequencing primer：
16S rDNA (forward primer)：AGAGTTTGATCCTGGCTC
16S rDNA (reverse primer)：AAGGAGGTGATCCAGCCGCA
In Genbank databases, the 16s rDNA sequences of S76-3 bacterial strains are retrieved using BLAST, itself and Xie Dian is found
Afnyloliquefaciens and bacterial strain similarity in bacillus subtilis Pseudomonas are higher, to further determine that the hereditary capacity of the bacterial strain, choose
Similarity is more than 95% 13 plants of phylogenetic tree constructions of bacterial strain in matching result (see 5).
(3) physiological and biochemical test of S76-3 bacterial strains
S76-3 bacterial strain Physiology and biochemistry results are shown：Gram's staining is positive, and gelatin liquefaction, milk are peptonized, starch water
Solution, Tween80 hydrolysis, cellulose utilization, citrate production alkali test are the positive, produce H2S experiments are feminine gender, can utilize Portugal
Grape sugar, fructose, sucrose, lactose, xylose, arabinose, mannose, maltose, inositol, sorbierite production acid, it is impossible to utilize sandlwood
Sugar production acid, has tolerance to 5%-7% NaCl, does not have tolerance to 10% NaCl, can not be grown at 51 DEG C.
The physiological and biochemical test of table 1S76-3 bacterial strains
The identification of strain classification status of the present invention, with reference to classical microbiological classification handbook：Such as George
M.Garrity《Bergey’s Mannual of Systematic Bacteriology》Vol. VIII, the content of version in 1974.
According to its morphological feature and physiological and biochemical property, and 16S rDNA gene order comparison results, through this hair of Bacillus subtilis
Bright separated bacterial strain is a bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and applicant is by by this
The Strain Designation of separation was bacillus amyloliquefaciens S76-3, Bacillus amyloliquefaciens S76-3, in 2014
The bacterial strain is delivered Chinese Wuhan Wuhan Universitys Chinese Typical Representative Organism Depositary (CCTCC) preservation, its preservation by July 3
Number be CCTCC NO：M 2014315.
The bacillus amyloliquefaciens S76-3 of embodiment 3 bacteriostatic test
By opposite culture method in culture dish (He et al.2008), detection S76-3 bacterial strains are to Different Kinds of Pathogens fungi (table 1
In the medium bacterial strain for being used to test be conventional bacterial strain) inhibitory action.As a result show, the bacterial strain not only has to Fusarium graminearum
Have inhibitory action, and can significantly suppress to include Fusarium oxysporum, it is Fusarlum poae, sclerotinite, Rhizoctonia solani Kuhn, big beautiful
Including Verticillium dahliae, fusarium moniliforme, alternaric bacteria, Aspergillus flavus and Monilinia fructicola etc. a variety of disease funguses growth (table
2).Except verticillium dahliae bacteriostasis rate is 44% (verticillium dahliae mycelia is in slow-growing in PDA culture medium), to other fungies
Bacteriostasis rate is above 65%.
The broad-spectrum antibacterial of table 2S76-3 bacterial strains
Note：Bacteriostasis rate is the average value of three repetition acquired results in table 2.
The optimization of the bacillus S76-3 high yield gemma culture mediums of embodiment 4：
Using gemma number as screening index, first by compare 4 kinds of culture mediums (YPG, Landy, culture medium I and culture medium II,
3) culture medium prescription is shown in Table determines that medium ii is spore production highest culture medium, the medium exchange based on medium ii,
Using experiment of single factor from numerous carbon sources (for example soluble starch, sucrose, glucose, lactose, maltose, brown sugar, corn flour,
Wheat flour, glycerine)；Nitrogen source (such as dusty yeast, peptone, peanut powder, mung bean flour, bean powder, urea, ammonium sulfate, potassium nitrate)；It is micro-
Secondary element (such as CaCO3、MgSO4·7H2O、NaCl、K2HPO4、KH2PO4) screen in the factor larger is influenceed on spore production
The factor carry out experimental design, using PB test (Plackett Burman, Bi Jingying etc., 2010) from the factor filtered out really
It is fixed that three maximum class important factors are influenceed on spore production：Carbon source (brown sugar), nitrogen source (bean powder) and inorganic ions (calcium carbonate),
Utilize the response surface design of steepest hill climbing test (Path of Steepest ascent, red bayberry etc., 2009) and optimization maximum
Optimum Experiment, the functional relation come between data fitting and response obtains regression equation (3 significant factor brown sugar, CaCO3、
Bean powder is respectively independent variable a, b, c, and spore production is response Y, obtains secondary multinomial regression equation：Y=9.750+1.156a-
1.042b+0.365c-1.115a2-1.1885b2-0.573c2- 1.000ab-0.0625ac-0.583bc), pass through regression equation
Analysis devise optimal fermentation medium i.e. brown sugar soybean medium (formula is shown in Table 3), it is fresh by above-mentioned fermentation medium
Bacillus S76-3 gemma number is up to 10 in zymotic fluid10Cfu/ml, optimal value is 10.58 × 1010cfu/ml。
Table 3S76-3 strain culturing used mediums
Specific experiment is as described below：
(1) it is used for the basal medium screening that single-factor is screened：Contrast YPG, Landy, culture medium I, II 4 kinds of culture medium not
With culture medium spore production, determine medium ii (yeast extract 10g/L, soluble starch 10g/L, NaCl 3g/L,
MgSO4·7H2O 3g/L、CaCO3Culture medium based on 1g/L), for single-factor screening.
(2) it is used for the carbon source factorial experiment of single factor experiment：By single factor experiment, from soluble starch, sucrose, grape
Brown sugar is filtered out in sugar, lactose, maltose, brown sugar, corn flour, wheat flour, glycerine for S76-3 optimum carbon sources.
(3) it is used for the nitrogen source factorial experiment of single factor experiment：By single factor experiment, from dusty yeast, peptone, peanut
It is S76-3 optimum nitrogen sources that bean powder and potassium nitrate are filtered out in powder, mung bean flour, bean powder, urea, ammonium sulfate, potassium nitrate.
(4) it is used for the micro- factorial experiment of single factor experiment：By single factor experiment, from calcium carbonate (CaCO3), sulphur
Sour magnesium (MgSO4·7H2O), sodium chloride (NaCl), potassium hydrogen phosphate (K2HPO4), potassium dihydrogen phosphate (KH2PO4) middle determination calcium carbonate
(CaCO3) maximum trace element is influenceed for S76-3 spore productions.
(5) using PB (Plackett Burman) experiments, the important factor of screening influence S76-3 spore productions tests table
Bright brown sugar, bean powder and calcium carbonate (CaCO3) notable is influenceed on spore production on S76-3, to promoting S76-3 sporulations that there is product
Pole meaning.By steepest climbing experiment (Path of Steepest ascent), it is determined that added in 1L culture mediums brown sugar 21g,
Bean powder 10g, CaCO3Spore production reaches highest during 6g.Utilize response surface analysis experiment (Response surface
Analysis), the functional relation between data fitting and response obtains regression equation, final by the analysis of regression equation
Go out S76-3 fermentation optimal medium formulas：Brown sugar 23.3g/L, CaCO34.9g/L, bean powder 11.1g/L, KNO38g/L,
KH2PO40.5g/L, K2HPO41.2g/L, MgSO4·7H2O 5g/L, NaCl 3g/L.Can using the formula, fermenting liquid gemma number
Up to 1010More than cfu/ml, optimal value is 10.58 × 1010cfu/ml.By the spore production under different condition of culture, it is determined that
30 DEG C of the most suitable cultivation temperature of S76-3 bacterial strains, optimal pH is 7.2, and the bacterial strain is through Shaking culture (being conventional method), one grade fermemtation
Tank (being conventional method), second order fermentation tank (being conventional method) fermentation test, obtain bacterium solution clear water and dilute 10 times (by volume
Than dilution, to gemma number final concentration of 109Cfu/ml the field control of wheat scab is can be directly used for after).
Embodiment 5S76-3 strain fermentations supernatant is tested the inhibitory action of wheat scab spore germination
Will the gained zymotic fluid of embodiment 4 centrifuge after filter (0.22 μm), by sterile supernatant with YPG culture mediums (being shown in Table 3)
Successively dilution 2,3,4,5,10,20,50 times, control is used as using the YPG culture mediums that are not added with fermented supernatant fluid and the identical multiple of dilution.
Sterile supernatant after dilution respectively takes 180 μ l to sequentially add in the different culture hole of 96 holes sterilizing culture plate, to add same volume
Long-pending YPG nutrient solutions often add Fusarium graminearum spore liquid (Xu et al.2002) 20 μ l of fresh collection as control in hole
(1×106cfu/ml).Culture plate seals the sprouting that spore is observed after being cultivated 5-7 days at 100rpm, 28 DEG C with aseptic thin-film
Situation, obtains result as shown in Figure 6 (please the result to Fig. 6 is explained).After culture 5 days, control group spore sprouts length completely
Into mycelia (see the CK in Fig. 6), the sterile supernatant group of addition S76-3 fermentations shows that sickle-like bacteria spore germination is substantially suppressed；Hair
Ferment supernatant, which dilutes, can still completely inhibit sickle-like bacteria spore germination after 10 times (volume ratios), 50 times of (volume ratio) fungistatic effects of dilution are still
Substantially, rarely seen subregion grows aerial hyphae (see the S76-3 in Fig. 6).After showing that S76-3 fermented supernatant fluids sterilize through suction filtration
Diluting different multiples still has efficient bacteriostasis.
Inhibitory action of the embodiment 6S76-3 strain fermentations supernatant to Fusarium graminearum mycelia
200 μ l are taken to sprout 12h freshly prepd Fusarium graminearum spore liquid (2 × 105Cfu/ml 200 μ l YPG) is gone to
In culture medium, the sterile supernatant (suction filtration that 100 μ l dilute S76-3 bacterial strains prepared by 10 times of the present invention is added in the culture medium
It is degerming), the YPG culture mediums to be not added with metabolite dilution are cultivated after 24h with micro- as control at 150rpm, 28 DEG C
Sem observation mycelia changes, and obtains result as shown in Figure 7：(see the A in Fig. 7), mycelial growth is normal in control group, even thickness,
Without significant change；Mycelial growth is substantially lopsided after fermented supernatant fluid processing 12h after dilution, and mycelia is expanded, part cystite
There is fold in surface (see the B in Fig. 7).
The field of embodiment 7S76-3 bacterial strain fermentation liquors is to preventing and treating the experiment of wheat scab
The field test of wheat scab is carried out in Hua Zhong Agriculture University's experiment greenhouse, and planting material is peace agriculture 8455 and China
Wheat 13 (being conventional variety), cell spray testing is carried out using RANDOMIZED BLOCK DESIGN.Field test is divided into three processing, is respectively
S76-3 bacterial strains dilute 10 times of supernatants, powder of carbendazim (commodity bactericide, Canada it is general it is sharp this, wettable powder, effectively into
Divide content 80%) and clear water, each processing 4 repetitions altogether.Each plot area is 4m2(2×2m).The wheat early flowering season is at dusk
6 points start spray testing, and every mu of spray amount is 6-7.5L, by zymotic fluid, the carbendazim of the S76-3 bacterial strains that 10 times are diluted with clear water
Wettable powder (consumption of the 750g/ hectares indicated by commodity packaging is used), clear water are sprayed on different disposal cell respectively.
Spray after 1h, spray freshly prepared Fusarium graminearum spore liquid (1 × 104Cfu/ml) in the wheat head, the wheat head is made to moisten but anhydrous
Pearl slide, after sprinkling every 5 days flood irrigation greenhouses once, daily 19:00- next day 7:00 carries out Greenhouse moisturizing, daily 7:00 opens
Open greenhouse surrounding about 2m height aeration-cooling, water spray moisturizing once, is uniformly distributed the globule with the wheat head but do not fallen for standard per 3h.Examination
It is that day temperature is 22-28 DEG C to test the control of greenhouse condition, and relative humidity is 60%-80%；Evening temperature is 12-20 DEG C, relatively
Humidity is 95%-100%.To ensure that preventive effect is stable, the zymotic fluids of S76-3 bacterial strains is sprayed for the first time after three days by same concentration weight
Multiple spraying.Inoculation (spraying) removes film when seeing that the control group wheat head has slight pink and stops moisturizing for 6-7 days afterwards,
Plant and observe under natural conditions.The disease index and severity of head blight are investigated in inoculation (spraying) after 21 days.Wheat is harvested
Detection harvests the content of toxins in seed afterwards.
As a result show, the zymotic fluid of S76-3 bacterial strains can effectively suppress wheat scab in field and fall ill (see Fig. 8),
After zymotic fluid spraying through S76-3 bacterial strains, the state of an illness of 13 two wheat breeds of peace agriculture 8455 and Hua Mai (for conventional commercial variety)
Index is significantly reduced compared with clear water control group, and preventive effect is respectively 59.71% and 45.91%, is superior to many of commercialization
Bacterium spirit dilution (36.74%, 31.98%).The zymotic fluid of S76-3 bacterial strains is suppressing the same of wheat scab pathogen morbidity
When, the 100-grain weight of seed showed increased compared with the control；Pacify agriculture 8455 and Hua Mai 13 rate of growth point after the processing of S76-3 bacterium solutions
Wei 16.32% and 17.91%；The content of toxins in wheat is detected after harvesting wheat, compared with the control, the poisoning of seed is harvested
Cellulose content inhibiting rate is respectively up to 73.65% and 52.17%, better than carbendazim dilution treatment group (table 4).
The S76-3 bacterial strain fermentation liquors of the present invention of table 4 prevent and treat wheat scab plot experiment result
Bibliography：
The main medium of Bi Jingying etc. (2010) .Plackett-Burman design methods screening influence ganoderma lucidum zinc-rich ability
Component Agriculture of Anhui science, 38 (10):5335-5337
Red bayberry etc., the optimization Fujian Normal University journal of (2009) bacillus thuringiensis LLB19 fermentation mediums is (certainly
Right science version) .25 (2):75-81.
de Silva S,Petterson B,Aquino de Muro M,Priest FG(1998)A DNA probe
for the detection and identification of Bacillus sporothermodurans using the
16S-23S rDNA spacer region and phylogenetic analysis of some field isolates
of Bacillus which form highly heat resistant spores.Syst Appl Microbiol21：
398-407
He J, Boland GJ, Zhou T (2008) Concurrent selection for microbial
Suppression of Fusarium graminearum, Fusarium head blight and deoxynivalenol
in wheat.J Appl Microbiol 106：1805-1817
Xu Y-B, Li H-P, Zhang J-B, Song B, Chen F-F, Duan X-J, Xu H-Q, Liao Y-C
(2010)Disruption of the chitin synthase gene CHS1 from Fusarium asiaticum
results in an altered structure of cell walls and reduced virulence.Fungal
Genet Biol 47：205-215 .
Claims (4)
1. the one plant of bacillus amyloliquefaciens resistant to wheat scab (Bacillus amyloliquefaciens) bacterium
Strain S76-3, is deposited in China typical culture collection center, and deposit number is CCTCC NO：M2014315.
2. bacillus amyloliquefaciens S76-3 as claimed in claim 1 fermentation process, it is characterised in that described fermentation side
Culture medium in method includes following ingredients：Brown sugar 23.3g/L, bean powder 11.1g/L, CaCO34.9g/L, KNO38g/L, KH2PO4
0.5g/L, K2HPO41.2g/L, MgSO4·7H2O 5g/L, NaCl 3g/L, supplement distilled water to 1L, the pH=of culture medium
7.2。
3. a kind of microbial bacterial agent for preventing and treating wheat scab, it is characterised in that the microbial inoculum includes preserving number for CCTCC NO：M
2014315 bacillus amyloliquefaciens (Bacillus amyloliquefaciens) S76-3 bacterial strains.
4. the bacillus amyloliquefaciens S76-3 bacterial strain resistant to wheat scab described in claim 1 is in gibberella saubinetii
Application in disease preventing and treating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410778424.0A CN104673705B (en) | 2014-07-06 | 2014-12-15 | One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2014103216760 | 2014-07-06 | ||
| CN201410321676 | 2014-07-06 | ||
| CN201410778424.0A CN104673705B (en) | 2014-07-06 | 2014-12-15 | One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104673705A CN104673705A (en) | 2015-06-03 |
| CN104673705B true CN104673705B (en) | 2017-08-15 |
Family
ID=53309299
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410778424.0A Active CN104673705B (en) | 2014-07-06 | 2014-12-15 | One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673705B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105439727A (en) * | 2015-12-21 | 2016-03-30 | 安徽省司尔特肥业股份有限公司 | Biological organic fertilizer for controlling wheat scab and preparation method thereof |
| CN105753568A (en) * | 2016-01-26 | 2016-07-13 | 安徽省司尔特肥业股份有限公司 | Functional biofertilizer for preventing and treating fruit tree gummosis and preparation method thereof |
| CN107347919A (en) * | 2017-08-14 | 2017-11-17 | 南阳市农业科学院 | A kind of composite bactericide for preventing and treating wheat scab |
| CN109182197B (en) * | 2018-09-29 | 2021-04-27 | 淮阴工学院 | Bacillus amyloliquefaciens CPLK1314 and application thereof in feed storage |
| CN112608860B (en) * | 2020-12-17 | 2022-06-28 | 河南省农业科学院植物保护研究所 | Bacillus amyloliquefaciens YB130 and application thereof |
| CN113774002B (en) * | 2021-11-02 | 2024-03-01 | 浙江珲达生物科技有限公司 | Bacillus amyloliquefaciens culture medium and application thereof |
| CN116267995B (en) * | 2023-02-28 | 2023-11-03 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Sterilization composition for preventing and treating wheat scab and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101379708B1 (en) * | 2012-02-09 | 2014-04-01 | 전남대학교산학협력단 | Bacillus amyloliquefaciens EML-CAP3 strain, composition for control plant diseases and control method of plant diseases with same |
| CN102604864B (en) * | 2012-03-09 | 2013-06-05 | 陕西加伦多作物科学有限公司 | Microbial bactericide and application thereof |
| CN103695356B (en) * | 2013-12-24 | 2016-03-23 | 河北省科学院生物研究所 | A kind of bacillus amyloliquefaciens and microbiobacterial agent and application thereof |
-
2014
- 2014-12-15 CN CN201410778424.0A patent/CN104673705B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104673705A (en) | 2015-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055281B (en) | Bacillus belgii ZF2 and application thereof in plant disease control | |
| CN104673705B (en) | One plant prevent and treat wheat scab bacillus amyloliquefaciens and its application | |
| CN100334201C (en) | Bacillus subtilis and its uses | |
| CN104164394B (en) | The bacterial strain of one strain antagonistic phytopathogen and application thereof | |
| CN103695356B (en) | A kind of bacillus amyloliquefaciens and microbiobacterial agent and application thereof | |
| CN104342394B (en) | One plant of Siam bacillus and its application in terms of preventing and treating Fusarium graminearum | |
| CN104403962B (en) | Application in terms of one plant of Te Jila bacillus and its prevention and treatment Fusarium graminearum | |
| CN106434499B (en) | A kind of actinomycetes strain KN37 and its application | |
| CN103756931A (en) | Paenibacillus kribbensis and its application | |
| CN110713951B (en) | Pantoea agglomerans strain and application thereof | |
| CN102433282A (en) | Bacillus subtilis NB12, as well as culture method and application thereof | |
| CN101845410A (en) | Endo-bacillus subtilis TR21 of plants and application thereof | |
| CN101531971B (en) | Bacillus subtilis and application thereof in prevention and treatment of continuous cropping obstacle of greenhouse vegetable | |
| CN106867934B (en) | One plant of Siam bacillus and its application in prevention and treatment plant powdery mildew | |
| CN104974965B (en) | Bacillus subtilis JN005 and its application in preventing rice blast | |
| CN111534460B (en) | Preparation method and application of bacillus beiLeisi capable of efficiently antagonizing fusarium graminearum | |
| CN111647522B (en) | Entomopathogenic nematode symbiotic bacterial strain for inhibiting various plant fungal diseases and application thereof | |
| CN104342395B (en) | One plant height ground bacillus and its application in terms of preventing and treating Fusarium graminearum | |
| CN105132296B (en) | A kind of hook-shaped trichoderma strain and its application | |
| CN105176894A (en) | Bacillus amyloliquefaciens for controlling gray mold of tomato and microbial inoculant thereof | |
| CN105199996A (en) | Bacillus amyloliquefaciens for controlling tomato gray mould and application of bacillus amyloliquefaciens | |
| CN106701623A (en) | Bacillus atrophaeus antagonistic to lycium chinensis root rot and application of bacillus atrophaeus | |
| CN100512651C (en) | Biocontrol fungus for preventing and controlling plant mycosis and its preparation process | |
| CN101942403B (en) | Bacillus pumilus as well as culture method and application thereof | |
| CN105349455A (en) | Streptomyces malaysiensis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |